Saudi Community-Based Screening Study on Genetic Variants in β-Cell Dysfunction and Its Role in Women with Gestational Diabetes Mellitus
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sanction of Ethical and Consent Approvals
2.2. Enrollment of Saudi Participants
2.3. Sample Size
2.4. Diagnosis Screening of GDM and Control Participants
2.5. Anthropometric Measurements
2.6. Serum Parameters
2.7. DNA-PCR Analysis
2.8. Validation Using Sanger Sequencing
2.9. Statistical Analysis
3. Results
3.1. Pre- and Post- Appointment Data for Saudi Women
3.2. HWE Analysis
3.3. Genotype Frequencies
3.4. Allele Frequencies
3.5. Multiple Logistic Regression Analysis
3.6. ANOVA Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Galicia-Garcia, U.; Benito-Vicente, A.; Jebari, S.; Larrea-Sebal, A.; Siddiqi, H.; Uribe, K.B.; Ostolaza, H.; Martín, C. Pathophysiology of type 2 diabetes mellitus. Int. J. Mol. Sci. 2020, 21, 6275. [Google Scholar] [CrossRef] [PubMed]
- Elsherbini, A.M.; Alsamman, A.M.; Elsherbiny, N.M.; El-Sherbiny, M.; Ahmed, R.; Ebrahim, H.A.; Bakkach, J. Decoding Diabetes Biomarkers and Related Molecular Mechanisms by Using Machine Learning, Text Mining, and Gene Expression Analysis. Int. J. Environ. Res. Public Health 2022, 19, 13890. [Google Scholar] [CrossRef]
- Islam, F.; Khadija, J.F.; Islam, R.; Shohag, S.; Mitra, S.; Alghamdi, S.; Babalghith, A.O.; Theyab, A.; Rahman, M.T.; Akter, A. Investigating polyphenol nanoformulations for therapeutic targets against diabetes mellitus. Evid.-Based Complement. Altern. Med. 2022, 2022, 5649156. [Google Scholar] [CrossRef] [PubMed]
- Rajabi, A.; Khajehlandi, M.; Siahkuhian, M.; Akbarnejad, A.; Khoramipour, K.; Suzuki, K. Effect of 8 Weeks Aerobic Training and Saffron Supplementation on Inflammation and Metabolism in Middle-Aged Obese Women with Type 2 Diabetes Mellitus. Sports 2022, 10, 167. [Google Scholar] [CrossRef]
- Khan, I.A.; Movva, S.; Shaik, N.A.; Chava, S.; Jahan, P.; Mukkavali, K.K.; Kamineni, V.; Hasan, Q.; Rao, P. Investigation of Calpain 10 (rs2975760) gene polymorphism in Asian Indians with gestational diabetes mellitus. Meta Gene 2014, 2, 299–306. [Google Scholar] [CrossRef]
- Zhou, Q.; Wang, Y.; Gu, Y.; Li, J.; Wang, H.; Leng, J.; Li, W.; Yu, Z.; Hu, G.; Ma, R.C.W. Genetic variants associated with beta-cell function and insulin sensitivity potentially influence bile acid metabolites and gestational diabetes mellitus in a Chinese population. BMJ Open Diabetes Res. Care 2021, 9, e002287. [Google Scholar] [CrossRef]
- Kamińska, K.; Stenclik, D.; Błażejewska, W.; Bogdański, P.; Moszak, M. Probiotics in the Prevention and Treatment of Gestational Diabetes Mellitus (GDM): A Review. Nutrients 2022, 14, 4303. [Google Scholar] [CrossRef] [PubMed]
- Zhang, D.; Cheng, D.; Cao, Y.; Su, Y.; Chen, L.; Liu, W.; Yu, Y.; Xu, X. The effect of dietary fiber supplement on prevention of gestational diabetes mellitus in women with pre-pregnancy overweight/obesity: A randomized controlled trial. Front. Pharmacol. 2022, 13, 922015. [Google Scholar] [CrossRef]
- Mellado-Gil, J.M.; Lorenzo, P.I.; Cobo-Vuilleumier, N.; López-Noriega, L.; Martín-Montalvo, A.; Gómez, I.d.G.H.; Ceballos-Chávez, M.; Gómez-Jaramillo, L.; Campos-Caro, A.; Romero-Zerbo, S.Y. The type 2 diabetes-associated HMG20A gene is mandatory for islet beta cell functional maturity. Cell Death Dis. 2018, 9, 279. [Google Scholar] [CrossRef] [PubMed]
- Laakso, M.; Fernandes Silva, L. Genetics of Type 2 Diabetes: Past, Present, and Future. Nutrients 2022, 14, 3201. [Google Scholar] [CrossRef]
- Russo, G.T.; Giorda, C.B.; Cercone, S.; Nicolucci, A.; Cucinotta, D.; Group, B.S. Factors associated with beta-cell dysfunction in type 2 diabetes: The BETADECLINE study. PLoS ONE 2014, 9, e109702. [Google Scholar]
- Suleiman, M.; Marselli, L.; Cnop, M.; Eizirik, D.L.; De Luca, C.; Femia, F.R.; Tesi, M.; Del Guerra, S.; Marchetti, P. The role of beta cell recovery in type 2 diabetes remission. Int. J. Mol. Sci. 2022, 23, 7435. [Google Scholar] [CrossRef]
- Thomsen, S.K.; Gloyn, A.L. The pancreatic β cell: Recent insights from human genetics. Trends Endocrinol. Metab. 2014, 25, 425–434. [Google Scholar] [PubMed]
- Kettunen, J.L.; Tuomi, T. Human physiology of genetic defects causing beta-cell dysfunction. J. Mol. Biol. 2020, 432, 1579–1598. [Google Scholar]
- Rattanatham, R.; Settasatian, N.; Komanasin, N.; Kukongviriyapan, U.; Sawanyawisuth, K.; Intharaphet, P.; Senthong, V.; Settasatian, C. Association of combined TCF7L2 and KCNQ1 gene polymorphisms with diabetic micro-and macrovascular complications in type 2 diabetes mellitus. Diabetes Metab. J. 2021, 45, 578–593. [Google Scholar] [CrossRef] [PubMed]
- Al-Rifai, R.H.; Abdo, N.M.; Paulo, M.S.; Saha, S.; Ahmed, L.A. Prevalence of gestational diabetes mellitus in the middle east and North Africa, 2000–2019: A Systematic Review, Meta-Analysis, and Meta-Regression. Front. Endocrinol. 2021, 12, 668447. [Google Scholar]
- Committee, A.D.A.P.P.; Committee:, A.D.A.P.P. 3. Prevention or delay of type 2 diabetes and associated comorbidities: Standards of Medical Care in Diabetes—2022. Diabetes Care 2022, 45, S39–S45. [Google Scholar]
- Hassan, S.M.; Iyer, A.P.; Al-Abbasi, F.A. Screening For Glucokinase (Gck) gene mutation in gestational diabetes women in western region of Saudi Arabia. Br. J. Med. Med. Res. 2016, 13, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Al-Hakeem, M.M.; Abotalib, Z.; Alharbi, K.K.; Khan, I.A.; Mohammed, A.A. Insertion and deletion polymorphism in the alpha-2B adrenoceptor gene in pregnant women ripens gestational diabetes mellitus. Saudi J. Biol. Sci. 2016, 23, 128–134. [Google Scholar] [CrossRef]
- Alharbi, K.K.; Abudawood, M.; Khan, I.A. Amino-acid amendment of arginine-325-tryptophan in rs13266634 genetic polymorphism studies of the SLC30A8 gene with type 2 diabetes-mellitus patients featuring a positive family history in the Saudi population. J. King Saud Univ.-Sci. 2021, 33, 101258. [Google Scholar]
- Moyce, B.L.; Dolinsky, V.W. Maternal β-cell adaptations in pregnancy and placental signalling: Implications for gestational diabetes. Int. J. Mol. Sci. 2018, 19, 3467. [Google Scholar] [CrossRef] [PubMed]
- Rosik, J.; Szostak, B.; Machaj, F.; Pawlik, A. The role of genetics and epigenetics in the pathogenesis of gestational diabetes mellitus. Ann. Hum. Genet. 2020, 84, 114–124. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Ning, C.; Mu, J.; Li, D.; Ma, Y.; Meng, X. Role of Wnt signaling pathways in type 2 diabetes mellitus. Mol. Cell. Biochem. 2021, 476, 2219–2232. [Google Scholar] [PubMed]
- Huopio, H.; Cederberg, H.; Vangipurapu, J.; Hakkarainen, H.; Pääkkönen, M.; Kuulasmaa, T.; Heinonen, S.; Laakso, M. Association of risk variants for type 2 diabetes and hyperglycemia with gestational diabetes. Eur. J. Endocrinol. 2013, 169, 291–297. [Google Scholar] [PubMed]
- Michalak-Wojnowska, M.; Gorczyca-Siudak, D.; Gorczyca, T.; Mosiewicz, B.; Kwaśniewska, A.; Filip, A.; Mosiewicz, J. Association between rs7901695 and rs7903146 polymorphisms of the TCF7L2 gene and gestational diabetes in the population of Southern Poland. Ginekol. Pol. 2016, 87, 745–750. [Google Scholar] [CrossRef]
- Shalabi, T.A.; Amr, K.S.; Shaker, M.M. Are single nucleotide polymorphisms rs7903146 and rs12255372 in transcription factor 7-like 2 gene associated with an increased risk for gestational diabetes mellitus in Egyptian women? J. Genet. Eng. Biotechnol. 2021, 19, 169. [Google Scholar] [CrossRef]
- Reyes-López, R.; Pérez-Luque, E.; Malacara, J.M. Metabolic, hormonal characteristics and genetic variants of TCF7L2 associated with development of gestational diabetes mellitus in Mexican women. Diabetes/Metab. Res. Rev. 2014, 30, 701–706. [Google Scholar]
- Hameed, T.; Khan, Z.; Imran, M.; Ali, S.; Albegali, A.A.; Ullah, M.I.; Ejaz, H. Associations of transcription factor 7-Like 2 (TCF7L2) gene polymorphism in patients of type 2 diabetes mellitus from Khyber Pakhtunkhwa population of Pakistan. Afr. Health Sci. 2021, 21, 15–22. [Google Scholar] [CrossRef]
- Ye, D.; Fei, Y.; Ling, Q.; Xu, W.; Zhang, Z.; Shu, J.; Li, C.; Dong, F. Polymorphisms in TCF7L2 gene are associated with gestational diabetes mellitus in Chinese Han population. Sci. Rep. 2016, 6, 1–8. [Google Scholar] [CrossRef]
- Rizk, N.; Rooshenas, A.A.; Fouladi, E.; Rooshenas, F.A.; Al-Ali, K.; Al-Khinji, M.; Saleh, R.; Khder, A. The associations of transcription factor 7-like 2 [TCF7L2] gene with gestational diabetes mellitus in state of Qatar. In Proceedings of the Qatar Foundation Annual Research Forum, Bloomsbury Qatar Foundation Journals. Doha, Qatar, 20–22 November 2011; p. BMP8. [Google Scholar]
- Huerta-Chagoya, A.; Vázquez-Cárdenas, P.; Moreno-Macías, H.; Tapia-Maruri, L.; Rodríguez-Guillén, R.; López-Vite, E.; García-Escalante, G.; Escobedo-Aguirre, F.; Parra-Covarrubias, A.; Cordero-Brieño, R.; et al. Genetic determinants for gestational diabetes mellitus and related metabolic traits in Mexican women. PLoS ONE 2015, 10, e0126408. [Google Scholar] [CrossRef]
- Shin, H.D.; Park, B.L.; Shin, H.J.; Kim, J.Y.; Park, S.; Kim, B.; Kim, S.-H. Association of KCNQ1 polymorphisms with the gestational diabetes mellitus in Korean women. J. Clin. Endocrinol. Metab. 2010, 95, 445–449. [Google Scholar]
- Zhou, Q.; Zhang, K.; Li, W.; Liu, J.; Hong, J.; Qin, S.; Ping, F.; Sun, M.; Nie, M. Association of KCNQ1 gene polymorphism with gestational diabetes mellitus in a Chinese population. Diabetologia 2009, 52, 2466–2468. [Google Scholar] [PubMed]
- Fatima, S.S.; Chaudhry, B.; Khan, T.A.; Farooq, S. KCNQ1 rs2237895 polymorphism is associated with Gestational Diabetes in Pakistani Women. Pak. J. Med. Sci. 2016, 32, 1380. [Google Scholar] [CrossRef]
- Majcher, S.; Ustianowski, P.; Malinowski, D.; Czerewaty, M.; Tarnowski, M.; Safranow, K.; Dziedziejko, V.; Pawlik, A. KCNJ11 and KCNQ1 Gene Polymorphisms and Placental Expression in Women with Gestational Diabetes Mellitus. Genes 2022, 13, 1315. [Google Scholar] [CrossRef]
- Popova, P.V.; Klyushina, A.A.; Vasilyeva, L.B.; Tkachuk, A.S.; Vasukova, E.A.; Anopova, A.D.; Pustozerov, E.A.; Gorelova, I.V.; Kravchuk, E.N.; Li, O.; et al. Association of Common Genetic Risk Variants With Gestational Diabetes Mellitus and Their Role in GDM Prediction. Front. Endocrinol. 2021, 12, 628582. [Google Scholar] [CrossRef]
- Zhang, C.; Bao, W.; Rong, Y.; Yang, H.; Bowers, K.; Yeung, E.; Kiely, M. Genetic variants and the risk of gestational diabetes mellitus: A systematic review. Hum. Reprod. Update 2013, 19, 376–390. [Google Scholar] [CrossRef] [PubMed]
- Lenin, M.; Ramasamy, R.; Kulkarani, S.; Ghose, S.; Srinivasan, A. Association of KCNJ11 (RS5219) gene polymorphism with biochemical markers of glycemic status and insulin resistance in gestational diabetes mellitus. Meta Gene 2018, 16, 134–138. [Google Scholar]
- Wu, L.; Cui, L.; Tam, W.H.; Ma, R.C.; Wang, C.C. Genetic variants associated with gestational diabetes mellitus: A meta-analysis and subgroup analysis. Sci. Rep. 2016, 6, 30539. [Google Scholar] [CrossRef]
- Kang, S.; Xie, Z.; Zhang, D. Association of the rs7903146 polymorphism in transcription factor 7-like 2 (TCF7L2) gene with gestational diabetes mellitus: A meta-analysis. Gynecol. Endocrinol. 2013, 29, 873–877. [Google Scholar]
- Chang, S.; Wang, Z.; Wu, L.; Lu, X.; Shangguan, S.; Xin, Y.; Li, L.; Wang, L. Association between TCF 7L2 polymorphisms and gestational diabetes mellitus: A meta-analysis. J. Diabetes Investig. 2017, 8, 560–570. [Google Scholar]
- Mao, H.; Li, Q.; Gao, S. Meta-analysis of the relationship between common type 2 diabetes risk gene variants with gestational diabetes mellitus. PLoS ONE 2012, 7, e45882. [Google Scholar] [CrossRef]
- Wang, B.; Xue, X. Investigations of associations between seven gene polymorphisms and gestational diabetes mellitus: Evidence from a meta-analysis. Gynecol. Obstet. Investig. 2020, 85, 229–236. [Google Scholar] [CrossRef]
- Ao, D.; Wang, H.-J.; Wang, L.-F.; Song, J.-Y.; Yang, H.-X.; Wang, Y. The rs2237892 polymorphism in KCNQ1 influences gestational diabetes mellitus and glucose levels: A case-control study and meta-analysis. PLoS ONE 2015, 10, e0128901. [Google Scholar] [CrossRef]
- Aris, N.K.M.; Ismai, N.A.M.; Mahdy, Z.A.; Ahmad, S.; Naim, N.M.; Siraj, H.H.H.; Jaafar, R.; Ishak, S.; Harun, R.; Jamal, R.; et al. An analysis of targeted single nucleotide polymorphisms for the risk prediction of gestational diabetes mellitus in a cohort of Malaysian patients. Asia-Pac. J. Mol. Med. 2011, 1, 1–8. [Google Scholar]
- Cho, Y.; Kim, T.; Lim, S.; Choi, S.; Shin, H.; Lee, H.; Park, K.; Jang, H. Type 2 diabetes-associated genetic variants discovered in the recent genome-wide association studies are related to gestational diabetes mellitus in the Korean population. Diabetologia 2009, 52, 253–261. [Google Scholar] [CrossRef] [PubMed]
- Rizk, N.M.; Rooshenas, A.A.; Rooshenas, F.A.; Fouladi, E.A.; Alali, K.A.; Khedr, A.M. The Rs12255372 variant of transcription like factor 7-like 2 [TCF7L2] is associated with an increased risk of gestational diabetes mellitus in Arab women. In Diabetes; American Diabetes Association: Arlington, VA, USA, 2011; p. A643. [Google Scholar]
- Pagán, A.; Sabater-Molina, M.; Olza, J.; Prieto-Sánchez, M.T.; Blanco-Carnero, J.E.; Parrilla, J.J.; Gil, Á.; Larqué, E. A gene variant in the transcription factor 7-like 2 (TCF7L2) is associated with an increased risk of gestational diabetes mellitus. Eur. J. Obstet. Gynecol. Reprod. Biol. 2014, 180, 77–82. [Google Scholar] [CrossRef] [PubMed]
- Francaite-Daugeliene, M.; Lesauskaite, V.; Tamosiunas, A.; Jasukaitiene, A.; Velickienė, D. Genetic variants of TCF7L2 gene and its coherence with metabolic parameters in Lithuanian (Kaunas district) women population with previously diagnosed gestational diabetes mellitus compared to general population. Diabetes Res. Clin. Pract. 2021, 172, 108636. [Google Scholar] [CrossRef]
- Hasan, M.; MA, H.; K NH, P.S.; Aktar, Y.; Sultana, N.; Jahan, S. TCF7L2 gene rs7903146 polymorphism is observed in gestational diabetes mellitus in Bangladesh. Integr. Obes. Diabetes 2016, 2. [Google Scholar] [CrossRef]
- Klein, K.; Haslinger, P.; Bancher-Todesca, D.; Leipold, H.; Knöfler, M.; Handisurya, A.; Kautzky-Willer, A.; Worda, C. Transcription factor 7-like 2 gene polymorphisms and gestational diabetes mellitus. J. Matern.-Fetal Neonatal Med. 2012, 25, 1783–1786. [Google Scholar] [CrossRef]
- Lauenborg, J.; Grarup, N.; Damm, P.; Borch-Johnsen, K.; Jørgensen, T.; Pedersen, O.; Hansen, T. Common type 2 diabetes risk gene variants associate with gestational diabetes. J. Clin. Endocrinol. Metab. 2009, 94, 145–150. [Google Scholar] [CrossRef] [PubMed]
- Kwak, S.H.; Kim, T.H.; Cho, Y.M.; Choi, S.H.; Jang, H.C.; Park, K.S. Polymorphisms in KCNQ1 are associated with gestational diabetes in a Korean population. Horm. Res. Paediatr. 2010, 74, 333–338. [Google Scholar] [CrossRef]
- Kasuga, Y.; Hata, K.; Tajima, A.; Ochiai, D.; Saisho, Y.; Matsumoto, T.; Arata, N.; Miyakoshi, K.; Tanaka, M. Association of common polymorphisms with gestational diabetes mellitus in Japanese women: A case-control study. Endocr. J. 2017, 64, 463–475. [Google Scholar] [PubMed]
- Zhang, W.; Wang, H.; Guan, X.; Niu, Q.; Li, W. Variant rs2237892 of KCNQ1 is potentially associated with hypertension and macrovascular complications in type 2 diabetes mellitus in a Chinese Han population. Genom. Proteom. Bioinform. 2015, 13, 364–370. [Google Scholar] [CrossRef]
- Pappa, K.I.; Gazouli, M.; Economou, K.; Daskalakis, G.; Anastasiou, E.; Anagnou, N.P.; Antsaklis, A. Gestational diabetes mellitus shares polymorphisms of genes associated with insulin resistance and type 2 diabetes in the Greek population. Gynecol. Endocrinol. 2011, 27, 267–272. [Google Scholar] [PubMed]
- Kanthimathi, S.; Chidambaram, M.; Liju, S.; Bhavadharini, B.; Bodhini, D.; Prakash, V.G.; Amutha, A.; Bhavatharini, A.; Anjana, R.M.; Mohan, V. Identification of genetic variants of gestational diabetes in South Indians. Diabetes Technol. Ther. 2015, 17, 462–467. [Google Scholar] [CrossRef] [PubMed]
- Shaat, N.; Ekelund, M.; Lernmark, Å.; Ivarsson, S.; Almgren, P.; Berntorp, K.; Groop, L. Association of the E23K polymorphism in the KCNJ11 gene with gestational diabetes mellitus. Diabetologia 2005, 48, 2544–2551. [Google Scholar]
- Acharya, S.; Al-Elq, A.; Al-Nafaie, A.; Muzaheed, M.; Al-Ali, A. Type 2 diabetes mellitus susceptibility gene TCF7L2 is strongly associated with hyperglycemia in the Saudi Arabia Population of the eastern province of Saudi Arabia. Eur. Rev. Med. Pharm. Sci. 2015, 19, 3100–3106. [Google Scholar]
- Ding, W.; Xu, L.; Zhang, L.; Han, Z.; Jiang, Q.; Wang, Z.; Jin, S. Meta-analysis of association between TCF7L2 polymorphism rs7903146 and type 2 diabetes mellitus. BMC Med. Genet. 2018, 19, 38. [Google Scholar]
- Lukács, K.; Hosszúfalusi, N.; Dinya, E.; Bakacs, M.; Madácsy, L.; Pánczél, P. The type 2 diabetes-associated variant in TCF7L2 is associated with latent autoimmune diabetes in adult Europeans and the gene effect is modified by obesity: A meta-analysis and an individual study. Diabetologia 2012, 55, 689–693. [Google Scholar] [CrossRef]
- Ng, M.C.; Park, K.S.; Oh, B.; Tam, C.H.; Cho, Y.M.; Shin, H.D.; Lam, V.K.; Ma, R.C.; So, W.Y.; Cho, Y.S. Implication of genetic variants near TCF7L2, SLC30A8, HHEX, CDKAL1, CDKN2A/B, IGF2BP2, and FTO in type 2 diabetes and obesity in 6719 Asians. Diabetes 2008, 57, 2226–2233. [Google Scholar]
- Wen, W.; Zheng, W.; Okada, Y.; Takeuchi, F.; Tabara, Y.; Hwang, J.-Y.; Dorajoo, R.; Li, H.; Tsai, F.-J.; Yang, X. Meta-analysis of genome-wide association studies in East Asian-ancestry populations identifies four new loci for body mass index. Hum. Mol. Genet. 2014, 23, 5492–5504. [Google Scholar] [PubMed]
Threshold for Diagnosis | Molarity Values (mmol/L) | Concentrated Values (mg/dL) |
---|---|---|
Fasting | 5.3 mmol/L | 95 mg/dL |
First Hour | 10.0 mmol/L | 180 mg/dL |
Second Hour | 8.6 mmol/L | 155 mg/dL |
Third Hour | 7.8 mmol/L | 140 mg/dL |
Gene | rs Number | SNP | Forward Primer | Reverse Primer | PCR Size | Annealing Temperature | Restriction Enzyme | Digested Products |
---|---|---|---|---|---|---|---|---|
TCF7L2 | rs7903146 | C-T | ACAATTAGAGAGCTAAGCACTTTTTAGGTA | GTGAAGTGCCCAAGCTTCTC | 188 bp | 60 °C | RsaI | C-159/29 bp T-188 bp |
KCNQ1 | rs2237892 | C-T | CTTGTGCCCTTGTCACCCAC | GGCTTCCAGCCTCCAAGCGT | 354 bp | 64 °C | HpaII | C-269/85 bp T-354 bp |
KCNJ11 | rs5219 | A-G | GTGCCAACCGAGAGGACTCTGCA | TGGCGGGCACGGTACCTAAGCT | 181 bp | 62 °C | BfaI | A-160/21 bp G-181 bp |
Controls (n = 100) | GDM (n = 100) | p Value | |
---|---|---|---|
Age | 28.17 ± 6.68 | 33.25 ± 6.01 | <0.0001 |
Gender | 0/100 | 0/100 | 1.00 |
Weight | 72.81 ± 11.79 | 79.13 ± 12.84 | 0.003 |
Height | 157.87 ± 4.98 | 158.21 ± 5.45 | 0.64 |
BMI | 29.27 ± 4.18 | 31.68 ± 4.60 | 0.0001 |
SBP | 109.41 ± 11.91 | 120.33 ± 10.54 | <0.0001 |
DBP | 63.48 ± 8.72 | 74.09 ± 3.22 | <0.0001 |
FBG | 4.28 ± 0.42 | 5.91 ± 1.22 | <0.0001 |
PPBG | 4.56 ± 11.13 | 9.44 ± 16.51 | 0.01 |
GCT | 6.25 ± 1.06 | 9.28 ± 1.07 | <0.0001 |
OGTT (F) | 4.84 ± 0.61 | 6.61 ± 2.24 | <0.0001 |
OGTT (1) | 7.17 ± 1.74 | 10.59 ± 1.84 | <0.0001 |
OGTT (2) | 6.21 ± 1.56 | 9.33 ± 1.62 | <0.0001 |
OGTT (3) | 4.21 ± 1.16 | 5.89 ± 1.53 | <0.0001 |
Hb1Ac | 4.81 ± 0.32 | 5.42 ± 0.35 | <0.0001 |
TC | 5.11 ± 1.15 | 5.78 ± 1.32 | 0.0001 |
TG | 1.62 ± 0.92 | 2.42 ± 2.03 | 0.0004 |
HDL-C | 0.68 ± 0.25 | 0.94 ± 0.41 | 0.0001 |
LDL-C | 3.74 ± 0.98 | 3.79 ± 0.96 | 0.71 |
Medication (Insulin) | 0 | 08 (08%) | NA |
Family History of T2DM | 26 (26%) | 100 (100%) | <0.0001 |
Family History of GDM | 10 (10%) | 32 (32%) | <0.0001 |
SNPs | Minor Allele | Allele Frequency | X2 | HW p-Value |
---|---|---|---|---|
rs7903146 | T | 0.26 | 5.60 | 0.01 |
rs2237892 | T | 0.12 | 2.71 | 0.09 |
rs5219 | G | 0.09 | 2.69 | 0.10 |
Gene (rs Number) | Genotypes | GDM (n = 100) | Non-GDM (n = 100) | OR (95%CI) and p Value |
---|---|---|---|---|
TCF7L2 (rs7903146) | CC | 39 (39%) | 60 (60%) | Reference |
CT | 40 (40%) | 29 (29%) | 2.12 (1.13–3.96) and p = 0.01 | |
TT | 21 (21%) | 11 (11%) | 2.93 (1.27–6.75) and p = 0.009 | |
CT + TT vs. CC | 61 (61%) | 40 (40%) | 2.34 (1.33–4.13) and p = 0.002 | |
TT+CC vs. CT | 60 (60%) | 71 (71%) | 0.61 (0.34–1.10) and p = 0.10 | |
CC+CT vs. TT | 79 (79%) | 89 (89%) | 0.46 (0.21–1.02) and p = 0.05 | |
KCNQ1 (rs2237892) | CC | 86 (86%) | 80 (80%) | Reference |
CT | 10 (10%) | 17 (17%) | 0.54 (0.23–1.26) and p = 0.15 | |
TT | 04 (04%) | 03 (03%) | 1.24 (0.26–5.71) and p = 0.78 | |
CT + TT vs. CC | 14 (14%) | 20 (20%) | 0.65 (0.30–1.37) and p = 0.25 | |
TT+CC vs. CT | 90 (90%) | 83 (83%) | 1.84 (0.79–4.25) and p = 0.14 | |
CC+CT vs. TT | 96 (96%) | 97 (97%) | 0.74 (0.16–3.41) and p = 0.70 | |
KCNJ11 (rs5219) | AA | 62 (62%) | 85 (85%) | Reference |
AG | 32 (32%) | 13 (13%) | 3.37 (1.63–6.95) and p = 0.0006 | |
GG | 06 (06%) | 02 (02%) | 4.11 (0.81–21.06) and p = 0.06 | |
AG+GG vs. AA | 38 (38%) | 15 (15%) | 3.47 (1.75–6.86) and p = 0.0002 | |
GG+AA vs. AG | 68 (68%) | 87 (87%) | 0.31 (0.15–0.65) and p = 0.001 | |
AA+AG vs. GG | 94 (94%) | 98 (98%) | 0.31 (0.06–1.62) and p = 0.14 |
Gene (rs Number) | Genotypes | GDM (n = 100) | Control (n = 100) | OR (95%CI) and p Value |
---|---|---|---|---|
TCF7L2 (rs7903146) | C | 118 (0.59%) | 149 (74.5%) | Reference |
T | 82 (0.41%) | 51 (25.5%) | 2.03 (1.32–3.11) and p = 0.001 | |
KCNQ1 (rs2237892) | C | 182 (0.91%) | 177 (88.5%) | Reference |
T | 18 (0.09%) | 23 (11.5%) | 0.76 (0.39–1.45) and p = 0.40 | |
KCNJ11 (rs5219) | A | 156 (0.78%) | 183 (91.5%) | Reference |
G | 44 (0.22%) | 17 (8.5%) | 3.03 (1.66–5.52) and p = 0.0001 |
Covariates | R-Value a | Adjusted R Value | Unstandardized β-Coefficient for rs7903146 | Unstandardized β-Coefficient for rs2237892 | Unstandardized β-Coefficient for rs5219 | F | t-Value | p Value b |
---|---|---|---|---|---|---|---|---|
Age | 0.241 | 0.029 | −0.818 | 2.358 | −1.500 | 1.978 | 35.361 | 0.122 |
Weight | 0.171 | 0.029 | −0.376 | 3.766 | −2.268 | 0.964 | 38.068 | 0.413 |
BMI | 0.209 | 0.014 | −0.139 | 1.733 | −0.893 | 1.457 | 42.788 | 0.231 |
SBP | 0.127 | 0.016 | −1.427 | 1.429 | −1.182 | 0.527 | 70.356 | 0.665 |
DBP | 0.167 | −0.003 | 0.503 | 0.235 | −0.578 | 0.917 | 140.51 | 0.436 |
FBG | 0.145 | −0.009 | −0.108 | −0.286 | 0.057 | 0.690 | 29.950 | 0.561 |
PPBG | 0.158 | −0.005 | −2.398 | −0.373 | 3.140 | 0.823 | 3.744 | 0.484 |
GCT | 0.204 | 0.011 | 0.024 | −0.403 | −0.168 | 1.371 | 53.857 | 0.256 |
OGTT (F) | 0.072 | −0.026 | −0.124 | 0.161 | 0.207 | 0.169 | 17.759 | 0.917 |
OGTT (1) | 0.125 | −0.015 | −0.092 | 0.312 | −0.296 | 0.508 | 35.393 | 0.678 |
OGTT (2) | 0.193 | 0.007 | −0.339 | 0.540 | −0.003 | 1.238 | 36.011 | −0.152 |
OGTT (3) | 0.148 | −0.009 | 0.303 | −0.094 | 0.060 | 0.716 | 22.491 | 0.545 |
Hb1Ac | 0.117 | −0.017 | −0.010 | −0.074 | −0.024 | 0.444 | 94.096 | 0.722 |
TC | 0.203 | 0.011 | −0.334 | 0.352 | 0.086 | 1.378 | 27.721 | 0.254 |
TG | 0.216 | 0.017 | −0.454 | 0.368 | −0.438 | 1.570 | 8.894 | 0.202 |
HDL-C | 0.282 | 0.051 | −0.999 | 0.039 | 0.156 | 2.755 | 14.277 | 0.047 |
LDL-C | 0.146 | −0.009 | −0.080 | −0.088 | −0.181 | 0.698 | 25.059 | 0.556 |
TCF7L2 (rs7903146) | KCNQ1 (rs2237892) | KCNJ11 (rs5219) | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
CC (n = 39) | CT (n = 40) | TT (n = 21) | p | CC (n = 86) | CT (n = 10) | TT (n = 04) | p | AA (n = 62) | AG (n = 32) | GG (n = 06) | p | |
Age | 33.92 ± 6.37 | 32.62 ± 6.07 | 33.19 ± 5.33 | 0.63 | 32.84 ± 6.06 | 35.90 ± 5.74 | 35.50 ± 4.20 | 0.23 | 33.69 ± 6.20 | 33.22 ± 5.78 | 28.83 ± 3.87 | 0.16 |
Weight | 81.18 ± 13.55 | 74.90 ± 12.09 | 83.37 ± 10.97 | 0.02 | 78.33 ± 12.86 | 84.99 ± 11.84 | 81.79 ± 14.13 | 0.27 | 80.77 ± 13.03 | 75.29 ± 12.28 | 82.73 ± 10.89 | 0.11 |
BMI | 32.41 ± 4.37 | 30.11 ± 4.62 | 33.34 ± 4.27 | 0.01 | 31.27 ± 4.55 | 35.20 ± 4.10 | 31.95 ± 3.87 | 0.03 | 32.23 ± 4.64 | 30.56 ± 4.61 | 32.12 ± 3.67 | 0.24 |
SBP | 121.74 ± 10.91 | 119.32 ± 9.22 | 119.62 ± 12.32 | 0.56 | 120.14 ± 10.21 | 121.80 ± 12.17 | 120.75 ± 16.26 | 0.89 | 120.92 ± 10.98 | 119.44 ± 9.69 | 119.00 ± 11.73 | 0.77 |
DBP | 73.33 ± 2.65 | 74.82 ± 3.48 | 74.10 ± 3.51 | 0.12 | 74.02 ± 3.33 | 74.30 ± 1.95 | 75.00 ± 3.92 | 0.82 | 74.32 ± 3.42 | 73.81 ± 2.93 | 73.17 ± 2.79 | 0.59 |
FBG | 6.10 ± 1.41 | 5.75 ± 1.09 | 5.86 ± 1.12 | 0.44 | 5.99 ± 1.27 | 5.42 ± 0.83 | 5.60 ± 0.93 | 0.33 | 5.91 ± 1.38 | 5.87 ± 0.87 | 6.17 ± 1.43 | 0.86 |
PPBG | 12.08 ± 2.32 | 7.62 ± 1.65 | 8.00 ± 1.87 | 0.003 | 9.70 ± 17.78 | 7.75 ± 1.30 | 8.15 ± 2.32 | 0.92 | 7.65 ± 1.68 | 12.95 ± 29.06 | 9.25 ± 1.38 | 0.33 |
GCT | 9.28 ± 1.12 | 9.34 ± 1.08 | 9.17 ± 1.02 | 0.84 | 9.36 ± 1.08 | 8.86 ± 0.96 | 8.68 ± 1.01 | 0.19 | 9.38 ± 1.02 | 9.13 ± 0.97 | 9.15 ± 2.04 | 0.54 |
OGTT (F) | 6.74 ± 2.38 | 6.47 ± 2.16 | 6.62 ± 2.27 | 0.86 | 6.57 ± 2.20 | 6.97 ± 2.56 | 6.50 ± 3.11 | 0.86 | 6.46 ± 1.97 | 6.96 ± 2.73 | 6.30 ± 2.13 | 0.56 |
OGTT (1) | 10.89 ± 2.07 | 10.07 ± 1.73 | 11.02 ± 1.42 | 0.06 | 10.55 ± 1.89 | 10.80 ± 1.83 | 11.08 ± 0.73 | 0.80 | 10.73 ± 1.92 | 10.41 ± 1.85 | 10.20 ± 0.86 | 0.63 |
OGTT (2) | 9.69 ± 1.77 | 8.99 ± 1.56 | 9.32 ± 1.39 | 0.16 | 9.29 ± 1.66 | 9.28 ± 1.55 | 10.55 ± 0.29 | 0.31 | 9.34 ± 1.55 | 9.34 ± 1.88 | 9.32 ± 1.06 | 0.99 |
OGTT (3) | 5.68 ± 1.52 | 5.89 ± 1.38 | 6.29 ± 1.81 | 0.34 | 5.90 ± 1.46 | 5.71 ± 1.75 | 6.23 ± 2.74 | 0.84 | 5.87 ± 1.46 | 5.91 ± 1.72 | 6.08 ± 1.43 | 0.94 |
Hb1Ac | 5.41 ± 0.42 | 5.47 ± 0.28 | 5.34 ± 0.33 | 0.38 | 5.43 ± 0.35 | 5.42 ± 0.41 | 5.20 ± 0.27 | 0.44 | 5.44 ± 0.36 | 5.39 ± 0.31 | 5.42 ± 0.54 | 0.96 |
TC | 5.96 ± 1.49 | 5.82 ± 1.18 | 5.38 ± 1.24 | 0.26 | 5.70 ± 1.18 | 6.61 ± 1.94 | 5.37 ± 2.21 | 0.10 | 5.27 ± 1.27 | 5.98 ± 1.44 | 5.49 ± 1.31 | 0.05 |
TG | 2.71 ± 2.74 | 2.43 ± 1.54 | 1.85 ± 1.02 | 0.29 | 2.35 ± 2.11 | 3.24 ± 1.61 | 1.87 ± 0.46 | 0.36 | 2.61 ± 2.47 | 2.20 ± 0.89 | 1.64 ± 0.86 | 0.40 |
HDL-C | 1.04 ± 0.46 | 0.85 ± 0.35 | 0.90 ± 0.43 | 0.11 | 0.93 ± 0.40 | 1.14 ± 0.53 | 0.72 ± 0.45 | 0.18 | 0.88 ± 0.38 | 1.01 ± 0.46 | 1.22 ± 0.43 | 0.08 |
LDL-C | 3.87 ± 1.13 | 3.77 ± 0.83 | 3.68 ± 0.89 | 0.75 | 3.85 ± 0.97 | 3.17 ± 0.84 | 4.21 ± 0.47 | 0.07 | 3.87 ± 1.04 | 3.70 ± 0.86 | 3.46 ± 0.67 | 0.50 |
Genes/SNPs | Normal Genotypes (CC/AA) | Heterozygous (CT/AG) | Homozygous Variant (TT/GG) |
---|---|---|---|
TCF7L2 (rs7903146) | 13 (40.6%) | 12 (37.5%) | 07 (21.9%) |
KCNQ1 (rs2237892) | 30 (93.8%) | 01 (3.1%) | 01 (3.1%) |
KCNJ11 (rs5219) | 19 (59.4%) | 11 (34.4%) | 02 (6.2%) |
Total Genotypes | 62 (64.6%) | 24 (25%) | 10 (10.4%) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Alshammary, A.F.; Al-Hakeem, M.M.; Ali Khan, I. Saudi Community-Based Screening Study on Genetic Variants in β-Cell Dysfunction and Its Role in Women with Gestational Diabetes Mellitus. Genes 2023, 14, 924. https://doi.org/10.3390/genes14040924
Alshammary AF, Al-Hakeem MM, Ali Khan I. Saudi Community-Based Screening Study on Genetic Variants in β-Cell Dysfunction and Its Role in Women with Gestational Diabetes Mellitus. Genes. 2023; 14(4):924. https://doi.org/10.3390/genes14040924
Chicago/Turabian StyleAlshammary, Amal F., Malak Mohammed Al-Hakeem, and Imran Ali Khan. 2023. "Saudi Community-Based Screening Study on Genetic Variants in β-Cell Dysfunction and Its Role in Women with Gestational Diabetes Mellitus" Genes 14, no. 4: 924. https://doi.org/10.3390/genes14040924
APA StyleAlshammary, A. F., Al-Hakeem, M. M., & Ali Khan, I. (2023). Saudi Community-Based Screening Study on Genetic Variants in β-Cell Dysfunction and Its Role in Women with Gestational Diabetes Mellitus. Genes, 14(4), 924. https://doi.org/10.3390/genes14040924