Next Article in Journal
Editorial for the Genetics of Muscular Dystrophies from the Pathogenesis to Gene Therapy Special Issue
Previous Article in Journal
Genome-Wide Identification, Characterization, and Expression of TCP Genes Family in Orchardgrass
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Identification and Bioinformatics Analyses of Host Defense Peptides Snakin/GASA in Mangrove Plants

1
Shenzhen Key Laboratory of Marine Bioresource and Eco-Environmental Science, Guangdong Provincial Key Laboratory for Plant Epigenetics, College of Life Sciences and Oceanography, Shenzhen University, Shenzhen 518060, China
2
College of Physics and Optoelectronic Engineering, Shenzhen University, Shenzhen 518060, China
3
Department of Biochemistry and Chemistry, La Trobe Institute for Molecular Science, La Trobe University, Bundoora, VIC 3086, Australia
*
Author to whom correspondence should be addressed.
Genes 2023, 14(4), 923; https://doi.org/10.3390/genes14040923
Submission received: 17 February 2023 / Revised: 3 April 2023 / Accepted: 13 April 2023 / Published: 16 April 2023
(This article belongs to the Section Microbial Genetics and Genomics)

Abstract

Host defense peptides (HDPs) are components of plant defensive barriers that resist microbial infection. Members of the Snakin/GASA protein family in plants have functions of regulating plant growth, defense, and bacteriostasis. Most mangrove plants grow in coastal zones. In order to survive in harsh environments, mangrove plants have evolved complex adaptations against microbes. In this study, Snakin/GASA family members were identified and analyzed in the genomes of three mangrove species. Twenty-seven, thirteen, and nine candidate Snakin/GASA family members were found in Avicennia marina, Kandelia obovata, and Aegiceras corniculatum, respectively. These Snakin/GASA family members were identified and categorized into three subfamilies via phylogenetic analysis. The genes coding for the Snakin/GASA family members were unevenly distributed on chromosomes. Collinearity and conservative motif analyses showed that the Snakin/GASA family members in K. obovata and A. corniculatum underwent multiple gene duplication events. Snakin/GASA family member expression in normal leaves and leaves infected with pathogenic microorganisms of the three mangrove species was verified using real-time quantitative polymerase chain reaction. The expression of KoGASA3 and 4, AcGASA5 and 10, and AmGASA1, 4, 5, 15, 18, and 23 increased after microbial infection. This study provides a research basis for the verification of HDPs from mangrove plants and suggests directions for the development and utilization of marine biological antimicrobial peptides.

1. Introduction

Plants have evolved sophisticated defense mechanisms in the natural environment to protect themselves from bacteria, fungi, viruses, and protozoa [1]. For example, in the constitutive defense, waxy cuticles and trichomes form physical barriers against the infiltration and spread of pathogenic microorganisms [2]. Alternatively, in the induced defense, by triggering a cascade of reactions that activate many defense-related genes, a variety of proteins and secondary metabolites are released to inhibit the growth of pathogenic microorganisms [3,4]. Among the defense molecules in plants, host defense peptides (HDPs) are common defense barriers that plants have evolved to resist microbial stress [5]. HDPs are part of the innate immune system inherent in almost all life forms and are found in microbes, arthropods, amphibians, mammals, and plants. HDPs significantly contribute to host defense against pathogens [6,7,8,9]. In plants, HDPs are typically peptides with masses less than 9000 Daltons; they are thermally stable and positively charged, and they have a significant proportion of hydrophobic amino acids (>30%) in linear or circular structures [5,10,11].
According to the sequence, cysteine number, and protein structure, plant HDPs can be divided into eight families: defensins, thionins, nonspecific lipid transfer proteins (LTPs), Snakins, hevein-like peptides, knottins, α-hairpinins, and cyclic peptides [12]. Snakin was first discovered in the stem of Solanum tuberosum and was named Snakin because of some common sequence motifs with snake venom [13,14]. Sequence analysis of potato Snakin/GASA predicted proteins showed that this family has three distinct structural domain features, and the most representative of these three subgroups are Snakin-1, Snakin-2, and Snakin-3, respectively. Snakins are typically smaller than 9000 Daltons, positively charged, and rich in cysteines [13,14]. The peptides comprise three parts: a signal peptide at the N-terminal, a variable intermediate region, and a conserved GASA domain [13,14]. The GASA (Gibberellins Stimulated in Arabidopsis thaliana) gene family in A. thaliana is consistent with the structural features of Snakin [15,16]. Increasing numbers of Snakin/GASA family members have recently been identified in various monocotyledonous and dicotyledonous plants [10,13,17]. For example, seven Snakin/GASA family members were found in Allium cepa L.; fourteen Snakin/GASA family members were found in Vitis vinifera L., and thirty-seven Snakin/GASA family members were found in Glycine max [18,19,20]. The present study aimed to discover and identify novel members of the Snakin/GASA family of plants in the mangroves.
Various plant hormones regulate the expression of Snakin/GASA family members. For example, gibberellins (Gas) can induce AtGASA4, 6, 7, 8, and 13 in A. thaliana, PeuGASA5, 6, 12, 17, and 19 in Populus euphratica, and OsGASA1 in Oryza sativa [10,15,16,21]. Methyl jasmonate (MeJA) can inhibit the expression of PeuGASA4, 8, 9, and 15 in P. euphratica [21]. Abscisic acid (ABA) can induce the expression of AtGASA2, 3, 5, and 14 in A. thaliana and PeuGASA9, 10, and 14 in P. euphratica but inhibit the expression of AtGASA7 and 9, PeuGASA8, 11, 15, 17, and 18 [10,16,21]. At the same time, Snakin/GASA family members participate in various physiological processes such as plant cell division, flower induction, seed germination, and root growth. For example, overexpression of AtGASA6 caused early flowering in A. thaliana. The overexpression of GmGASA32 can promote soybean height [22,23].
Snakin/GASA family members can inhibit the growth of various bacteria and fungi at very low concentrations. StSN1 isolated from S. tuberosum inhibited the growth of fungal pathogens such as Fusarium solani, Fusarium culmorum, Bipolaris maydis, and Botrytis cinerea, as well as bacterial pathogens such as Clavibacter michiganensis at low concentrations (EC50 < 10 μM) [14]. PnSN1 found in Panax notoginseng inhibited the mycelial growth of four phytopathogenic fungi (F. solani, Fusarium oxysporum, Fusarium verticillioides, and Botryosphaeria dothidea) and the spore germination of F. solani [17]. PdSN1 (Peltophorum dubium Snakin peptide) inhibited Streptomyces scabies at 1.8 μM [24]. In addition to their antifungal and antibacterial activities, the Snakin/GASA family protects plants from viral threats; for example, overexpression of GmSN1 enhanced viral resistance in A. thaliana and G. max [18].
Mangroves form unique ecosystems in the intertidal zones of tropical and subtropical regions. The living environment of mangrove plants is more complex than that of terrestrial and aquatic plants, and thus they face more diverse pathogenic microorganisms. Therefore, there may be very efficient HDPs in mangrove plants. However, a literature search (Google Scholar; keywords: host defense peptide in mangrove plants, 28 March 2022) found few research reports concerning HDPs from mangrove plants. Therefore, we first identified Snakin/GASA family members in K. obovata, A. corniculatum, and A. marina. Chromosomal localization, gene expansion, gene structure, and upstream promoter cis-acting elements of candidate Snakin/GASA family members were predicted and analyzed. The chemical properties, subcellular localization, motifs, and phylogenetic relationships of the encoded proteins were also predicted and analyzed. The gene expression changes of the Snakin/GASA family were examined on the leaves of three mangrove species, which are infected by pathogenic microorganisms in their natural habitats. This study provides a resource for future research on HDPs from mangrove species and suggests directions for developing and utilizing marine biological antimicrobial peptides.

2. Materials and Methods

2.1. Gene Identification of Snakin/GASA Family in K. obovata, A. corniculatum, and A. marina

The genomic data of K. obovata were obtained from Genome Warehouse (GWH) with the accession code PRJCA002330/GWHACBH00000000 [25]. The A. corniculatum genome data were obtained from the China National GeneBank (CNGB), accession number CNA0017738 [26]. A. marina genomic data were obtained from NCBI (www.ncbi.nlm.nih.gov/, 3 April 2022), Genebank numbers GCA_019155195.1 (file 1, assembled to the chromosomal level but no transcripts) and PRJNA392013 (file 2, assembled to the scaffold level with transcripts [27]). The hidden Markov model (HMM) profile of the GASA domain (PF02704) from the Pfam database was used as a query, and the putative Snakin/GASA family members were identified by HMMER searching against the K. obovata, A. corniculatum, and A. marina genomes. The complete GASA domains of the protein sequences were examined using Batch CD-Search tools (https://www.ncbi.nlm.nih.gov/Structure/cdd/cdd.shtml, 3 April 2022) and Pfam (http://pfam.xfam.org/, 3 April 2022). Finally, conserved domains of all candidate protein sequences were verified by manually removing incomplete domain sequences.

2.2. Physicochemical Characterization, Chromosomal Location, and Sequence Alignments

Snakin/GASA family members’ physicochemical properties were predicted using ProtParam (https://web.expasy.org/protparam/, 3 April 2022). The chromosomal locations of Snakin/GASA family members were confirmed in the gene annotation files of K. obovata and A. corniculatum and mapped using MapChart software [28]. The coding sequences of Snakin/GASA family members were confirmed in the genome file 2 of A. marina. Then the chromosomal location information of Snakin/GASA family members was obtained in file 1 by blastn and visualized using MapChart software [28]. Snakin/GASA family members of the three mangrove species were aligned using Genedoc software [29] with Snakin-1, Snakin-2, and Snakin-3 sequences of S. tuberosum.

2.3. Phylogenetic, Gene Structure, Motif, and Promoter Region Analyses

A phylogenetic tree was constructed using the neighbor-joining method with 1000 bootstrap replicates via MEGAX software with Snakin/GASA sequences of K. obovata, A. corniculatum, A. marina, V. vinifera, S. tuberosum, P. euphratica, A. thaliana, Malus domestica, and Populus trichocarpa. EVOLVIEW (https://www.evolview.com, 3 April 2022) was used to visualize the evolutionary tree. Gene structure was analyzed using GSDS tools (http://gsds.cbi.pku.edu.cn, 5 April 2022). Motifs in sequences were analyzed using the MEME online tool (http://meme-suite.org/, 5 April 2022). Prediction of cis-acting elements was performed on the upstream sequence of each gene (1.5 KB) using the PlantCARE online tool (http://sphinx.rug.ac.be:8080/PlantCARE/, 6 April 2022), and the final images were created using TBtools software [30].

2.4. Subcellular Localization, Protein Structure and Gene Duplication

Subcellular localization analysis of GASA was performed using the online sites WoLF PSORT (https://www.genscript.com/wolf-psort.html, 7 April 2022) and Plant-PLoc (http://www.csbio.sjtu.edu.cn/cgi-bin/PlantPLoc.cgi, 7 April 2022). Protein 3D structure prediction was performed with SWISS-MODEL (https://swissmodel.expasy.org/, 7 April 2022) and illustrated with Cherima1.14. The occurrence and duplication events of the Snakin/GASA family members in the three mangrove species were analyzed and visualized by MCScanX (University of Georgia, Athens, GA, USA). Non-synonymous (ka) and synonymous (ks) substitution rates of each duplicated WRKY gene were calculated using KaKs_Calculator 2.0.

2.5. Sample Collection

Plant samples obtained in the field can provide a true and visual picture of plant populations’ health status, the causes of disease, and plant response characteristics. In November 2021, infected and normal leaves of three mangrove species (Figure S1) were collected in Baguang Yinye Wetland Park (22°38′ N, 114°24′ E), Shenzhen. After washing the leaf surface with sterile water, the collected samples were photographed (Figure S1), wrapped in tinfoil, and immediately frozen in liquid nitrogen and stored at −80 °C.

2.6. RNA Extraction, cDNA Synthesis, and qRT-PCR Analysis

RNA was extracted using an RNA Pure Plant Plus Kit (Tiangen Biotechnology, Beijing, China). According to the manufacturer’s instructions, the extracted RNA was reverse transcribed into cDNA using the Hifair III 1st Strand cDNA Synthesis SuperMix for qPCR (YEASEN, Shanghai, China). NanoDrop nucleic acid concentration tester (Thermo Fisher Scientific, MA, USA) was used to determine the concentration and purity of RNA. Only samples with OD 260/OD 280 ratios between 1.8 and 2.0 could proceed to the next step. RNA samples were randomly selected and electrophoresed on 0.8% agarose gels to check the integrity of the RNA. The loading volume was 1 μg total RNA, and the voltage was 6 V/cm. The specific primers for Snakin/GASA family members from three mangrove species were designed using Premier 6.0. The specificity of primers was determined by 0.8% agarose gel electrophoresis. Real-time PCR was run with the qTower3 instrument (Analytik Jena AG, Jena, Germany) to detect the chemical SYBR Green. The established reaction system was as follows: 5 μL 2 × SYBR Green Pro Taq HS Premix (Accurate Biotechnology, Hunan, China), 0.5 μL of each forward and reverse primer (10 μM), 1 μL of diluted cDNA template, and RNase-free ddH2O were added until the total volume was 10 μL. The reaction procedure was as follows: 95 °C for 15 min, 40 cycles of 10 s at 95 °C, 15 s at 59 °C, and 20 s at 72 °C. The melting curve analysis was performed immediately after the PCR reaction, i.e., fluorescence intensity was measured for each degree increase from 60 °C to 95 °C. The relative template abundance in each PCR expansion mixture was calculated by the 2−ΔΔCT method. Three biological replicates were used for gene expression analysis, and the expression of the control samples was set to 1 for normalization. Data manipulation and structural visualization were performed with GraphPad Prism 6, and an LSD test was used to calculate the p-value. All primers for internal reference genes and Snakin/GASA family members in the three mangrove species are shown in Tables S1 and S2. Internal reference genes refer to Dr. Peng Yalan’s research [31,32,33].

2.7. Identification of Pathogenic Microorganism

The infected part was cut out, and the Ezuo Column Fungal Genomic DNA Extraction Kit DNA (Sangon Biotech, Shanghai, China) instructions were followed to obtain. PCR amplification was performed using the fungus ITS universal primer pair (ITS1F: CTTGGTCATTTAGAGGAAGTAA; ITS4R: TCCTCCGCTTATTGATATGC) that amplifies the ITS1-5.8S-ITS2 region, and the bacteria 16S universal primer pair (27F: AGAGTTTGATCMTGGCTCAG; 1492R: TACGGYTACCTTGTTACGACTT) that amplifies the V1-V5 variable regions. The nucleic acid was recovered from an agarose gel and sent for sequencing. The sequencing results were compared to the NCBI database to identify the pathogenic microbes.

2.8. Statistical Analysis

GraphPad Prism 7.0 (GraphPad, San Diego, CA, USA) was selected for statistical analysis. Statistical significance was determined via a one-way analysis of variance. All data are presented as mean ± SE and p-value < 0.05 was considered statistically significant.

3. Results

3.1. Identification of Snakin/GASA Genes in Three Mangrove Plants and Chromosomal Location

Chromosome-scale assemblies of the genomes of K. obovata and A. corniculatum were reported in 2020 [25] and 2021 [26]. A reference-grade genome of A. marina was published in 2021 [27]. We first used the conserved GASA domain (PF02704) to search for Snakin/GASA family members in the three mangrove species using Hmmersearch. Thirteen candidate Snakin/GASA family members were found in A. corniculatum; nine candidate Snakin/GASA family members were found in K. obovate; and twenty-seven candidate Snakin/GASA family members were found in A. marina. The Snakin/GASA family members of the three mangrove species were named according to their locations on the chromosomes (Figure 1). As shown in Figure 1, the A. corniculatum genome contained 13 Snakin/GASA family members spread across six chromosomes. Eight Snakin/GASA family members of A. corniculatum (AcGASA1–AcGASA8) were located on chromosome 1. Nine Snakin/GASA family members were spread across six chromosomes in the K. obovata genome. On chromosomes 4 and 2, there were three and two Snakin/GASA family members, respectively. AmGASA27 was not placed on a scaffold and could not be located on a chromosome. The remaining 26 Snakin/GASA family members were distributed on 15 chromosomes in the A. marina genome. Furthermore, three Snakin/GASA family members were respectively identified on A. marina’s chromosomes 2, 20, 22, and 25.

3.2. Physicochemical Properties Prediction

As shown in Table 1, after ProtParam prediction, among the Snakin/GASA family members in A. marina, AmGASA22 had 88 amino acids and was the smallest. AmGASA19 had 307 amino acids. Among the Snakin/GASA family members of K. obovata, KoGASA9 was the largest with 186 amino acids. There were 421 amino acids in AcGASA6 of A. corniculatum, the Snakin/GASA family member with the most significant number of amino acids among the three mangrove species. AcGASA7 and AcGASA8 had 346 and 387 amino acids, respectively. KoGASA1, 4, 5, and 8 in K. obovata, AcGASA5, 9, 10, 12, and 13 in A. corniculatum, and AmGASA2, 5, 11, 16, 17, 21, 22, and 23 in A. marina had fewer than 100 amino acids.
Table 1 displays the predicted properties of Snakin/GASA family members in three different mangrove species. The majority of these proteins were classified as basic proteins with a theoretical isoelectric point (pI) value above 8. The proteins AmGASA4 and AmGASA19 had the highest and lowest pI values, with 9.83 and 5.39, respectively.

3.3. Subcellular Localization Prediction

This study predicted the subcellular localization of Snakin/GASA family members in three mangrove species. For A. corniculatum, AcGASA2, 5, 10, and 12 were predicted to be localized in the extracellular matrix, AcGASA6 in the nucleus, and AcGASA3, 4, 8, and 9 in the chloroplast (Table S3). AcGASA1, 11, and 13 were predicting localized in the chloroplast and extracellular matrix. In K. obvoata, the predicted localization of KoGASA2, 4, 5, 6, 7, and 8 was in the extracellular matrix. KoGASA1 was distributed in the extracellular and Golgi apparatus. KoGASA9 was localized in the mitochondrion and chloroplast. In A. marina, AmGASA3 and 12 localized in the cytoplasm. The predicted localization of AmGASA1, 4–6, 8–11, 14–18, 20, 21, 23, and 27 was in the extracellular matrix.

3.4. Phylogeny, and Protein Sequence Analysis of Snakin/GASA Family Members in Three Mangrove Species

To illustrate the evolutionary relationships of the Snakin/GASA family members of the three mangrove species, a phylogenetic tree of conserved GASA domains was constructed (Figure 2). The GASA domains of all species were divided into three groups. Group III had the most members. There were 11 Snakin/GASA family members of A. corniculatum belonging to Group I. There were nine Snakin/GASA family members of K. obovata distributed among the three groups. There were 8, 6, and 13 Snakin/GASA family members of A. marina in groups I, II, and III, respectively. The three mangrove plants were more phylogenetically related to V. vinifera L. and P. trichocarpa.
The Snakin-1, Snakin-2, and Snakin-3 of potato were aligned with the Snakin/GASA family members of the three mangrove species. The Snakin/GASA family members of A. corniculatum and K. obovata were divided into three groups (Figure 3A,B). Snakin/GASA family members of A. marina were divided into four groups. Sequence analysis of the predicted proteins of A. marina species showed that the family has four distinct structural domain features, while the fourth family members are missing some of the conserved domains. AmGASA3, 12, and 15 were dissimilar from the three Snakins of potato (Figure 3C). KoGASA4 and AmGASA11 were adjacent to StGASA15 (Snakin-3); AmGASA7 and AmGASA26 were adjacent to StGASA2 (Snakin-2).

3.5. Collinearity Analysis among Snakin/GASA Family Members

There are two versions of the A. marina genome. The annotation of the genome assembled to the scaffold level was relatively complete, while the annotation of the genome assembled to the chromosome level was lacking. Analyzing the intergenic collinearity of Snakin/GASA family members in the A. marina genome is temporarily impossible. To illustrate the family expansion pattern of Snakin/GASA family members in the three mangrove species, we analyzed gene duplication events in their genomes by McsanX. In the K. obovata genome, two repetitive events occurred in the evolution of Snakin/GASA family members (Figure 4A). No gene tandem duplication events were found in K. obovata. In A. corniculatum, nonsynonymous substitution rate (Ka) and synonymous substitution rate (Ks) and their ratio were estimated for Snakin/GASA family members. The gene duplication event of Snakin/GASA family members occurred on chromosome 1 (Table 2). The negative Ka/Ks values of two duplicated gene pairs (AcGASA4 and AcGASA3, AcGASA5 and AcGASA9, Ka/Ks values < 1) suggested negative or purifying selection pressure during evolution. T = Ks/2r, where r is the expected clock sample rate of synonymous substitution in dicotyledons, and r = 1.5 × 108 substitutions/synonymous sites/year is the formula used to determine divergence time. The range of divergence times of two gene pairs calculated using Ks values was 32.28 to 33.13 million years ago (MYA) (Table 2). AcGASA5 and AcGASA6 had signatures of neutral evolution, as suggested by Ka/Ks values equal to 1, while the Ka/Ks values of other gene pairs were greater than one, suggesting positive selection.
Figure 4B and Table 3 display the collinearity analysis of Snakin/GASA family members among different species. Four collinear gene pairs were identified between K. obovata and A. thaliana. Between A. corniculatum and A. thaliana, two collinear gene pairs of Snakin/GASA family members were found. Between K. obovata and P. trichocarpa and K. obovata and V. vinifera, there were nine and seven collinear gene pairs of Snakin/GASA family members, respectively. Two and three collinear gene pairs of Snakin/GASA family members existed between A. corniculatum and V. vinifera, respectively. Finally, K. obovata and V. vinifera shared three gene pairs with Snakin/GASA family traits.

3.6. Gene Structure and Motif Identification among Snakin/GASA Family Members

As shown in Figure 5, Snakin/GASA family members in G-I of K. obovata consisted of two exons and introns. Other Snakin/GASA family members of K. obovata had multiple exons and introns. Eight Snakin/GASA family members on chromosome 1 of A. corniculatum did not have a UTR and had many introns and exons. AcGASA6 of A. corniculatum had the largest number of introns and exons, with 12 exons and 11 introns. AmGASA21 and AmGASA22 of A. marina had only one intron and one exon, while AmGASA19 had the largest number of exons and introns, with five exons and four introns.
The GASA domain of most Snakin/GASA family members in G-I consisted of motif 3 and motif 2 or motif 3 and motif 4. The GASA domains of AcGASA3, AcGASA7, and AcGASA8 consisted of motif 1 and motif 4. The GASA domain of most Snakin/GASA family members in G-II and G-III consisted of motif 1 and motif 4, except for AmGASA27 and AcGASA9. The GASA domains of AcGASA9, AmGASA3, AmGASA12, and AmGASA25 had deletions compared to the conserved GASA domain.

3.7. Gene upstream Element Analysis

AcGASA2, 3, 5, 7, 8, 9, and 12 had methyl jasmonate (MeJA) elements upstream. AcGASA4, 8 had SA elements upstream. AcGASA3, 4, 5, 8, and 10 had abscisic acid (ABA) elements upstream, and there were four ABA regulatory elements upstream of AcGASA10. AcGASA2, 3, 5, 6, 8, 11, and 13 had regulatory elements that could respond to defense (Figure 6A). MeJa regulated all Snakin/GASA family members of K. obovata except for KoGASA2 and KoGASA4. The upstream regions of Snakin/GASA family members in K. obovata except for KoGASA1, KoGASA2, and KoGASA6 had regulatory elements that could respond to drought stress. There were four salicylic acid (SA) regulatory elements upstream of KoGASA4. All Snakin/GASA family members of K. obovata were regulated by ABA except for KoGASA8 (Figure 6B). ABA regulated all Snakin/GASA family members of A. marina except for AmGASA5-7, 11, and 13. AmGASA1-7, 10, 12, 13, 15, 18, 21, 23, and 25 had MeJA and defense regulatory elements upstream (Figure 6C).

3.8. Protein Structure Prediction

One representative of each Snakin/GASA family member in each mangrove species was selected for three-dimensional (3D) protein structure prediction. The predicted structures of these Snakin/GASA family members were similar, with all of them having random coils, extended strands, and two long α-helices (Figure 7).

3.9. Responses to Pathogenic Microbial Threats

To investigate the role of the GASA family in response to environmental stress, infected leaves were collected from the Dapeng mangrove forest (22°38′ N, 114°24′ E) in Shenzhen, China (Figure S1).
Microbiological testing of black spots on collected environmental leaf samples revealed that fungal infections caused black spots on the leaves, while no bacterial infections were detected (Table S4). It was found that Tropicoporus texanus caused marginal and vein scorching in A. corniculatum. K. obovata became ulcerated as a result of Jattaea spp. infection. It should be Berkeleyomyces basicola that caused the infection of A. marina (Supplementary Tables S4 and S5). The expression levels of Snakin/GASA family members in the infected leaves were measured to explore their role in responding to fungal infections.
After collecting infected and normal leaves of three mangrove plants in the field, qRT-PCR analysis was performed to examine the expression of Snakin/GASA family members (Figure 8A–C). In the infected leaves of A. marina, the expression of all selected Snakin/GASA family members was significantly up-regulated, with AmGASA18 showing the most significant difference. Compared with the normal leaves, the expression of AmGASA18 in the leaves infected by pathogenic microbial was increased by more than fivefold. In A. corniculatum, AcGASA1, 2, 8, and 12 were significantly down-regulated in the infected leaves. Compared with normal leaves, the expression levels of AcGASA5, AcGASA6, AcGASA9, and AcGASA10 in infected leaves were significantly increased by 2.820, 2.123, 1.563, and 1.819-fold, respectively. AcGASA5 showed the most intense response to infection. In K. obovata, KoGASA1, 2, 5, 6, 7, and 8 were significantly down-regulated after being infected by pathogenic microorganisms. KoGASA3 and KoGASA4 were significantly up-regulated by 2.453 and 2.261-fold, respectively, in infected leaves.

4. Discussion

Most members of the Snakin/GASA family are small peptides with multiple functions. They are regulated by various hormones involved in plant development, stress response, and antibacterial activities [10,14]. The biological processes, physicochemical properties, and gene structures of Snakin/GASA family members in various plants (including G. max, V. vinifera, and Populus spp.) have been reported [18,19,21].
Peptide lengths vary greatly among Snakin/GASA family members in the same plant species. For instance, the smallest Snakin/GASA protein in A. thaliana has 87 amino acids, while the largest has 275 amino acids [34]. The smallest Snakin/GASA family member in wheat has 261 amino acids, while the largest has 1099 amino acids [35]. The peptide lengths of the Snakin/GASA family members of the three mangroves varied significantly. HDPs are typically proteins with less than 100 amino acids [36]. However, many proteins with more than 100 amino acids have good antibacterial effects and may have other biological functions [37]. KoGASA1, 4, 5, and 8 in K. obovata, AcGASA5, 9, 10, 12, and 13 in A. corniculatum, and AmGASA2, 5, 11, 16, 17, 21, 22, and 23 in A. marina had fewer than 100 amino acids. Their amino acid numbers met the criteria for HDPs, but their antibacterial functions remain elusive.
In cotton and potato, longer chromosomes did not necessarily contain more Snakin/GASA family members. This suggests that the number of Snakin/GASA family members on each chromosome of the three mangrove species was unrelated to chromosome length. Additionally, the pI values (from 4.11 to 10.14) also vary widely among different plant species and individual members [10]. The apple MdGASA23 is currently the known Snakin/GASA family member with the lowest pI value (pI value = 4.11) [38]. The non-alkaline Snakin/GASA family members in the three mangrove species may have different functions compared to the basic Snakin/GASA family members. Typically, HDPs usually contain more cationic amino acid residues and are basic [36,37]. Therefore, electrically neutral AmGASA19 and AcGASA6 may not have normal HDP functions.
The GASA domain of Snakins is typically situated at the C-terminal and consists of approximately 60 residues, including 12 conserved cysteines [10,39]. The GASA domains of KoGASA9, AcGASA7, 8, and AmGASA19 are not located at their C-terminal. Based on their sequence features, they may not be considered part of the Snakin/GASA family. Subcellular localization provides insights into the functions of proteins [40,41,42]. Existing studies have shown that Snakin/GASA family members are distributed in various locations within plants, including nuclei, cell walls, cytoplasm, and extracellular spaces [10,17,21,43]. For example, AtGASA5 of A. thaliana is present in the cell wall and extracellular matrix [10,44], and HbGASA5 and HbGASA9 proteins of Hevea brasiliensis are present in the nucleus and the cytoplasm [45]. The transition between the cell periphery and the nucleus may be important concerning their antimicrobial function [10]. Based on the predictions, several members of the Snakin/GASA family in the three mangrove species, including AmGASA1, 4–6, 8–11, 14–18, 20, 21, 23, 27, KoGASA2, 4–8, AcGASA2, 5, 10, and 12, may have antimicrobial function and are predicted to be located in the extracellular space. KoGASA9 and AcGASA6-8 did not have signal peptides, which may be the reason why they were predicted to be localized in the intracellular space. The subcellular localization of proteins can be influenced by various factors, including post-translational modifications, electrostatic interactions, and covalent bonds with membrane lipids [10,13]. As a result, the predictions of the two methods were somewhat inconsistent. At present, it is not possible to conclusively determine whether Snakin/GASA family members have antibacterial function only based on subcellular localization.
The adjacent Snakin/GASA family members in the evolutionary tree had similar sequences and thus may have similar functions. Although many plant Snakin/GASA family members have been identified, few have been functionally validated [16,19,44,46]. The tandem and segmental duplication of genes play important roles in functional regulation, domestication, evolution, and response to biotic and abiotic stresses [42,47,48]. Segmentally duplicated genes also show similar functions and stable expression [18,49]. The motif and exon–intron analyses and Ka/Ks analysis showed that Snakin/GASA family members of A. corniculatum may have evolved leading to variation in motifs and introns in some groups. Some members of the Snakin/GASA family can be strongly induced to respond to temperature variation [10]. The Oligocene (33 million to 23 million years ago) was an important turning point in the rapid transformation of the Earth’s climate from “greenhouse” to “ice chamber” [50], which may be the reason for negative or purifying selection pressure during the evolution of GASA/Snakin family members in A. corniculatum. AtGASA4, 6, and 14 in A. thaliana are critical in promoting plant development [16,34,51]. Inhibition of both AtGASA4 and 6 has been shown to cause delayed flowering [16]. KoGASA6 and AmGASA13 are adjacent to AtGASA4 and 6 (Figure 2), and thus they may have the same function in regulating flower development. AtGASA4 and AtGASA14 can interact with the cell membrane-localized receptor-like kinase protein VH1/BRL2, which participates in leaf vein development [34,51]. KoGASA4 and AmGASA11 are adjacent to AtGASA5, which are negative regulators of GA-induced flowering and stem growth [44]. KoGASA6 is adjacent to VvGASA7, which regulates seed development, and they are collinear genes (Figure 2 and Table 3). Therefore, KoGASA6 may regulate seed development [19]. VvGASA5 can regulate ovule abortion. AcGASA11 and VvGASA5 are collinear genes with the same function [19]. VvGASA2 is thought to play a role in seed development [19]. Collinear relationships were observed between VvGASA2 and KoGASA1, KoGASA5 and AcGASA10, and KoGASA8 and AcGASA12. KoGASA1 and KoGASA5, KoGASA1 and KoGASA8, are intra-genome collinear gene pairs that belonged to the same group in the evolutionary tree; their amino acid sequences consisted of motifs 2, 3, and 5, and their patterns of response to pathogenic microorganisms were consistent. This suggests that their functions may be similar. Therefore, KoGASA1, 5, 8, and AcGASA10 and 12 may regulate seed development. Snakin-1, Snakin-2, and Snakin-3 had good antibacterial effects. KoGASA4 and AmGASA11 were adjacent to StGASA15 (Snakin-3); AmGASA7 and AmGASA26 were adjacent to StGASA2 (Snakin-2). Therefore, KoGASA4, AmGASA7, 11, and 26 may have the same function as Snakin-2 and Snakin-3.
Snakin/GASA family members are regulated by gibberellin (GA), abscisic acid (ABA), and other plant hormones [10,19]. The predictions via the Plant CARE website suggested that the promoters of the three mangrove GASA family members had significant differences in the number of cis-acting elements in response to abscisic acid, gibberellin, methyl jasmonate, low temperature, drought, and pathogenic microorganisms. MeJA, as a damage-related plant hormone and signaling molecule, can stimulate the expression of plant defense genes and induce plant chemical defenses [52,53]. In this study, AmGASA1-7, 10, 12, 13, 15, 18, 21, 23, and 25 had MeJA and defense regulatory elements upstream, consistent with their up-regulated expression after pathogenic microorganism infection. Not all Snakin/GASA family members of the three mangrove species with MeJA and defense regulatory elements were up-regulated after infection by pathogenic microorganisms. Salicylic acid (SA) can act as a signal to promote the expression of downstream defense genes and limit the growth of pathogenic microorganisms [54,55]. Four SA regulatory elements were upstream of KoGASA4, and its expression was up-regulated after pathogenic microorganism infection. KoGASA4 is a secreted protein with a signal peptide and was predicted to localize in the extracellular milieu. Therefore, KoGASA4 has some characteristics of plant HDPs, and its function is worthy of further verification. Although AcGASA6 had two SA upstream regulatory elements and its expression could be induced by pathogenic microorganisms, it did not have a signal peptide and was predicted to localize in the nucleus. Therefore, after pathogenic microorganisms have invaded the plants, the increased level of SA induces the expression of AcGASA6. A recent report has shown that the type one protein phosphatases (TOPP)-SnRK2 module of ABA signaling in A. thaliana was disturbed by the pathogenic effector AvrE, resulting in up-regulation of ABA signaling and stomatal closure that promoted the generation of interstitial waterlogging and pathogenic infection [56]. Four ABA regulatory elements upstream of AcGASA10 may account for its up-regulation after infection by pathogenic microorganisms. The regulatory relationship between the Snakin/GASA family members of the three mangrove species and hormones should be further investigated.
Based on prediction, the structure of Snakin/GASA family members is highly conserved [39]. The structures of these Snakin/GASA family members were similar to previous studies [39,42]. These results confirmed the structural conservation of Snakin/GASA family members. Furthermore, the 3D structures of Snakin/GASA family members in the three mangrove species were similar to those of potato Snakins [13].
Microorganisms often cause diseases in plants. For instance, T. texanus can cause browning of the leaf edges and veins, Jattaea spp. will cause yellowing and ulceration of plant leaves; and Fusarium spp. will cause the plant to wilt [57,58,59]. Genes involved in plant pathogen defense are often up-regulated after microbial infection. The synthesis of most HDPs occurs precisely under conditions of infection or other stress factors. Multiple studies have shown that Snakin/GASA family members are involved in pathogen defense. For example, overexpression of the Snakin-1 gene enhances resistance to Rhizoctonia solani and Erwinia carotovora in transgenic potato plants [60]. Expression of Snakin-2 is up-regulated after infection of potato tubers with the compatible fungus B. cinerea [61]. The new CaSn gene from the Snakin family induces resistance against root-knot nematode infection in Capsicum annuum [62]. Snakin-3 was induced 24 h after infection by Pseudomonas syringae pv. Tabaci [13]. PnSN1 in P. notoginseng roots was induced 24 h after infection by F. solani [17]. TcGASA12 and TcGASA13 of Theobroma cacao were up-regulated after infection by Phytophthora megakarya [42]. Snakin/GASA family members whose expression was not induced after being infected by pathogenic microorganisms did not necessarily lack antibacterial activity. The Snakin/GASA family members whose expression is induced by pathogens are more likely to have functions involved in plant defense and antibacterial effects. According to the RT-qPCR results of the infected leaves, the expression levels of KoGASA3, 4, AcGASA5, 6, 9, 10, AmGASA1-5, 7, 12, 13, 15, 18, 23, and 25 were significantly higher than those of normal leaves. They may be candidates for HDP and deserve further verification. The prediction of HDPs relies on multiple criteria, including sequence features such as the presence of conserved motifs, charge, hydrophobicity, and secondary structure. Additionally, subcellular localization and phylogenetic analysis provide valuable information on the potential function of the protein. Based on these criteria, it is suggested that AcGASA6 may not be an HDP, as it lacks a signal peptide and is predicted to be localized in the nucleus. Regarding AcGASA9, its GASA domain is incomplete, which may affect its functionality as an HDP. AmGASA12 was predicted to be located in chloroplasts, and its GASA domain is incomplete. According to sequence characteristics, amino acid number, and subcellular localization prediction, they may not be HDPs. AmGASA1-5, 7, 13, 15, 18, 23, and 25 can be regulated by ABA or MeJA, while KoGASA3, 4, and AcGASA5, 10 are regulated by ABA. These genes may be induced by pathogenic microorganisms, resulting in increased expression. Thus, they may play a role in the plant’s defense against pathogenic microorganisms. Further verification is needed to confirm their functions. That is very worthy of study; there has been much discussion and in-depth excavation, and it is also one of the directions for future work.

5. Conclusions

In this study, the number of Snakin/GASA family members varied among the three mangrove species. Specifically, K. obovata, A. corniculatum, and A. marina had 9, 13, and 27 candidate Snakin/GASA family members, respectively. Sequence alignment showed that the cysteine residues in the GASA domains of Snakin/GASA family members were relatively conserved within the three mangrove species. Additionally, the peptide lengths of the Snakin/GASA family members in the three mangrove species were different. Through evolutionary analysis, prediction of physicochemical properties, and qRT-PCR results, we have identified several potential candidates for HDPs. Taken together, these findings suggest that AmGASA1-5, 7, 13, 15, 18, 23, 25, KoGASA3, 4, AcGASA5, and 10 are most likely involved in plant defense. These candidates warrant further investigation to determine their involvement in plant defenses. This study lays the foundation for further investigation and exploration of the HDPs present in mangrove plants.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/genes14040923/s1, Figure S1: Normal leaves and leaves infected with pathogenic microorganisms of A. corniculatum, K. obovata and A. marina; Table S1: Primers used for qRT-PCR; Table S2: Reference genes were used in qRT-PCR; Table S3: Subcellular localization prediction of Snakin/GASA family members in A. marina, K. obovata and A. corniculatum; Table S4: Microbial detection of infected leaves. Table S5: Identification of pathogenic microorganism.

Author Contributions

Data curation, formal analysis, S.C. and T.Y.; writing—original draft preparation, W.Z.; writing—review and editing, C.S., W.Z., P.C. and T.Y.; Formal analysis, Q.Z.; validation, C.S. and T.Y.; methodology, C.S., X.L. and W.Z.; software, T.Y. and W.L.; funding acquisition, C.S. and Z.H. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Key R&D Program of China (2018YFA0902500), the CAS Key Laboratory of Science and Technology on Operational Oceanography (No. OOST2021-07), and the Natural Science Foundation of SZU (000002110258).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The authors confirm that the data supporting the results of this study can be found within the article or its Supplementary Materials.

Acknowledgments

We thank Jianwen Deng and Jing Liu in the research group for their help in the sampling process. We acknowledge the technical support of Biosciences Central Research Facility, Shenzhen University.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Wang, Y.; Pruitt, R.N.; Nürnberger, T.; Wang, Y. Evasion of Plant Immunity by Microbial Pathogens. Nat. Rev. Microbiol. 2022, 20, 449–464. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Varma, S.; Meena, A.K. Chapter-2 Integrated Defense Response of Plant against Pathogen. In Integrated Defense Response of Plant against Pathogen; Wiley: Hoboken, NJ, USA, 2020. [Google Scholar]
  3. Nishad, R.; Ahmed, T.; Rahman, V.J.; Kareem, A. Modulation of Plant Defense System in Response to Microbial Interactions. Front. Microbiol. 2020, 11, 1298. [Google Scholar] [CrossRef] [Scilit]
  4. Bukhat, S.; Imran, A.; Javaid, S.; Shahid, M.; Majeed, A.; Naqqash, T. Communication of Plants with Microbial World: Exploring the Regulatory Networks for PGPR Mediated Defense Signaling. Microbiol. Res. 2020, 238, 126486. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Li, J.; Hu, S.; Jian, W.; Xie, C.; Yang, X. Plant Antimicrobial Peptides: Structures, Functions, and Applications. Bot. Stud. 2021, 62, 1–15. [Google Scholar] [CrossRef] [Scilit]
  6. Moravej, H.; Moravej, Z.; Yazdanparast, M.; Heiat, M.; Mirhosseini, A.; Moosazadeh Moghaddam, M.; Mirnejad, R. Antimicrobial Peptides: Features, Action, and Their Resistance Mechanisms in Bacteria. Microbial. Drug Resist. 2018, 24, 747–767. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Mwangi, J.; Hao, X.; Lai, R.; Zhang, Z.-Y. Antimicrobial Peptides: New Hope in the War against Multidrug Resistance. Zool Res. 2019, 40, 488. [Google Scholar] [CrossRef] [Scilit]
  8. Li, W.; Tailhades, J.; O’Brien-Simpson, N.M.; Separovic, F.; Otvos, L.; Hossain, M.A.; Wade, J.D. Proline-Rich Antimicrobial Peptides: Potential Therapeutics against Antibiotic-Resistant Bacteria. Amino Acids 2014, 46, 2287–2294. [Google Scholar] [CrossRef] [Scilit]
  9. Li, W.; Separovic, F.; O’Brien-Simpson, N.M.; Wade, J.D. Chemically Modified and Conjugated Antimicrobial Peptides against Superbugs. Chem. Soc. Rev. 2021, 50, 4932–4973. [Google Scholar] [CrossRef] [Scilit]
  10. Su, T.; Han, M.; Cao, D.; Xu, M. Molecular and Biological Properties of Snakins: The Foremost Cysteine-Rich Plant Host Defense Peptides. J. Fungi 2020, 6, 220. [Google Scholar] [CrossRef] [Scilit]
  11. Koehbach, J.; Craik, D.J. The Vast Structural Diversity of Antimicrobial Peptides. Trends Pharmacol. Sci. 2019, 40, 517–528. [Google Scholar] [CrossRef] [Scilit]
  12. Campos, M.L.; de Souza, C.M.; de Oliveira, K.B.S.; Dias, S.C.; Franco, O.L. The Role of Antimicrobial Peptides in Plant Immunity. J. Exp. Bot. 2018, 69, 4997–5011. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Nahirñak, V.; Rivarola, M.; Gonzalez de Urreta, M.; Paniego, N.; Hopp, H.E.; Almasia, N.I.; Vazquez-Rovere, C. Genome-Wide Analysis of the Snakin/GASA Gene Family in Solanum tuberosum Cv. Kennebec. Am. J. Potato Res. 2016, 93, 172–188. [Google Scholar] [CrossRef] [Scilit]
  14. Segura, A.; Moreno, M.; Madueño, F.; Molina, A.; García-Olmedo, F. Snakin-1, a Peptide from Potato That Is Active against Plant Pathogens. Mol. Plant-Microbe Interact. 1999, 12, 16–23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Aubert, D.; Chevillard, M.; Dorne, A.-M.; Arlaud, G.; Herzog, M. Expression Patterns of GASA Genes in Arabidopsis thaliana: The GASA4 Gene is up-Regulated by Gibberellins in Meristematic Regions. Plant Mol. Biol. 1998, 36, 871–883. [Google Scholar] [CrossRef] [Scilit]
  16. Qu, J.; Kang, S.G.; Hah, C.; Jang, J.-C. Molecular and Cellular Characterization of GA-Stimulated Transcripts GASA4 and GASA6 in Arabidopsis thaliana. Plant Sci. 2016, 246, 1–10. [Google Scholar] [CrossRef] [Scilit]
  17. Qiu, B.; Zhang, Y.; Wang, Q.; Wang, Z.; Chen, H.; Cui, X.; Liu, D. Panax notoginseng Snakin Gene Increases Resistance to Fusarium solani in Transgenic Tobacco. Ind. Crops Prod. 2020, 157, 112902. [Google Scholar] [CrossRef] [Scilit]
  18. Ahmad, M.Z.; Sana, A.; Jamil, A.; Nasir, J.A.; Ahmed, S.; Hameed, M.U. A Genome-Wide Approach to the Comprehensive Analysis of GASA Gene Family in Glycine max. Plant Mol. Biol. 2019, 100, 607–620. [Google Scholar] [CrossRef] [Scilit]
  19. Ahmad, B.; Yao, J.; Zhang, S.; Li, X.; Zhang, X.; Yadav, V.; Wang, X. Genome-Wide Characterization and Expression Profiling of GASA Genes during Different Stages of Seed Development in Grapevine (Vitis vinifera L.) Predict Their Involvement in Seed Development. Int. J. Mol. Sci. 2020, 21, 1088. [Google Scholar] [CrossRef] [Scilit]
  20. Lanzotti, V.; Romano, A.; Lanzuise, S.; Bonanomi, G.; Scala, F. Antifungal Saponins from Bulbs of White Onion, Allium cepa L. Phytochemistry 2012, 74, 133–139. [Google Scholar] [CrossRef] [Scilit]
  21. Han, S.; Jiao, Z.; Niu, M.-X.; Yu, X.; Huang, M.; Liu, C.; Wang, H.-L.; Zhou, Y.; Mao, W.; Wang, X. Genome-Wide Comprehensive Analysis of the GASA Gene Family in Populus. Int. J. Mol. Sci. 2021, 22, 12336. [Google Scholar] [CrossRef] [Scilit]
  22. Zhang, S.; Wang, X. One New Kind of Phytohormonal Signaling Integrator: Up-and-Coming GASA Family Genes. Plant Signal Behav. 2017, 12, e1226453. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Chen, K.; Liu, W.; Li, X.; Li, H. Overexpression of GmGASA32 Promoted Soybean Height by Interacting with GmCDC25. Plant Signal Behav. 2021, 16, 1855017. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Rodriguez-Decuadro, S.; Barraco-Vega, M.; Dans, P.D.; Pandolfi, V.; Benko-Iseppon, A.M.; Cecchetto, G. Antimicrobial and Structural Insights of a New Snakin-like Peptide Isolated from Peltophorum dubium (Fabaceae). Amino Acids 2018, 50, 1245–1259. [Google Scholar] [CrossRef] [Scilit]
  25. Hu, M.-J.; Sun, W.-H.; Tsai, W.-C.; Xiang, S.; Lai, X.-K.; Chen, D.-Q.; Liu, X.-D.; Wang, Y.-F.; Le, Y.-X.; Chen, S.-M.; et al. Chromosome-Scale Assembly of the Kandelia obovata Genome. Hortic. Res. 2020, 7, 75. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Ma, D.; Guo, Z.; Ding, Q.; Zhao, Z.; Shen, Z.; Wei, M.; Gao, C.; Zhang, L.; Li, H.; Zhang, S.; et al. Chromosome-Level Assembly of the Mangrove Plant Aegiceras corniculatum Genome Generated through Illumina, PacBio and Hi-C Sequencing Technologies. Mol. Ecol. Resour. 2021, 21, 1593–1607. [Google Scholar] [CrossRef] [Scilit]
  27. Natarajan, P.; Murugesan, A.K.; Govindan, G.; Gopalakrishnan, A.; Kumar, R.; Duraisamy, P.; Balaji, R.; Shyamli, P.S.; Parida, A.K.; Parani, M. A Reference-Grade Genome Identifies Salt-Tolerance Genes from the Salt-Secreting Mangrove Species Avicennia marina. Commun. Biol. 2021, 4, 851. [Google Scholar] [CrossRef] [Scilit]
  28. Voorrips, R. MapChart: Software for the Graphical Presentation of Linkage Maps and QTLs. J. Hered. 2002, 93, 77–78. [Google Scholar] [CrossRef] [Scilit]
  29. Nicholas, K.B. Genedoc: A Tool for Editing and Annoting Multiple Sequence Alignments. 1997. Available online: http://wwwpscedu/biomed/genedoc (accessed on 16 February 2023).
  30. Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef] [Scilit]
  31. Peng, Y.-L.; Wang, Y.-S.; Cheng, H.; Sun, C.-C.; Wu, P.; Wang, L.-Y.; Fei, J. Characterization and Expression Analysis of Three CBF/DREB1 Transcriptional Factor Genes from Mangrove Avicennia marina. Aquat. Toxicol. 2013, 140–141, 68–76. [Google Scholar] [CrossRef] [Scilit]
  32. Peng, Y.-L.; Wang, Y.-S.; Fei, J.; Sun, C.-C. Isolation and Expression Analysis of Two Novel C-Repeat Binding Factor (CBF) Genes Involved in Plant Growth and Abiotic Stress Response in Mangrove Kandelia obovata. Ecotoxicology 2020, 29, 718–725. [Google Scholar] [CrossRef] [Scilit]
  33. Peng, Y.-L.; Wang, Y.-S.; Gu, J.-D. Identification of Suitable Reference Genes in Mangrove Aegiceras corniculatum under Abiotic Stresses. Ecotoxicology 2015, 24, 1714–1721. [Google Scholar] [CrossRef] [Scilit]
  34. Rubinovich, L.; Weiss, D. The Arabidopsis Cysteine-rich Protein GASA4 Promotes GA Responses and Exhibits Redox Activity in Bacteria and in Planta. Plant J. 2010, 64, 1018–1027. [Google Scholar] [CrossRef] [Scilit]
  35. Lei, P.; Wei, X.; Gao, R.; Huo, F.; Nie, X.; Tong, W.; Song, W. Genome-Wide Identification of PYL Gene Family in Wheat: Evolution, Expression and 3D Structure Analysis. Genomics 2021, 113, 854–866. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Wang, G.; Li, X.; Wang, Z. APD3: The Antimicrobial Peptide Database as a Tool for Research and Education. Nucleic Acids Res. 2016, 44, D1087–D1093. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Seyfi, R.; Kahaki, F.A.; Ebrahimi, T.; Montazersaheb, S.; Eyvazi, S.; Babaeipour, V.; Tarhriz, V. Antimicrobial Peptides (AMPs): Roles, Functions and Mechanism of Action. Int. J. Pept. Res. Ther. 2020, 26, 1451–1463. [Google Scholar] [CrossRef] [Scilit]
  38. Fan, S.; Zhang, D.; Zhang, L.; Gao, C.; Xin, M.; Tahir, M.M.; Li, Y.; Ma, J.; Han, M. Comprehensive Analysis of GASA Family Members in the Malus domestica Genome: Identification, Characterization, and Their Expressions in Response to Apple Flower Induction. BMC Genom. 2017, 18, 827. [Google Scholar] [CrossRef] [Scilit]
  39. Porto, W.F.; Franco, O.L. Theoretical Structural Insights into the Snakin/GASA Family. Peptides 2013, 44, 163–167. [Google Scholar] [CrossRef] [Scilit]
  40. Mendu, V.; Singh, K.; Upadhyay, S.K. Insight into the Roles of Proline-Rich Extensin-like Receptor Protein Kinases of Bread Wheat (Triticum aestivum L.). Life 2022, 12, 941. [Google Scholar] [CrossRef] [Scilit]
  41. Sharma, H.; Sharma, A.; Rajput, R.; Sidhu, S.; Dhillon, H.; Verma, P.C.; Pandey, A.; Upadhyay, S.K. Molecular Characterization, Evolutionary Analysis, and Expression Profiling of BOR Genes in Important Cereals. Plants 2022, 11, 911. [Google Scholar] [CrossRef] [Scilit]
  42. Faraji, S.; Mehmood, F.; Malik, H.M.T.; Ahmed, I.; Heidari, P.; Poczai, P. The GASA Gene Family in Cacao (Theobroma cacao, Malvaceae): Genome Wide Identification and Expression Analysis. Agronomy 2021, 11, 1425. [Google Scholar]
  43. Boonpa, K.; Tantong, S.; Weerawanich, K.; Panpetch, P.; Pringsulaka, O.; Yingchutrakul, Y.; Roytrakul, S.; Sirikantaramas, S. Heterologous Expression and Antimicrobial Activity of OsGASR3 from Rice (Oryza sativa L.). J. Plant Physiol. 2018, 224, 95–102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Roxrud, I.; Lid, S.E.; Fletcher, J.C.; Schmidt, E.D.L.; Opsahl-Sorteberg, H.-G. GASA4, One of the 14-Member Arabidopsis GASA Family of Small Polypeptides, Regulates Flowering and Seed Development. Plant Cell Physiol. 2007, 48, 471–483. [Google Scholar] [CrossRef] [Scilit]
  45. An, B.; Wang, Q.; Zhang, X.; Zhang, B.; Luo, H.; He, C. Comprehensive Transcriptional and Functional Analyses of HbGASA Genes Reveal Their Roles in Fungal Pathogen Resistance in Hevea brasiliensis. Tree Genet. Genomes 2018, 14, 1–13. [Google Scholar] [CrossRef] [Scilit]
  46. Hernández-Martínez, M.A.; Suárez-Rodríguez, L.M.; López-Meza, J.E.; Ochoa-Zarzosa, A.; Salgado-Garciglia, R.; Fernández-Pavia, S.P.; López-Gómez, R. Antifungal Activity of Avocado Seed Recombinant GASA/Snakin PaSn. Antibiotics 2022, 11, 1558. [Google Scholar] [CrossRef] [Scilit]
  47. Ahmad, B.; Azeem, F.; Ali, M.A.; Nawaz, M.A.; Nadeem, H.; Abbas, A.; Batool, R.; Atif, R.M.; Ijaz, U.; Nieves-Cordones, M. Genome-Wide Identification and Expression Analysis of Two Component System Genes in Cicer arietinum. Genomics 2020, 112, 1371–1383. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  48. Liu, C.; Wu, Y.; Liu, Y.; Yang, L.; Dong, R.; Jiang, L.; Liu, P.; Liu, G.; Wang, Z.; Luo, L. Genome-Wide Analysis of Tandem Duplicated Genes and Their Contribution to Stress Resistance in Pigeonpea (Cajanus cajan). Genomics 2021, 113, 728–735. [Google Scholar] [CrossRef] [Scilit]
  49. Faraji, S.; Filiz, E.; Kazemitabar, S.K.; Vannozzi, A.; Palumbo, F.; Barcaccia, G.; Heidari, P. The AP2/ERF Gene Family in Triticum durum: Genome-Wide Identification and Expression Analysis under Drought and Salinity Stresses. Genes 2020, 11, 1464. [Google Scholar] [CrossRef] [Scilit]
  50. Li, S.; Xing, Y.; Valdes, P.J.; Huang, Y.; Su, T.; Farnsworth, A.; Lunt, D.J.; Tang, H.; Kennedy, A.T.; Zhou, Z. Oligocene Climate Signals and Forcings in Eurasia Revealed by Plant Macrofossil and Modelling Results. Gondwana Res. 2018, 61, 115–127. [Google Scholar] [CrossRef] [Scilit]
  51. Sun, S.; Wang, H.; Yu, H.; Zhong, C.; Zhang, X.; Peng, J.; Wang, X. GASA14 Regulates Leaf Expansion and Abiotic Stress Resistance by Modulating Reactive Oxygen Species Accumulation. J. Exp. Bot. 2013, 64, 1637–1647. [Google Scholar] [CrossRef] [Scilit]
  52. Tripathi, D.; Zhang, T.; Koo, A.J.; Stacey, G.; Tanaka, K. Extracellular ATP Acts on Jasmonate Signaling to Reinforce Plant Defense. Plant Physiol. 2018, 176, 511–523. [Google Scholar] [CrossRef] [Scilit]
  53. Meena, R.K.; Jangra, S.; Wadhwa, Z.; Wati, M.; Wati, L. Role of Plant Volatiles in Defense and Communication. Int. J. Curr. Microbiol. Appl. Sci. 2017, 6, 300–313. [Google Scholar] [CrossRef] [Scilit]
  54. Zhang, Y.; Li, X. Salicylic Acid: Biosynthesis, Perception, and Contributions to Plant Immunity. Curr. Opin. Plant Biol. 2019, 50, 29–36. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  55. Huang, W.; Wang, Y.; Li, X.; Zhang, Y. Biosynthesis and Regulation of Salicylic Acid and N-Hydroxypipecolic Acid in Plant Immunity. Mol. Plant 2020, 13, 31–41. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Hu, Y.; Ding, Y.; Cai, B.; Qin, X.; Wu, J.; Yuan, M.; Wan, S.; Zhao, Y.; Xin, X.-F. Bacterial Effectors Manipulate Plant Abscisic Acid Signaling for Creation of an Aqueous Apoplast. Cell Host Microbe 2022, 30, 518–529. [Google Scholar] [CrossRef] [Scilit]
  57. Li, X.; He, S.; Gao, Y.; Xing, S.; Ren, H.; Yang, H.; Gao, Y.; Wang, J.; Li, N.; Duan, J. Ceratocystis and Related Genera Causing Wilt of Cunninghamia lanceolata Yunnan, China. For. Pathol. 2022, 52, e12744. [Google Scholar] [CrossRef] [Scilit]
  58. Kazemzadeh-Chakusary, M.; Mohammadi, H.; Sohrabi, M. Occurrence and Pathogenicity of Jattaea algeriensis (Calosphaeriales, Calosphaeriaceae) and Biscogniauxia mediterranea on Forest Trees in Guilan Province (Iran). J. Phytopathol. 2021, 169, 129–138. [Google Scholar] [CrossRef] [Scilit]
  59. Brown, A.A.; Lawrence, D.P.; Baumgartner, K. Role of Basidiomycete Fungi in the Grapevine Trunk Disease Esca. Plant Pathol. 2020, 69, 205–220. [Google Scholar] [CrossRef] [Scilit]
  60. Darqui, F.S.; Radonic, L.M.; Trotz, P.M.; López, N.; Vázquez Rovere, C.; Hopp, H.E.; López Bilbao, M. Potato Snakin-1 Gene Enhances Tolerance to Rhizoctonia solani and Sclerotinia sclerotiorum in Transgenic Lettuce Plants. J. Biotechnol. 2018, 283, 62–69. [Google Scholar] [CrossRef] [Scilit]
  61. Berrocal-Lobo, M.; Segura, A.; Moreno, M.; López, G.; García-Olmedo, F.; Molina, A. Snakin-2, an Antimicrobial Peptide from Potato Whose Gene Is Locally Induced by Wounding and Responds to Pathogen Infection. Plant Physiol. 2002, 128, 951–961. [Google Scholar] [CrossRef] [Scilit]
  62. Mao, Z.; Zheng, J.; Wang, Y.; Chen, G.; Yang, Y.; Feng, D.; Xie, B. The New CaSn Gene Belonging to the Snakin Family Induces Resistance against Root-Knot Nematode Infection in Pepper. Phytoparasitica 2011, 39, 151–164. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Chromosomal locations of Snakin/GASA family members in three mangrove species. (A) Chromosomal locations of Snakin/GASA family members in A. corniculatum. (B) Chromosomal locations of Snakin/GASA family members in K. obovata. (C) Chromosomal locations of Snakin/GASA family members in A. marina.
Figure 1. Chromosomal locations of Snakin/GASA family members in three mangrove species. (A) Chromosomal locations of Snakin/GASA family members in A. corniculatum. (B) Chromosomal locations of Snakin/GASA family members in K. obovata. (C) Chromosomal locations of Snakin/GASA family members in A. marina.
Genes 14 00923 g001
Figure 2. Phylogenetic tree of Snakin/GASA family members of A. corniculatum, K. obovata, A. marina, V. vinifera, S. tuberosum, P. euphratica, A. thaliana, M. domestica, and P. trichocarpa. Members of the A. corniculatum family are denoted by purple stars and tick marks, while red and blue indicate the K. obovata and A. marina families, respectively.
Figure 2. Phylogenetic tree of Snakin/GASA family members of A. corniculatum, K. obovata, A. marina, V. vinifera, S. tuberosum, P. euphratica, A. thaliana, M. domestica, and P. trichocarpa. Members of the A. corniculatum family are denoted by purple stars and tick marks, while red and blue indicate the K. obovata and A. marina families, respectively.
Genes 14 00923 g002
Figure 3. The GASA domains of Snakin/GASA family members from three mangrove species (A. corniculatum (A), K. obovate (B), and A. marina (C)) were compared with those of potato Snakins.
Figure 3. The GASA domains of Snakin/GASA family members from three mangrove species (A. corniculatum (A), K. obovate (B), and A. marina (C)) were compared with those of potato Snakins.
Genes 14 00923 g003
Figure 4. Analysis of evolutionary relationships among Snakin/GASA family members. (A) Fragment duplication events within the genome of K. obovata. (B) Synteny analysis of Snakin/GASA family members between K. obovata, A. corniculatum, V. vinifera, P. trichocarpa, and A. thaliana.
Figure 4. Analysis of evolutionary relationships among Snakin/GASA family members. (A) Fragment duplication events within the genome of K. obovata. (B) Synteny analysis of Snakin/GASA family members between K. obovata, A. corniculatum, V. vinifera, P. trichocarpa, and A. thaliana.
Genes 14 00923 g004
Figure 5. The gene structure and motif analysis of Snakin/GASA family members of three mangrove species. (A) Unrooted phylogenetic tree constructed based on Snakin/GASA family members of the three mangrove species and A. thaliana. (B) Conserved motif distribution of Snakin/GASA family members in the three mangrove species. (C) Exon–intron composition analysis. The red boxes and black lines denote exon and intron positions, respectively. (D) Details of conserved motifs.
Figure 5. The gene structure and motif analysis of Snakin/GASA family members of three mangrove species. (A) Unrooted phylogenetic tree constructed based on Snakin/GASA family members of the three mangrove species and A. thaliana. (B) Conserved motif distribution of Snakin/GASA family members in the three mangrove species. (C) Exon–intron composition analysis. The red boxes and black lines denote exon and intron positions, respectively. (D) Details of conserved motifs.
Genes 14 00923 g005
Figure 6. Upstream regulatory elements analysis of Snakin/GASA family members in A. corniculatum (A), K. obovate (B), and A. marina (C).
Figure 6. Upstream regulatory elements analysis of Snakin/GASA family members in A. corniculatum (A), K. obovate (B), and A. marina (C).
Genes 14 00923 g006
Figure 7. Three-dimensional protein structure prediction of partial Snakin/GASA family members of three mangrove species.
Figure 7. Three-dimensional protein structure prediction of partial Snakin/GASA family members of three mangrove species.
Genes 14 00923 g007
Figure 8. Effects of pathogenic microbial infestation on the expression of Snakin/GASA family members in three mangrove species. Differential gene expression of Snakin/GASA family members in both normal and pathogen-infected leaves of A. corniculate (A), K. obovata (B), and A. marina (C). * p-value < 0.05, ** p-value < 0.01, *** p-value < 0.001, **** p-value < 0.0001.
Figure 8. Effects of pathogenic microbial infestation on the expression of Snakin/GASA family members in three mangrove species. Differential gene expression of Snakin/GASA family members in both normal and pathogen-infected leaves of A. corniculate (A), K. obovata (B), and A. marina (C). * p-value < 0.05, ** p-value < 0.01, *** p-value < 0.001, **** p-value < 0.0001.
Genes 14 00923 g008
Table 1. Physicochemical properties prediction of Snakin/GASA family members in A. corniculatum, K. obovata and A. marina.
Table 1. Physicochemical properties prediction of Snakin/GASA family members in A. corniculatum, K. obovata and A. marina.
NameSize (aa)pICys
Number
Arg + Lys
Number
Instability IndexAliphatic IndexGRAVY 1SignalP 2
AcGASA13468.52214631.0174.65−0.215No
AcGASA21057.94131253.366−0.07Yes
AcGASA31498.52101635.1870−0.295No
AcGASA41959.59143747.5185.54−0.401No
AcGASA5898.39141335.1958.09−0.215Yes
AcGASA64215.86204443.1376.53−0.308No
AcGASA73468.52214631.0174.65−0.215No
AcGASA83878.28224736.8467.03−0.357No
AcGASA9419.28739.4328.54−0.459Yes
AcGASA10978.86121324.4863.4−0.005Yes
AcGASA111549.54122547.8365.19−0.301Yes
AcGASA12889.14121537.7974.32−0.074Yes
AcGASA13719.06121325.830.14−0.586No
KoGASA1889.22131427.0658.86−0.115Yes
KoGASA21569.21151760.4878.210.085No
KoGASA31879.68132762.1762.09−0.34Yes
KoGASA4949.08141329.4367.45−0.014Yes
KoGASA5968.76121244.8545.83−0.248Yes
KoGASA61079.42121549.6947.38−0.308Yes
KoGASA71008.79121249.5468.4−0.082Yes
KoGASA8888.46121225.4670.80.043Yes
KoGASA91868.22132233.3658.23−0.533No
AmGASA11119.33141737.850.99−0.214Yes
AmGASA2968.92131345.9767.190.006Yes
AmGASA31168.53111169.3859.83−0.097No
AmGASA41599.83132587.1155.16−0.457Yes
AmGASA5889.02121427.6265.34−0.051Yes
AmGASA61149.24131462.3453.07−0.235Yes
AmGASA71049.34121560.2264.9−0.154Yes
AmGASA81038.79121238.7252.47−0.378No
AmGASA91059.06121540.0178.86−0.030Yes
AmGASA101078.45131233.7177.480.121Yes
AmGASA11989.28121536.4254.8−0.207Yes
AmGASA122499.72102378.3775.98−0.086Yes
AmGASA131069.52121639.747.83−0.284Yes
AmGASA141119.67121834.8454.59−0.307Yes
AmGASA151138.17151280.3960.44−0.251Yes
AmGASA16899.62121132.9670.11−0.085Yes
AmGASA17888.74121330.2463.18−0.23Yes
AmGASA181109.35121542.566.55−0.03Yes
AmGASA193075.39104430.9964.85−0.523Yes
AmGASA201089.67121938.176.670.024Yes
AmGASA21898.88121545.9159.21−0.307Yes
AmGASA22878.76121336.2466.21−0.093Yes
AmGASA23969.15131444.8963.020.050Yes
AmGASA241569.34132074.4252.5−0.374Yes
AmGASA251737.08101841.4466.65−0.125Yes
AmGASA261009.18121436.3574.20.065Yes
AmGASA271098.96111344.4780.55−0.049Yes
1 GRAVY: grand average of hydropathicity. 2 SignalP5.0: prediction, yes: have signal peptide, no: no signal peptide.
Table 2. Gene duplication events in A. corniculatum and K. obovata.
Table 2. Gene duplication events in A. corniculatum and K. obovata.
Duplicated Gene PairsKaKsKa/KsDuplicated
Type
Time
(MYE)
AcGASA7&AcGASA10.890.801.11Tandem29.67
AcGASA8&AcGASA51.060.821.30Tandem35.37
AcGASA8&AcGASA41.010.961.06Tandem33.74
AcGASA5&AcGASA61.001.001.00Tandem33.36
AcGASA5&AcGASA31.050.861.22Tandem34.92
AcGASA5&AcGASA90.991.020.97Tandem33.13
AcGASA6&AcGASA21.030.871.18Tandem34.48
AcGASA6&AcGASA41.010.961.05Tandem33.65
AcGASA2&AcGASA31.050.851.24Tandem35.10
AcGASA4&AcGASA30.971.090.89Tandem32.38
KoGASA1&KoGASA50.741.820.61Segmental60.75
KoGASA1&KoGASA81.020.960.32Segmental31.89
Table 3. Synteny analysis of Snakin/GASA family members between K. obovata, A. corniculatum, V. vinifera, P. trichocarpa, and A. thaliana.
Table 3. Synteny analysis of Snakin/GASA family members between K. obovata, A. corniculatum, V. vinifera, P. trichocarpa, and A. thaliana.
RelationshipMembersLocation 1MembersLocation 1
A. thaliana andAtGASA143AcGASA93
A. corniculatumAtGASA135AcGASA1110
A. thaliana andAtGASA11KoGASA76
K. obovataAtGASA72KoGASA11
AtGASA135KoGASA32
AtGASA45KoGASA64
AcGASA1110KoGASA34
AcGASA1216KoGASA87
AcGASA107KoGASA54
A. corniculatumAcGASA1110VvGASA514
and V. viniferaAcGASA1216VvGASA918
AcGASA1318VvGASA918
A. corniculatumAcGASA1318PtGASA1614
and P. trichocarpaAcGASA93PtGASA106
K. obovata andKoGASA11PtGASA21
P. trichocarpaKoGASA11PtGASA139
KoGASA914PtGASA1715
KoGASA32PtGASA41
KoGASA64PtGASA1817
KoGASA44PtGASA1917
KoGASA76PtGASA62
KoGASA76PtGASA95
KoGASA87PtGASA1614
K. obovata andKoGASA11VvGASA23
V. viniferaKoGASA914VvGASA11
KoGASA914VvGASA817
KoGASA32VvGASA514
KoGASA64VvGASA614
KoGASA64VvGASA717
KoGASA87VvGASA918
1 Location of members on chromosomes.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Shang, C.; Ye, T.; Zhou, Q.; Chen, P.; Li, X.; Li, W.; Chen, S.; Hu, Z.; Zhang, W. Genome-Wide Identification and Bioinformatics Analyses of Host Defense Peptides Snakin/GASA in Mangrove Plants. Genes 2023, 14, 923. https://doi.org/10.3390/genes14040923

AMA Style

Shang C, Ye T, Zhou Q, Chen P, Li X, Li W, Chen S, Hu Z, Zhang W. Genome-Wide Identification and Bioinformatics Analyses of Host Defense Peptides Snakin/GASA in Mangrove Plants. Genes. 2023; 14(4):923. https://doi.org/10.3390/genes14040923

Chicago/Turabian Style

Shang, Chenjing, Ting Ye, Qiao Zhou, Pengyu Chen, Xiangyu Li, Wenyi Li, Si Chen, Zhangli Hu, and Wei Zhang. 2023. "Genome-Wide Identification and Bioinformatics Analyses of Host Defense Peptides Snakin/GASA in Mangrove Plants" Genes 14, no. 4: 923. https://doi.org/10.3390/genes14040923

APA Style

Shang, C., Ye, T., Zhou, Q., Chen, P., Li, X., Li, W., Chen, S., Hu, Z., & Zhang, W. (2023). Genome-Wide Identification and Bioinformatics Analyses of Host Defense Peptides Snakin/GASA in Mangrove Plants. Genes, 14(4), 923. https://doi.org/10.3390/genes14040923

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop