Next Article in Journal
Retinal Phenotyping of a Murine Model of Lafora Disease
Next Article in Special Issue
Circ_PIAS1 Promotes the Apoptosis of ALV-J Infected DF1 Cells by Up-Regulating miR-183
Previous Article in Journal
Phenotypes and Genotypes in Patients with SMC1A-Related Developmental and Epileptic Encephalopathy
Previous Article in Special Issue
RNA-Seq Profiling between Commercial and Indigenous Iranian Chickens Highlights Differences in Innate Immune Gene Expression
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Genes
Volume 14
Issue 4
10.3390/genes14040856
genes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Association Study Reveals the Genetic Basis of Duck Plumage Colors

by
Xinye Zhang
1,
Tao Zhu
1,
Liang Wang
2,
Xueze Lv
2,
Weifang Yang
2,
Changqing Qu
3,
Haiying Li
4,
Huie Wang
5,
Zhonghua Ning
1 and
Lujiang Qu
1,*
1
National Engineering Laboratory for Animal Breeding, Department of Animal Genetics and Breeding, College of Animal Science and Technology, China Agricultural University, Yuanmingyuan West Road 2, Beijing 100193, China
2
Beijing Municipal General Station of Animal Science, Beijing 100107, China
3
Engineering Technology Research Center of Anti-Aging Chinese Herbal Medicine of Anhui Province, Fuyang Normal University, Fuyang 236037, China
4
College of Animal Science, Xinjiang Agricultural University, Urumchi 830052, China
5
College of Animal Science, Tarim University, Alar 843300, China
*
Author to whom correspondence should be addressed.
Genes 2023, 14(4), 856; https://doi.org/10.3390/genes14040856
Submission received: 12 February 2023 / Revised: 17 March 2023 / Accepted: 30 March 2023 / Published: 31 March 2023
(This article belongs to the Special Issue Poultry Genetics and Genomics)
Browse Figures
Review Reports Versions Notes

Abstract

:
Plumage color is an artificially and naturally selected trait in domestic ducks. Black, white, and spotty are the main feather colors in domestic ducks. Previous studies have shown that black plumage color is caused by MC1R, and white plumage color is caused by MITF. We performed a genome-wide association study (GWAS) to identify candidate genes associated with white, black, and spotty plumage in ducks. Two non-synonymous SNPs in MC1R (c.52G>A and c.376G>A) were significantly related to duck black plumage, and three SNPs in MITF (chr13:15411658A>G, chr13:15412570T>C and chr13:15412592C>G) were associated with white plumage. Additionally, we also identified the epistatic interactions between causing loci. Some ducks with white plumage carry the c.52G>A and c.376G>A in MC1R, which also compensated for black and spotty plumage color phenotypes, suggesting that MC1R and MITF have an epistatic effect. The MITF locus was supposed to be an upstream gene to MC1R underlying the white, black, and spotty colors. Although the specific mechanism remains to be further clarified, these findings support the importance of epistasis in plumage color variation in ducks.

1. Introduction

Plumage color in birds plays a significant role in courtship and camouflage [1,2]. It is also an important target trait in the poultry industry and has been used for sex identification and breed improvement [3]. In ducks, a greater variety of plumage colors have been found in domestic ducks compared to the mallard [4] (Figure 1). White plumage has been found in the Beijing duck, Lian-cheng white duck, etc.; black plumage has been found in the Wendeng black duck and Putian black duck, etc.; and spotty plumage has been found in the Gaoyou duck and Shanma duck, etc. These plumage variations are used to clearly distinguish domesticated ducks from their wild ancestors, which indicates that alleles for black and white plumage color are undergoing artificial selection during the domestication process of ducks.
There are numerous studies focusing on the molecular mechanisms of plumage color variation. Studies have found that the variation in the content, proportion, and location of melanin in plumage affects different plumage color phenotypes [5]. Melanin biosynthesis takes place in melanosomes [6,7,8]. Melanin mainly consists of two types, eumelanin and pheomelanin [9]. The two types of melanin are both tyrosine derivatives. The relative amounts of the two melanin pigments are determined by tyrosinase activity and expression, with high tyrosinase activity resulting in the production of eumelanin and low tyrosinase activity resulting in the production of pheomelanin [10]. The migration, proliferation, and differentiation of melanocytes can also affect pigmentation, leading to differences in plumage color [11].
Previous studies have identified 11 loci associated with plumage color in ducks. Among these, at the recessive white (c) locus, the recessive allele (cc) is responsible for the white plumage color [4,12,13]. Gong et al. [14] found the recessive allele (tt) at the autosomal locus (T) determines the white plumage in Liancheng duck. The E locus is related to black plumage. In chickens, the black locus (E) corresponds to MC1R [15,16]. However, the relationship between loci and regulatory genes that affect pigmentation traits in ducks is still unclear.
Currently, numerous genes related to melanin have been identified. MITF belongs to the family of the bHLH-leucine zipper transcription factors and is involved in the melanogenesis pathway [17]. MITF regulates a variety of melanocyte-specific genes, such as directly regulating the genes encoding TYR, TYRP1, and TYRP2/DCT, resulting in an upregulation of their expression. Mutations in the MITF gene can cause different depth of coat color depigmentation in mice, including dilutions, white spotting, or a complete absence of pigmentation [18,19,20]. Silver plumage in Japanese quail is linked to the B mutation in the MITF gene [21]. MITF is also a key gene associated with the white plumage in ducks [22,23,24,25,26,27]. MC1R can promote the production of eumelanin by stimulating the intracellular cAMP signal transduction pathway [28]. If MC1R at low activity, pigment synthesis will generally shift to a predominantly pheomelanin. In chickens, MC1R encodes the E locus and affects the plumage color phenotype. Different alleles of E locus affect the distribution of eumelanin and phaeomelanin, leading to different depth of pigment phenotypes in chicken feathers [29]. Glu92Lys mutations in MC1R cause black plumage in chickens [15,16,30]. Zhang et al. [31] found that three mutations in MC1R (one synonymous SNP (69 C>T) and two non-synonymous SNPs (212 T>C and 274 A>G)) were related to tile-grey plumage in chickens. Zhang et al. [32] found the Ile57Val mutation was significantly related with the black color phenotype in Japanese quails. In ducks, the extended black color is also associated with MC1R [33,34].
Plumage color is affected by many complex genetic factors, involving linkage, epistasis, and pleiotropy [35]. Gene interactions also play an important role in plumage color. However, epistatic interaction effects between MC1R and MITF on duck coloration have not been determined. Epistasis is generally defined as non-additive effects of two genes, whereby the effect of one locus is masked by that of another locus [36]. Analyses of epistasis can provide a deeper understanding of the genetic basis of complex traits [36,37,38]. Rapid advances in bioinformation technology have enabled the identification of candidate variants or genes at the whole-genome scale, as well as gene interactions [37,39,40].
In this study, we explored the genetic mechanism underlying duck plumage colors. In particular, we selected 96 ducks with different colors for next-generation sequencing and GWAS of white, black, and spotty colors to identify candidate genes. Our study focused on the roles of gene interactions in plumage color and on providing a new insight for genetic research on the plumage color in ducks.

2. Materials and Methods

2.1. Sampling

In total, 96 ducks from two wild populations and ten domestic breeds were used, including wild spot-billed duck (SB, n = 7), mallard (MD, n = 8), Peking duck (PK, n = 8), Maple Leaf duck (FY, n = 8), Cherry Valley Duck (CV, n = 8), Wendeng black duck (WD, n = 8), Putian black duck (PT, n = 8), Gaoyou duck (GY, n = 8), Jinding duck (JD, n = 8), Mei duck (MEI, n = 9), Shanma duck (SM, n = 8), Shaoxing duck (SX, n = 8). SB was sampled from Ningxia Province, China; MD was sampled from Zhejiang Province, China; PK, FY, and CV were sampled from Beijing, China; JD, SM, and PT were sampled from Fujian Province, China; SX and GY ducks were sampled from Jiangsu Province, China; MEI was sampled from Anhui Province, China; WD was sampled from Shandong, China. Detailed sample information, including plumage colors, is provided in Table 1. The animal experimentation protocols were approved by the Animal Welfare Committee of China Agricultural University, and the study was performed in accordance with ethical guidelines for animal research.

2.2. Genotyping and SNP Calling

Blood samples were collected through the wing vein. The genomic DNA was extracted with a standard phenol-chloroform method. The DNA samples were sequenced on the Illumina Hiseq2500 platform, with the read length of 150 bp at each end (San Diego, CA, USA). The sequences were filtered with default parameters using fastp v0.20.0 [41]. Reads with Q value less than 20 or high-quality bases less than 70% were excluded.
The clean reads were mapped to the duck reference genome (cau_duck1.0) using BWA-MEM v0.7.15 [42]. Genome Analysis Toolkit version 4.1.8.1 was used for the realignment of reads and SNP calling. The ‘SortSam’ command was used for reads sorting by coordinate. Duplicate reads were marked using the ‘MarkDuplicates’ command. The ‘ApplyBQSR’ command was used to recalibrate the base quality score. The ‘HaplotypeCaller’ command was used to call SNPs and indels, and ‘CombineGVCFs’ command was used to generate variant set in VCF format. A joint genotyping was performed with the ‘GenotypeGVCFs’ command.
Then, the SNPs were filtered by following thresholds: (a) QUAL > 30.0; (b) QD > 5.0; (c) FS < 60.0; (d) MQ > 40.0; (e) MQRankSum > 12.5; and (f) ReadPosRankSum > 8.0. Additionally, 10 bp windows with more than three SNPs were excluded from analyses [43].

2.3. GWAS

Plink was used for quality filtering prior to GWAS. After filtration, we obtained a total of 10,014,685 SNPs. Subsequently, GEMMA [44] was used for the GWAS with a univariate linear mixed model. The models were as follows:
y = Wα + xβ + u + ϵ,
where y denotes the vector of phenotypic values for individuals, W is the matrix of covariates, α denotes the vector of corresponding coefficients consisting of the intercept, x is the vector of marker genotypes, β is an estimate of the additive effect of the marker/SNP, u is the vector of random effects, ϵ is the vector of errors.
The significance threshold was set to 0.05/SNP number. The GWAS results were visualized using the R package CMplot. The genome control inflation factor lambda (λ) was calculated to evaluate confounding due to population stratification using the R package gap.

2.4. Analysis of SNP–SNP Epistasis

Epistatic effects were detected using PLINK v1.9 with command ‘–fast-epistasis’. The statistical model used to test for epistatic effects associated with plumage color traits was as follows:
ln ( P ( Y = case ) P ( Y = control ) ) = β 0 + β 1 g A + β 2 g B + β 3 g A g B
where, for each inspected variant pair (A, B), gA and gB were the allele counts. The β3 coefficients were tested for significance. We identified epistasis between SNPs associated with genes using p-value threshold of 0.05.

2.5. Functional Annotation

Candidate genes were identified by the overlapping significant SNPs on the reference genome (cau_duck1.0), and the Variation Effect Predictor tool in Ensembl was used to evaluate the functional enrichment of candidate SNPs (http://useast.ensembl.org/Multi/Tools/VEP, accessed on 11 February 2023) [45].

3. Results

3.1. Associations between SNPs and Plumage Color

Since the λ value of the different plumage color were 1.029 (black plumage) and 0.987 (white plumage), the effect of population stratification was not considered in our study. By a GWAS, we identified 64 SNPs using the threshold of significant p-value (4.583099 × 10−9) that were significantly associated with the black/spotty plumage color. Ten genes were around significant peaks, including MC1R, TCF25, NELL2, CARD10, PTGFRN, AKIRIN2, RYR3, PGAP1, FRMPD3, USP20. Among them, MC1R is associated with pigmentation [16,30,46,47]. The GWAS results and SNP information are shown in Figure 2 and Table S1.
For the white/spotty plumage color group, we identified 491 SNPs using the threshold of significant p-value (6.042978 × 10−9). Thirty-two genes were around significant peaks, including WNT7B, VWF, MTUS2, CACNB2, PKHD1, CEP162, PDGFC, SLIT2, GRIA2, DLST, HERC4, SEMA5B, ZNF385B, SLC49A4, ACVR2A, LPP, PCSK6, ADCY7, WTIP, GPI, MGLL, MAGI1, ARL8B, ITPR1, PPP4R2, MITF, SLC25A26, PTPRG, ITIH4, QRICH1, ARHGAP26, MVB12B. Some genes, such as WNT7B and MITF, have been demonstrated to be associated with pigmentation [17,48]. Among these genes, MITF is known to be essential for melanocyte development and could directly account for the phenotypic difference between white plumage and spotty plumage in this study. The significant SNPs in WNT7B have a weaker relation to the white plumage. The detail GWAS results and SNPs are shown in Figure 3 and Table S2.
Polymorphisms in MC1R and MITF are listed in Table 2. We detected two nonsynonymous SNPs (c.52G>A and c.376G>A) in MC1R and found that the GA and AA genotypes of c.52G>A and c.376G>A in MC1R showed higher frequencies in WD and PT, suggesting that the two mutations in MC1R was significantly associated with black plumage. At the c.52G>A locus, AA was the most frequent genotype in PT with 62.5% while GA was the most frequent genotype in WD with 75%. At the c.376G>A locus, AA was the most frequent genotype in PT with 62.5% while GA was the most frequent genotype in WD with 75%. In WD, two individuals carry the GG genotype in c.52G>A, and one carries the GG genotype in c.376G>A. Furthermore, we observed that genotype GA and AA genotypes of SNPs (c.52G>A and c.376G>A) showed higher frequencies in PK, CV, and FY, as opposed to their white plumage phenotype, suggesting that MC1R and MITF have an interaction effect. Three SNPs (chr13:15411658A>G, chr13:15412570T>C, and chr13:15412592C>G) were detected in MITF, which is located in the intron regions. The AA genotype of chr13:15411658A>G, the TT genotype of chr13:15412570T>C, and the CC genotype of chr13:15412592C>G were the most frequent genotype in PK, FY, and CV, which were responsible for the recessive white variant in ducks.
In addition, to detect the 6.6-kb insertion in Pekin ducks found by Zhou et al. [27], we examined the deletion of a large segment of MITF in spotty-feathered ducks and found this insertion in all spotty ducks is missing.

3.2. MITF–MC1R Interaction and Epistasis

We examined the interaction between MITF and MC1R and epistatic effects by analyzing SNPs in candidate genes. In an epistasis analysis, a significant interactive effect of MC1R and MITF was observed in the white and spotty plumage group (p < 0.05) and white and black plumage group (p < 0.05) but not in white and non-white plumage group (p > 0.05) (Table 3).

4. Discussion

Plumage color is an important trait in the poultry industry. The genetic and molecular mechanisms underlying the diversity in plumage color have been studied extensively. MC1R and MITF have been identified as candidate genes related to this trait [26,27,33,34]. The MC1R gene encodes the MC1R protein, a G protein-coupled receptor primarily expressed in melanocytes. The activation of MC1R is mediated by α-melanocyte-stimulating hormone (α-MSH) and leads to an increase in eumelanin. Conversely, binding to the inverse agonist Agouti inhibits MC1R activity, which reduces eumelanin and increases pheomelanin within melanocytes [28]. MITF has been identified as the main regulatory factor in melanocyte biology and can activate the expression of genes involved in the production of melanin [49]. In this study, we evaluated the mutations of MC1R and MITF involved in plumage color variation in ducks. Two non-synonymous SNPs in MC1R (c.52G>A and c.376G>A) were associated with black plumage in ducks in this study. The AA genotype of c.52G>A and the AA genotype of c.376G>A showed higher frequencies in PT. The GA genotype of c.52G>A and the GA genotype of c.376G>A showed higher frequencies in WD. As previously reported, the extended black phenotype in ducks is caused by non-synonymous SNPs (c.52G>A and c.376G>A) in MC1R [33,34]. p.Glu18Lys, resulting from the c.52G>A substitution, may have led to the overexpression of MC1R by either disrupting or creating a salt bridge with the extracellular ligands of the MC1R protein [33]. Furthermore, p.Val126Ile, resulting from the c.376G>A mutation in the third transmembrane domain of MC1R, has been linked to pigmentation in both chickens and ducks [16,33,50].
SNPs, indels, and structural variants in MITF have been reported as possible causes of duck white plumage. Li et al. [22] found that two isoforms of MITF (B and M isoforms) were expressed in black feather bulbs while only an M isoform of MITF was expressed in white feather bulbs. Lin et al. [23] found that g.39807T>G and g.40862G>A of MITF were associated with white plumage in Putian ducks while g.32813G>A of MITF was strongly correlated with white plumage in Liancheng white ducks. Zhang et al. [26] found thirteen SNPs and two indels associated with white plumage in ducks. Yang et al. [25] have found that six SNPs of MITF are associated with plumage color in Kaiya–Liancheng F2 offspring. Guo et al. [51] found that MITF is closely related to white plumage color. In this study, we identified three SNPs in MITF (chr13:15411658A>G, chr13:15412570T>C, and chr13:15412592C>G) in white-feathered ducks, which are located in the intron region. The above findings showed that MITF was significantly associated with white plumage color. Additionally, small indels and large intron insertions are complex variants with the potential to have substantial impacts on phenotypic variation [52,53,54]. In our study, we detected the 6.6kb insertion in ducks and found this insertion was present in ducks with white plumage. This suggests that functional mutations in MITF are key factors in the white plumage phenotype of ducks.
Epistasis plays a crucial role in the evolution of complex genetic systems. Interactions between genes can have important implications for the functions of genetic pathways [55]. Our results showed that MITF and MC1R have an epistatic relationship. In the white/spotty plumage groups and white/black plumage groups, the white feather gene (MITF) masked the effect of the extended black feather gene (MC1R). In the white/non-white plumage groups, we could not detect an epistatic effect between MITF and MC1R. Research has shown that there is a complex interaction between MITF and MC1R in the regulation of melanocyte function and melanin synthesis. MITF regulates the expression of enzymes responsible for melanin synthesis and the expression of a receptor that is involved in the function of melanocytes [56]. In cream-colored Australian cattle dogs, researchers have found that a single nucleotide variant in the MC1R promoter causes cream coloration in dogs [57]. Zhou et al. [27] found that the expression levels of genes downstream of MITF in the melanin synthesis pathway (MLANA, TYR, TYRP1, DCT, OCA2, and MLPH) were downregulated, indicating that MITF plays a switching role in the melanogenesis pathway of Pekin duck. However, the molecular mechanism remains to be further clarified.
Studies of duck plumage color [4,58] have revealed that at the extended black locus (E), the E allele causes black plumage while the non-extended black homozygous ee genotype results in a spotty plumage color. Lin et al. [59] found that the average frequency of spotty plumage in offspring produced by Putian black ducks was 23.15% while the remaining offspring show black plumage, indicating that black plumage was dominant. Homozygous recessive alleles (cc) at the C locus produce white plumage, which prevents the expression of other colors [4,13,58]. This suggests that, regardless of the genotype at the E locus, individuals with the cc genotype have white plumage in ducks. At the C locus, the recessive white allele is homozygous (c/c), effectively masking the effect of the C allele. For the genotype C/- (C/C or C/c) at the C locus, individuals have black/spotty plumage affected by the E locus. At the E locus, the E allele is dominant to e, where individuals with the E allele have black plumage and those with the e/e genotype have spotty plumage. However, individuals with the c/c genotype at the C locus have white plumage regardless of the genotype at the E locus. The C locus may be epistatic to the E locus. This pattern of plumage color inheritance was supported by the phenotypic distribution in a duck cross test [27,59]. In our study, epistasis was detected between variants in MITF and MC1R gene, which indicated that the E locus corresponds to MC1R and the C locus corresponds to MITF and that the C locus masked the effect of the E locus.
In other animals, such as chickens, mice, cattle, and pigs, the expanded black locus E is thought to correspond to MC1R [15,16,28,60,61]. We investigated the different mutations leading to the respective phenotypes by GWAS on duck breeds with different plumage colors. The results showed that c.52G>A and c.376G>A of MC1R were associated with black plumage color. We hypothesize that these two mutations on MC1R are relevant to the E alleles, in agreement with the results reported by YU et al. [33]. Furthermore, YU et al. also found that c.52G>A was more associated with the E allele, but this difference was not shown in our study. In our study, very few individuals of WD ducks with the black plumage phenotype showed the GG genotype at c.52G>A and c.376G>A of MC1R. Meanwhile, mutations of c.52G>A and c.376G>A in MC1R are prevalent in PT. A possible reason for this phenomenon is the presence of individuals with the spotty-feather phenotype in the Wendeng black duck while the plumage color in PT is all black. In addition, further experimental protocols and studies are needed to assess the genetic mechanisms that influence plumage color in WD.

5. Conclusions

We identified MITF and MC1R as candidate genes for duck plumage color. c.52G>A and c.376G>A in MC1R were closely related to duck black plumage. The MITF locus functioned upstream of MC1R in the determination of the white, black, and spotty colors in ducks.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/genes14040856/s1, Table S1: Genome-wide SNPs associated with black plumage color trait, Table S2: Genome-wide SNPs associated with white plumage color trait.

Author Contributions

Conceptualization, L.Q. and X.Z.; methodology, T.Z.; software, X.Z.; valida-tion, L.W. and X.L.; formal analysis, W.Y.; investigation, C.Q.; resources, H.L.; data curation, H.W.; writing—original draft preparation, X.Z.; writing—review and editing, T.Z. and L.Q.; visualization, X.Z.; supervision, Z.N.; project administration, L.Q.; funding acquisition, L.Q. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Beijing Agriculture Innovation Consortium for Poultry (BAIC06-2022-G01).

Institutional Review Board Statement

The experimental protocols related to animal experimentation in this study followed the actual law of animal protection and approved by the Animal Welfare Committee of China Agricultural University (permit XK622). The spot-billed ducks and Mei ducks was sampled with permission from Institute of Animal Science of Chinese Academy of Agricultural Sciences (Permit 046/2018).

Informed Consent Statement

Not applicable.

Data Availability Statement

The genome data for WD and PT ducks used in this study are available on request from the corresponding author. The remaining genome data can be found in our previous research with accession ID PRJNA686828 and PRJNA419832 [26,62].

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Seddon, N.; Botero, C.A.; Tobias, J.; Dunn, P.O.; MacGregor, H.E.A.; Rubenstein, D.; Uy, J.A.C.; Weir, J.T.; Whittingham, L.A.; Safran, R.J. Sexual selection accelerates signal evolution during speciation in birds. Proc. R. Soc. B Boil. Sci. 2013, 280, 20131065. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Wilkins, M.R.; Karaardıç, H.; Vortman, Y.; Parchman, T.L.; Albrecht, T.; Petrželková, A.; Özkan, L.; Pap, P.L.; Hubbard, J.K.; Hund, A.K.; et al. Phenotypic differentiation is associated with divergent sexual selection among closely related barn swallow populations. J. Evol. Biol. 2016, 29, 2410–2421. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Hubbard, J.K.; Jenkins, B.R.; Safran, R.J. Quantitative genetics of plumage color: Lifetime effects of early nest environment on a colorful sexual signal. Ecol. Evol. 2015, 5, 3436–3449. [Google Scholar] [CrossRef] [PubMed]
  4. Lancaster, F.M. The Inheritance of Plumage Colour in the Common Duck; Bibliographia Genetica XIX; Springer: Berlin/Heidelberg, Germany, 1963; pp. 317–404. [Google Scholar]
  5. Gluckman, T.-L.; Mundy, N.I. Evolutionary pathways to convergence in plumage patterns. BMC Evol. Biol. 2016, 16, 172. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  6. Kushimoto, T.; Valencia, J.; Costin, G.-E.; Toyofuku, K.; Watabe, H.; Yasumoto, K.-I.; Rouzaud, F.; Vieira, W.; Hearing, V. The Seiji memorial lecture: The melanosome: An ideal model to study cellular differentiation. Pigment. Cell Res. 2003, 16, 237–244. [Google Scholar] [CrossRef]
  7. Le Douarin, N.M.; Dupin, E. Multipotentiality of the neural crest. Curr. Opin. Genet. Dev. 2003, 13, 529–536. [Google Scholar] [CrossRef]
  8. Wakamatsu, K.; Ito, S. Advanced Chemical Methods in Melanin Determination. Pigment. Cell Res. 2002, 15, 174–183. [Google Scholar] [CrossRef]
  9. McGraw, K.J.; Safran, R.J.; Wakamatsu, K. How feather colour reflects its melanin content. Funct. Ecol. 2005, 19, 816–821. [Google Scholar] [CrossRef]
  10. Hearing, V.J.; Tsukamoto, K. Enzymatic control of pigmentation in mammals. FASEB J. 1991, 5, 2902–2909. [Google Scholar] [CrossRef] [Green Version]
  11. Raposo, G.; Marks, M.S. Melanosomes—Dark organelles enlighten endosomal membrane transport. Nat. Rev. Mol. Cell Biol. 2007, 8, 786–797. [Google Scholar] [CrossRef] [Green Version]
  12. Campbell, R.; Reinhard, B.; Jerome, F. A “New” Allele of the Mallard Plumage Pattern in Ducks. Poult. Sci. 1984, 63, 19–24. [Google Scholar] [CrossRef]
  13. Jaap, R.G. Inheritance of White Spotting in Ducks. Poult. Sci. 1933, 12, 233–241. [Google Scholar] [CrossRef]
  14. Gong, Y.; Yang, Q.; Li, S.; Feng, Y.; Gao, C.; Tu, G.; Peng, X. Grey plumage colouration in the duck is genetically determined by the alleles on two different, interacting loci. Anim. Genet. 2010, 41, 105–108. [Google Scholar] [CrossRef] [PubMed]
  15. Takeuchi, S.; Suzuki, H.; Yabuuchi, M.; Takahashi, S. A possible involvement of melanocortin 1-receptor in regulating feather color pigmentation in the chicken. Biochim. Biophys. Acta (BBA) Gene Struct. Expr. 1996, 1308, 164–168. [Google Scholar] [CrossRef]
  16. Kerje, S.; Lind, J.; Schütz, K.; Jensen, P.; Andersson, L. Melanocortin 1-receptor (MC1R) mutations are associated with plumage colour in chicken. Anim. Genet. 2003, 34, 241–248. [Google Scholar] [CrossRef] [PubMed]
  17. Hallsson, J.H.; Haflidadóttir, B.S.; Schepsky, A.; Arnheiter, H.; Steingrímsson, E. Evolutionary sequence comparison of the Mitf gene reveals novel conserved domains. Pigment. Cell Res. 2007, 20, 185–200. [Google Scholar] [CrossRef] [PubMed]
  18. Hodgkinson, C.A.; Moore, K.J.; Nakayama, A.; Steingrímsson, E.; Copeland, N.G.; Jenkins, N.A.; Arnheiter, H. Mutations at the mouse microphthalmia locus are associated with defects in a gene encoding a novel basic-helix-loop-helix-zipper protein. Cell 1993, 74, 395–404. [Google Scholar] [CrossRef]
  19. Moore, K.J. Insight into the microphthalmia gene. Trends Genet. 1995, 11, 442–448. [Google Scholar] [CrossRef]
  20. Steingrímsson, E.; Moore, K.J.; Lamoreux, M.L.; Ferré-D’Amaré, A.R.; Burley, S.; Zimring, D.C.S.; Skow, L.; Hodgkinson, C.A.; Arnheiter, H.; Copeland, N.G.; et al. Molecular basis of mouse microphthalmia (mi) mutations helps explain their developmental and phenotypic consequences. Nat. Genet. 1994, 8, 256–263. [Google Scholar] [CrossRef]
  21. Minvielle, F.; Bed’Hom, B.; Coville, J.-L.; Ito, S.; Inoue-Murayama, M.; Gourichon, D. The “silver” Japanese quail and the MITF gene: Causal mutation, associated traits and homology with the “blue” chicken plumage. BMC Genet. 2010, 11, 15. [Google Scholar] [CrossRef]
  22. Li, S.; Wang, C.; Yu, W.; Zhao, S.; Gong, Y. Identification of Genes Related to White and Black Plumage Formation by RNA-Seq from White and Black Feather Bulbs in Ducks. PLoS ONE 2012, 7, e36592. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Lin, R.; Lin, W.; Zhou, S.; Chen, Q.; Pan, J.; Miao, Y.; Zhang, M.; Huang, Z.; Xiao, T. Integrated Analysis of mRNA Expression, CpG Island Methylation, and Polymorphisms in the MITF Gene in Ducks (Anas platyrhynchos). BioMed Res. Int. 2019, 2019, 8512467. [Google Scholar] [CrossRef] [Green Version]
  24. Sultana, H.; Seo, D.; Choi, N.-R.; Alam Bhuiyan, S.; Lee, S.H.; Heo, K.N.; Lee, J.H. Identification of polymorphisms in MITF and DCT genes and their associations with plumage colors in Asian duck breeds. Asian-Australas. J. Anim. Sci. 2018, 31, 180–188. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Yang, L.; Mo, C.; Shen, W.; Du, X.; Bhuiyan, A.A.; Li, L.; Li, N.; Gong, Y.; Li, S. The recessive C locus in the MITF gene plays a key regulatory role in the plumage colour pattern of duck (Anas platyrhynchos). Br. Poult. Sci. 2019, 60, 105–108. [Google Scholar] [CrossRef]
  26. Zhang, Z.; Jia, Y.; Almeida, P.; E Mank, J.; van Tuinen, M.; Wang, Q.; Jiang, Z.; Chen, Y.; Zhan, K.; Hou, S.; et al. Whole-genome resequencing reveals signatures of selection and timing of duck domestication. Gigascience 2018, 7, giy027. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  27. Zhou, Z.; Li, M.; Cheng, H.; Fan, W.; Yuan, Z.; Gao, Q.; Xu, Y.; Guo, Z.; Zhang, Y.; Hu, J.; et al. An intercross population study reveals genes associated with body size and plumage color in ducks. Nat. Commun. 2018, 9, 2648. [Google Scholar] [CrossRef] [Green Version]
  28. Robbins, L.S.; Nadeau, J.H.; Johnson, K.R.; Kelly, M.A.; Roselli-Rehfuss, L.; Baack, E.; Mountjoy, K.G.; Cone, R.D. Pigmentation phenotypes of variant extension locus alleles result from point mutations that alter MSH receptor function. Cell 1993, 72, 827–834. [Google Scholar] [CrossRef]
  29. Schiöth, H.B.; Raudsepp, T.; Ringholm, A.; Fredriksson, R.; Takeuchi, S.; Larhammar, D.; Chowdhary, B.P. Remarkable synteny conservation of melanocortin receptors in chicken, human, and other vertebrates. Genomics 2003, 81, 504–509. [Google Scholar] [CrossRef]
  30. Dávila, S.G.; Gil, M.G.; Resino-Talaván, P.; Campo, J.L. Association between polymorphism in the melanocortin 1 receptor gene and E locus plumage color phenotype. Poult. Sci. 2014, 93, 1089–1096. [Google Scholar] [CrossRef]
  31. Zhang, L.Y.; Huang, M.Y.; Li, Y.; Yang, X.D.; Luo, Y.S.; Shi, X.W. Molecular characteristics of MC1R gene in tile-grey plumage of domestic chicken. Br. Poult. Sci. 2020, 61, 382–389. [Google Scholar] [CrossRef]
  32. Zhang, X.; Pang, Y.; Zhao, S.; Xu, H.; Li, Y.; Xu, Y.; Guo, Z.; Wang, D. The relationship of plumage colours with MC1R (Melanocortin 1 Receptor) and ASIP (Agouti Signaling Protein) in Japanese quail (Coturnix coturnix japonica). Br. Poult. Sci. 2013, 54, 306–311. [Google Scholar] [CrossRef] [PubMed]
  33. Yu, W.; Wang, C.; Xin, Q.; Li, S.; Feng, Y.; Peng, X.; Gong, Y. Non-synonymous SNPs in MC1R gene are associated with the extended black variant in domestic ducks (Anas platyrhynchos). Anim. Genet. 2012, 44, 214–216. [Google Scholar] [CrossRef] [PubMed]
  34. Sultana, H.; Seo, D.-W.; Park, H.-B.; Choi, N.-R.; Hoque, R.; Alam Bhuiyan, S.; Heo, K.-N.; Lee, S.-H.; Lee, J.-H. Identification of MC1R SNPs and their Association with Plumage Colors in Asian Duck. J. Poult. Sci. 2017, 54, 111–120. [Google Scholar] [CrossRef] [Green Version]
  35. Wright, D.; Rubin, C.-J.; Barrio, A.M.; Schütz, K.; Kerje, S.; Brändström, H.; Kindmark, A.; Jensen, P.; Andersson, L. The genetic architecture of domestication in the chicken: Effects of pleiotropy and linkage. Mol. Ecol. 2010, 19, 5140–5156. [Google Scholar] [CrossRef] [PubMed]
  36. Cordell, H.J. Epistasis: What it means, what it doesn’t mean, and statistical methods to detect it in humans. Hum. Mol. Genet. 2002, 11, 2463–2468. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  37. Huang, W.; Richards, S.; Carbone, M.A.; Zhu, D.; Anholt, R.R.H.; Ayroles, J.F.; Duncan, L.; Jordan, K.W.; Lawrence, F.; Magwire, M.M.; et al. Epistasis dominates the genetic architecture of Drosophila quantitative traits. Proc. Natl. Acad. Sci. USA 2012, 109, 15553–15559. [Google Scholar] [CrossRef] [Green Version]
  38. Zhang, H.; Yu, J.-Q.; Yang, L.-L.; Kramer, L.M.; Zhang, X.-Y.; Na, W.; Reecy, J.M.; Li, H. Identification of genome-wide SNP-SNP interactions associated with important traits in chicken. BMC Genom. 2017, 18, 892. [Google Scholar] [CrossRef] [Green Version]
  39. Mackay, T.F.C. Epistasis and quantitative traits: Using model organisms to study gene–gene interactions. Nat. Rev. Genet. 2013, 15, 22–33. [Google Scholar] [CrossRef] [Green Version]
  40. Manolio, T.A.; Collins, F.S.; Cox, N.J.; Goldstein, D.B.; Hindorff, L.A.; Hunter, D.J.; McCarthy, M.I.; Ramos, E.M.; Cardon, L.R.; Chakravarti, A.; et al. Finding the missing heritability of complex diseases. Nature 2009, 461, 747–753. [Google Scholar] [CrossRef] [Green Version]
  41. Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef]
  42. Li, H.; Durbin, R. Fast and accurate short read alignment with Burrows—Wheeler transform. Bioinformatics 2009, 25, 1754–1760. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  43. Li, H.; Ruan, J.; Durbin, R. Mapping short DNA sequencing reads and calling variants using mapping quality scores. Genome Res. 2008, 18, 1851–1858. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Zhou, X.; Stephens, M. Genome-wide efficient mixed-model analysis for association studies. Nat. Genet. 2012, 44, 821–824. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  45. McLaren, W.; Pritchard, B.; Rios, D.; Chen, Y.; Flicek, P.; Cunningham, F. Deriving the consequences of genomic variants with the Ensembl API and SNP Effect Predictor. Bioinformatics 2010, 26, 2069–2070. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  46. Nadeau, N.J.; Minvielle, F.; Mundy, N.I. Association of a Glu92Lys substitution in MC1R with extended brown in Japanese quail (Coturnix japonica). Anim. Genet. 2006, 37, 287–289. [Google Scholar] [CrossRef]
  47. Ran, J.-S.; You, X.-Y.; Jin, J.; Zhou, Y.-G.; Wang, Y.; Lan, D.; Ren, P.; Liu, Y.-P. The Relationship between MC1R Mutation and Plumage Color Variation in Pigeons. BioMed Res. Int. 2016, 2016, 3059756. [Google Scholar] [CrossRef] [Green Version]
  48. Wang, X.; Li, D.; Song, S.; Zhang, Y.; Li, Y.; Wang, X.; Liu, D.; Zhang, C.; Cao, Y.; Fu, Y.; et al. Combined transcriptomics and proteomics forecast analysis for potential genes regulating the Columbian plumage color in chickens. PLoS ONE 2019, 14, e0210850. [Google Scholar] [CrossRef] [Green Version]
  49. Vachtenheim, J.; Borovanský, J. “Transcription physiology” of pigment formation in melanocytes: Central role of MITF. Exp. Dermatol. 2010, 19, 617–627. [Google Scholar] [CrossRef]
  50. Guo, X.; Li, X.; Li, Y.; Gu, Z.; Zheng, C.; Wei, Z.; Wang, J.; Zhou, R.; Li, L.; Zheng, H. Genetic variation of chicken MC1R gene in different plumage colour populations. Br. Poult. Sci. 2010, 51, 734–739. [Google Scholar] [CrossRef]
  51. Guo, Q.; Jiang, Y.; Wang, Z.; Bi, Y.; Chen, G.; Bai, H.; Chang, G. Genome-Wide Analysis Identifies Candidate Genes Encoding Feather Color in Ducks. Genes 2022, 13, 1249. [Google Scholar] [CrossRef]
  52. Ding, Y.; Berrocal, A.; Morita, T.; Longden, K.D.; Stern, D.L. Natural courtship song variation caused by an intronic retroelement in an ion channel gene. Nature 2016, 536, 329–332. [Google Scholar] [CrossRef] [PubMed]
  53. Feuk, L.; Carson, A.R.; Scherer, S. Structural variation in the human genome. Nat. Rev. Genet. 2006, 7, 85–97. [Google Scholar] [CrossRef] [PubMed]
  54. Vialle, R.A.; Lopes, K.D.P.; Bennett, D.A.; Crary, J.F.; Raj, T. Integrating whole-genome sequencing with multi-omic data reveals the impact of structural variants on gene regulation in the human brain. Nat. Neurosci. 2022, 25, 504–514. [Google Scholar] [CrossRef] [PubMed]
  55. Phillips, P.C. Epistasis—The essential role of gene interactions in the structure and evolution of genetic systems. Nat. Rev. Genet. 2008, 9, 855–867. [Google Scholar] [CrossRef] [Green Version]
  56. Aoki, H.; Moro, O. Involvement of microphthalmia-associated transcription factor (MITF) in expression of human melanocortin-1 receptor (MC1R). Life Sci. 2002, 71, 2171–2179. [Google Scholar] [CrossRef]
  57. Dürig, N.; Letko, A.; Lepori, V.; Hadji Rasouliha, S.; Loechel, R.; Kehl, A.; Hytönen, M.K.; Lohi, H.; Mauri, N.; Dietrich, J. Two MC1R loss-of-function alleles in cream-coloured Australian Cattle Dogs and white Huskies. Anim. Genet. 2018, 49, 284–290. [Google Scholar] [CrossRef] [Green Version]
  58. Lancaster, F.M. Mutations and major variants in domestic ducks. In Poultry Breeding and Genetics; Crawford, R.D., Ed.; Elsevier: Amsterdam, The Netherlands, 1990; pp. 381–388. [Google Scholar]
  59. Lin, R.L.; Chen, H.P.; Rouvier, R.; Poivey, J.P. Selection and Crossbreeding in Relation to Plumage Color Inheritance in Three Chinese Egg Type Duck Breeds (Anas Platyrhynchos). Asian-Australas. J. Anim. Sci. 2014, 27, 1069–1074. [Google Scholar] [CrossRef] [Green Version]
  60. Klungland, H.; Våge, D.I.; Gomez-Raya, L.; Adalsteinsson, S.; Lien, S. The role of melanocyte-stimulating hormone (MSH) receptor in bovine coat color determination. Mamm. Genome 1995, 6, 636–639. [Google Scholar] [CrossRef]
  61. Kijas, J.M.H.; Wales, R.; Törnsten, A.; Chardon, P.; Moller, M.; Andersson, L. Melanocortin Receptor 1 (MC1R) Mutations and Coat Color in Pigs. Genetics 1998, 150, 1177–1185. [Google Scholar] [CrossRef]
  62. Zhu, T.; Qi, X.; Chen, Y.; Wang, L.; Lv, X.; Yang, W.; Zhang, J.; Li, K.; Ning, Z.; Jiang, Z.; et al. Positive selection of skeleton-related genes during duck domestication revealed by whole genome sequencing. BMC Ecol. Evol. 2021, 21, 165. [Google Scholar] [CrossRef]
Genes 14 00856 g001 550
Figure 1. Representative images of color in duck plumage. (a) Duck with white plumage (Peking duck). (b) Duck with spotty plumage (Shanma duck). (c) Duck with black plumage (Wendeng black duck).
Figure 1. Representative images of color in duck plumage. (a) Duck with white plumage (Peking duck). (b) Duck with spotty plumage (Shanma duck). (c) Duck with black plumage (Wendeng black duck).
Genes 14 00856 g001
Genes 14 00856 g002 550
Figure 2. Genome-wide association study results for black plumage. (a) Manhattan plot of GWAS results. The Y-axis shows −log10 (p-values). The red dashed horizontal line indicates the genome-wide significance threshold (4.583099 × 10−9). (b) Q-Q plot. Lambda (λ) is the genomic expansion factor. A total of 16 ducks showed black plumage, and 56 controls were spotty.
Figure 2. Genome-wide association study results for black plumage. (a) Manhattan plot of GWAS results. The Y-axis shows −log10 (p-values). The red dashed horizontal line indicates the genome-wide significance threshold (4.583099 × 10−9). (b) Q-Q plot. Lambda (λ) is the genomic expansion factor. A total of 16 ducks showed black plumage, and 56 controls were spotty.
Genes 14 00856 g002
Genes 14 00856 g003 550
Figure 3. Genome-wide association study results for white plumage. (a) Manhattan plot of GWAS results. The Y-axis shows −log10 (p-values). The two red dashed horizontal line indicates genome- wide significance thresholds (6.042978 × 10−9). (b) Q-Q plot. Lambda (λ) is the genomic expansion factor. A total of 24 ducks showed white plumage while 56 controls were spotty.
Figure 3. Genome-wide association study results for white plumage. (a) Manhattan plot of GWAS results. The Y-axis shows −log10 (p-values). The two red dashed horizontal line indicates genome- wide significance thresholds (6.042978 × 10−9). (b) Q-Q plot. Lambda (λ) is the genomic expansion factor. A total of 24 ducks showed white plumage while 56 controls were spotty.
Genes 14 00856 g003
Table
Table 1. Overview of duck populations used in this study.
Table 1. Overview of duck populations used in this study.
PopulationGeographic OriginClassificationNumber
Spot-billed duck (SB)Ningxia, ChinaSpotty plumage7
Mallard (MD)Zhejiang, ChinaSpotty plumage8
Peking duck (PK)Beijing, ChinaWhite plumage8
Maple Leaf duck (FY)Beijing, ChinaWhite plumage8
Cherry Valley duck (CV)Beijing, ChinaWhite plumage8
Wendeng black duck (WD)Shandong, ChinaBlack plumage8
Putian black duck (PT)Fujian, ChinaBlack plumage8
Gaoyou duck (GY)Jiangsu, ChinaSpotty plumage8
Jinding duck (JD)Fujian, ChinaSpotty plumage8
Mei duck (MEI)Anhui, ChinaSpotty plumage9
Shanma duck (SM)Fujian, ChinaSpotty plumage8
Shaoxing duck (SX)Jiangsu, ChinaSpotty plumage8
Total 96
Table
Table 2. Genetic polymorphisms in MC1R and MITF.
Table 2. Genetic polymorphisms in MC1R and MITF.
MITFMC1R
PhenotypeBreeds6.6-kb Intron Insertionchr13:15411658 A>Gchr13:15412570 T>Cchr13:15412592 C>Gc.52 G>Ac.376 G>A
AAAGGGTTTCCCCCCGGGGGGAAAGGGAAA
Recessive whiteCVinsertion800800800016017
Recessive whiteFYinsertion800800800233134
Recessive whitePKinsertion800800800602521
Wild-typeGY⁄008008006800800
Wild-typeJD⁄008008008800800
Wild-typeMD⁄008008008800800
Wild-typeMEI⁄009009009900900
Wild-typeSM⁄008008008800800
Wild-typeSX⁄008008008800800
Wild-typeSB⁄007007007700700
Extended blackPT⁄017017017035035
Extended blackWD⁄035034035260161
Table
Table 3. Epistatic effects of MITF and MC1R.
Table 3. Epistatic effects of MITF and MC1R.
GroupChr1Gene1SNP1Chr2Gene2SNP2p
13MITF13:1541165812MC1R12:202227930.226
13MITF13:1541165812MC1R12:202231170.164
white vs. non-white 13MITF13:1541257012MC1R12:202227930.271
13MITF13:1541257012MC1R12:202231170.212
13MITF13:1541259212MC1R12:202227930.298
13MITF13:1541259212MC1R12:202231170.234
13MITF13:1541165812MC1R12:202227930.451
13MITF13:1541165812MC1R12:202231170.509
white vs. black 13MITF13:1541257012MC1R12:202227930.438
13MITF13:1541257012MC1R12:202231170.490
13MITF13:1541259212MC1R12:202227930.451
13MITF13:1541259212MC1R12:202231170.509
13MITF13:1541165812MC1R12:202227930.025
13MITF13:1541165812MC1R12:202231170.036
white vs. spotty 13MITF13:1541257012MC1R12:202227930.038
13MITF13:1541257012MC1R12:202231170.054
13MITF13:1541259212MC1R12:202227930.041
13MITF13:1541259212MC1R12:202231170.057
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, X.; Zhu, T.; Wang, L.; Lv, X.; Yang, W.; Qu, C.; Li, H.; Wang, H.; Ning, Z.; Qu, L. Genome-Wide Association Study Reveals the Genetic Basis of Duck Plumage Colors. Genes 2023, 14, 856. https://doi.org/10.3390/genes14040856

AMA Style

Zhang X, Zhu T, Wang L, Lv X, Yang W, Qu C, Li H, Wang H, Ning Z, Qu L. Genome-Wide Association Study Reveals the Genetic Basis of Duck Plumage Colors. Genes. 2023; 14(4):856. https://doi.org/10.3390/genes14040856

Chicago/Turabian Style

Zhang, Xinye, Tao Zhu, Liang Wang, Xueze Lv, Weifang Yang, Changqing Qu, Haiying Li, Huie Wang, Zhonghua Ning, and Lujiang Qu. 2023. "Genome-Wide Association Study Reveals the Genetic Basis of Duck Plumage Colors" Genes 14, no. 4: 856. https://doi.org/10.3390/genes14040856

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop