Missense Variants of von Willebrand Factor in the Background of COVID-19 Associated Coagulopathy
Abstract
1. Introduction
2. Materials and Methods
2.1. Participants
2.2. DNA Sampling and Purification
2.3. In Silico Tools for SNP Selection and Genotype Analysis
2.4. SNP Genotyping
2.4.1. Genotype Analysis with qPCR TaqMan Probes
2.4.2. PCR–RFLP
2.5. Prediction of 3D Protein Structure
2.6. Statistical Analysis
3. Results
3.1. Clinical Characterization of Patient Cohorts
3.2. SNP Genotyping
3.3. Linkage Disequilibrium and Haplotype Analysis
3.4. Association Analyses
3.5. Predicted Structural Changes in Missense Variants
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Long, B.; Carius, B.M.; Chavez, S.; Liang, S.Y.; Brady, W.J.; Koyfman, A.; Gottlieb, M. Clinical update on COVID-19 for the emergency clinician: Presentation and evaluation. Am. J. Emerg. Med. 2022, 54, 46–57. [Google Scholar] [CrossRef]
- Camporota, L.; Cronin, J.N.; Busana, M.; Gattinoni, L.; Formenti, F. Pathophysiology of coronavirus-19 disease acute lung injury. Curr. Opin. Crit. Care 2022, 28, 9–16. [Google Scholar] [CrossRef]
- Klok, F.A.; Kruip, M.; van der Meer, N.J.M.; Arbous, M.S.; Gommers, D.; Kant, K.M.; Kaptein, F.H.J.; van Paassen, J.; Stals, M.A.M.; Huisman, M.V.; et al. Incidence of thrombotic complications in critically ill ICU patients with COVID-19. Thromb. Res. 2020, 191, 145–147. [Google Scholar] [CrossRef]
- Tang, N.; Li, D.; Wang, X.; Sun, Z. Abnormal coagulation parameters are associated with poor prognosis in patients with novel coronavirus pneumonia. J. Thromb. Haemost. JTH 2020, 18, 844–847. [Google Scholar] [CrossRef]
- Poor, H.D. Pulmonary Thrombosis and Thromboembolism in COVID-19. Chest 2021, 160, 1471–1480. [Google Scholar] [CrossRef]
- Plášek, J.; Gumulec, J.; Máca, J.; Škarda, J.; Procházka, V.; Grézl, T.; Václavík, J. COVID-19 associated coagulopathy: Mechanisms and host-directed treatment. Am. J. Med. Sci. 2022, 363, 465–475. [Google Scholar] [CrossRef]
- Christensen, B.; Favaloro, E.J.; Lippi, G.; Van Cott, E.M. Hematology Laboratory Abnormalities in Patients with Coronavirus Disease 2019 (COVID-19). Semin. Thromb. Hemost. 2020, 46, 845–849. [Google Scholar] [CrossRef]
- Terpos, E.; Ntanasis-Stathopoulos, I.; Elalamy, I.; Kastritis, E.; Sergentanis, T.N.; Politou, M.; Psaltopoulou, T.; Gerotziafas, G.; Dimopoulos, M.A. Hematological findings and complications of COVID-19. Am. J. Hematol. 2020, 95, 834–847. [Google Scholar] [CrossRef]
- Bonaventura, A.; Vecchié, A.; Dagna, L.; Martinod, K.; Dixon, D.L.; Van Tassell, B.W.; Dentali, F.; Montecucco, F.; Massberg, S.; Levi, M.; et al. Endothelial dysfunction and immunothrombosis as key pathogenic mechanisms in COVID-19. Nat. Rev. Immunol. 2021, 21, 319–329. [Google Scholar] [CrossRef]
- Sinkovits, G.; Réti, M.; Müller, V.; Iványi, Z.; Gál, J.; Gopcsa, L.; Reményi, P.; Szathmáry, B.; Lakatos, B.; Szlávik, J.; et al. Associations between the von Willebrand Factor—ADAMTS13 Axis, Complement Activation, and COVID-19 Severity and Mortality. Thromb. Haemost. 2022, 122, 240–256. [Google Scholar] [CrossRef]
- Ward, S.E.; Fogarty, H.; Karampini, E.; Lavin, M.; Schneppenheim, S.; Dittmer, R.; Morrin, H.; Glavey, S.; Ni Cheallaigh, C.; Bergin, C.; et al. ADAMTS13 regulation of VWF multimer distribution in severe COVID-19. J. Thromb. Haemost. 2021, 19, 1914–1921. [Google Scholar] [CrossRef]
- Ishikawa, M.; Uemura, M.; Matsuyama, T.; Matsumoto, M.; Ishizashi, H.; Kato, S.; Morioka, C.; Fujimoto, M.; Kojima, H.; Yoshiji, H.; et al. Potential role of enhanced cytokinemia and plasma inhibitor on the decreased activity of plasma ADAMTS13 in patients with alcoholic hepatitis: Relationship to endotoxemia. Alcohol. Clin. Exp. Res. 2010, 34 (Suppl. S1), S25–S33. [Google Scholar] [CrossRef]
- Pereira, M.C.B.; Ruschel, B.; Schneider, B.; de Melgar, V.; Rech, T.H. COVID-19-Induced Fatal Thrombotic Thrombocytopenic Purpura in a Healthy Young Patient. Case Rep. Crit. Care 2022, 2022, 2934171. [Google Scholar] [CrossRef] [PubMed]
- Szóstek-Mioduchowska, A.; Kordowitzki, P. Shedding Light on the Possible Link between ADAMTS13 and Vaccine—Induced Thrombotic Thrombocytopenia. Cells 2021, 10, 2785. [Google Scholar] [CrossRef]
- Boussier, J.; Yatim, N.; Marchal, A.; Hadjadj, J.; Charbit, B.; El Sissy, C.; Carlier, N.; Pène, F.; Mouthon, L.; Tharaux, P.L.; et al. Severe COVID-19 is associated with hyperactivation of the alternative complement pathway. J. Allergy Clin. Immunol. 2022, 149, 550–556. [Google Scholar] [CrossRef]
- Zuo, Y.; Yalavarthi, S.; Shi, H.; Gockman, K.; Zuo, M.; Madison, J.A.; Blair, C.; Weber, A.; Barnes, B.J.; Egeblad, M.; et al. Neutrophil extracellular traps in COVID-19. JCI Insight 2020, 5, e138999. [Google Scholar] [CrossRef] [PubMed]
- Skendros, P.; Mitsios, A.; Chrysanthopoulou, A.; Mastellos, D.C.; Metallidis, S.; Rafailidis, P.; Ntinopoulou, M.; Sertaridou, E.; Tsironidou, V.; Tsigalou, C.; et al. Complement and tissue factor-enriched neutrophil extracellular traps are key drivers in COVID-19 immunothrombosis. J. Clin. Investig. 2020, 130, 6151–6157. [Google Scholar] [CrossRef]
- Fogarty, H.; Townsend, L.; Morrin, H.; Ahmad, A.; Comerford, C.; Karampini, E.; Englert, H.; Byrne, M.; Bergin, C.; O’Sullivan, J.M.; et al. Persistent endotheliopathy in the pathogenesis of long COVID syndrome. J. Thromb. Haemost. 2021, 19, 2546–2553. [Google Scholar] [CrossRef]
- Bomba, L.; Walter, K.; Soranzo, N. The impact of rare and low-frequency genetic variants in common disease. Genome Biol. 2017, 18, 77. [Google Scholar] [CrossRef] [PubMed]
- Agarwala, V.; Flannick, J.; Sunyaev, S.; GoT2D Consortium; Altshuler, D. Evaluating empirical bounds on complex disease genetic architecture. Nat. Genet. 2013, 45, 1418–1427. [Google Scholar] [CrossRef]
- Liu, S.; Liu, Y.; Zhang, Q.; Wu, J.; Liang, J.; Yu, S.; Wei, G.H.; White, K.P.; Wang, X. Systematic identification of regulatory variants associated with cancer risk. Genome Biol. 2017, 18, 194. [Google Scholar] [CrossRef]
- Vischer, U.M. von Willebrand factor, endothelial dysfunction, and cardiovascular disease. J. Thromb. Haemost. JTH 2006, 4, 1186–1193. [Google Scholar] [CrossRef]
- Smith, N.L.; Rice, K.M.; Bovill, E.G.; Cushman, M.; Bis, J.C.; McKnight, B.; Lumley, T.; Glazer, N.L.; Vlieg, A.V.H.; Tang, W.; et al. Genetic variation associated with plasma von Willebrand factor levels and the risk of incident venous thrombosis. Blood 2011, 117, 6007–6011. [Google Scholar] [CrossRef] [PubMed]
- Aggarwal, S.; Gheware, A.; Agrawal, A.; Ghosh, S.; Prasher, B.; Mukerji, M. Combined genetic effects of EGLN1 and VWF modulate thrombotic outcome in hypoxia revealed by Ayurgenomics approach. J. Transl. Med. 2015, 13, 184. [Google Scholar] [CrossRef] [PubMed]
- Ozel, A.B.; McGee, B.; Siemieniak, D.; Jacobi, P.M.; Haberichter, S.L.; Brody, L.C.; Mills, J.L.; Molloy, A.M.; Ginsburg, D.; Li, J.Z.; et al. Genome-wide studies of von Willebrand factor propeptide identify loci contributing to variation in propeptide levels and von Willebrand factor clearance. J. Thromb. Haemost. JTH 2016, 14, 1888–1898. [Google Scholar] [CrossRef]
- van Loon, J.E.; Kavousi, M.; Leebeek, F.W.; Felix, J.F.; Hofman, A.; Witteman, J.C.; de Maat, M.P. von Willebrand factor plasma levels, genetic variations and coronary heart disease in an older population. J. Thromb. Haemost. JTH 2012, 10, 1262–1269. [Google Scholar] [CrossRef]
- Vaidya, D.; Yanek, L.R.; Herrera-Galeano, J.E.; Mathias, R.A.; Moy, T.F.; Faraday, N.; Becker, L.C.; Becker, D.M. A common variant in the Von Willebrand factor gene is associated with multiple functional consequences. Am. J. Hematol. 2010, 85, 971–973. [Google Scholar] [CrossRef]
- Sun, Y.; Xu, X.; Sun, L.; Zhang, E.; Zhai, Z.; Fang, B.; Xiao, F. [Correlation of three common variation loci in von Willebrand factor gene and pulmonary thromboembolism disease]. Zhonghua Yi Xue Za Zhi 2015, 95, 2428–2432. [Google Scholar] [PubMed]
- Ezigbo, E.D.; Ukaejiofo, E.O.; Nwagha, T.U. Molecular characterization of exon 28 of von Willebrand’s factor gene in Nigerian population. Niger. J. Clin. Pract. 2017, 20, 235–238. [Google Scholar] [CrossRef] [PubMed]
- Flood, V.H.; Gill, J.C.; Morateck, P.A.; Christopherson, P.A.; Friedman, K.D.; Haberichter, S.L.; Branchford, B.R.; Hoffmann, R.G.; Abshire, T.C.; Di Paola, J.A.; et al. Common VWF exon 28 polymorphisms in African Americans affecting the VWF activity assay by ristocetin cofactor. Blood 2010, 116, 280–286. [Google Scholar] [CrossRef]
- Lindström, S.; Wang, L.; Smith, E.N.; Gordon, W.; Vlieg, A.V.H.; de Andrade, M.; Brody, J.A.; Pattee, J.W.; Haessler, J.; Brumpton, B.M.; et al. Genomic and transcriptomic association studies identify 16 novel susceptibility loci for venous thromboembolism. Blood 2019, 134, 1645–1657. [Google Scholar] [CrossRef] [PubMed]
- Plaimauer, B.; Fuhrmann, J.; Mohr, G.; Wernhart, W.; Bruno, K.; Ferrari, S.; Konetschny, C.; Antoine, G.; Rieger, M.; Scheiflinger, F. Modulation of ADAMTS13 secretion and specific activity by a combination of common amino acid polymorphisms and a missense mutation. Blood 2006, 107, 118–125. [Google Scholar] [CrossRef] [PubMed]
- Ma, Q.; Jacobi, P.M.; Emmer, B.T.; Kretz, C.A.; Ozel, A.B.; McGee, B.; Kimchi-Sarfaty, C.; Ginsburg, D.; Li, J.Z.; Desch, K.C. Genetic variants in ADAMTS13 as well as smoking are major determinants of plasma ADAMTS13 levels. Blood Adv. 2017, 1, 1037–1046. [Google Scholar] [CrossRef] [PubMed]
- Lasom, S.; Komanasin, N.; Settasatian, N.; Settasatian, C.; Kukongviriyapan, U.; Intharapetch, P. Association of a disintegrin and metalloproteinase with a thrombospondin type 1 motif member 13 polymorphisms with severity of coronary stenosis in type 2 diabetes mellitus. J. Res. Med. Sci. 2018, 23, 59. [Google Scholar] [CrossRef] [PubMed]
- Gong, X.; Yuan, B.; Yuan, Y. Incidence and prognostic value of pulmonary embolism in COVID-19: A systematic review and meta-analysis. PLoS ONE 2022, 17, e0263580. [Google Scholar] [CrossRef]
- Barrett, J.C.; Fry, B.; Maller, J.; Daly, M.J. Haploview: Analysis and visualization of LD and haplotype maps. Bioinformatics 2005, 21, 263–265. [Google Scholar] [CrossRef]
- Marshall, J.C.; Murthy, S.; Diaz, J.; Adhikari, N.K.; Angus, D.C.; Arabi, Y.M.; Baillie, K.; Bauer, M.; Berry, S.; Blackwood, B.; et al. A minimal common outcome measure set for COVID-19 clinical research. Lancet Infect. Dis. 2020, 20, e192–e197. [Google Scholar] [CrossRef]
- White, D.; MacDonald, S.; Edwards, T.; Bridgeman, C.; Hayman, M.; Sharp, M.; Cox-Morton, S.; Duff, E.; Mahajan, S.; Moore, C.; et al. Evaluation of COVID-19 coagulopathy; laboratory characterization using thrombin generation and nonconventional haemostasis assays. Int. J. Lab. Hematol. 2021, 43, 123–130. [Google Scholar] [CrossRef]
- Varikasuvu, S.R.; Varshney, S.; Dutt, N.; Munikumar, M.; Asfahan, S.; Kulkarni, P.P.; Gupta, P. D-dimer, disease severity, and deaths (3D-study) in patients with COVID-19: A systematic review and meta-analysis of 100 studies. Sci. Rep. 2021, 11, 21888. [Google Scholar] [CrossRef]
- Raballah, E.; Anyona, S.B.; Cheng, Q.; Munde, E.O.; Hurwitz, I.F.; Onyango, C.; Ndege, C.; Hengartner, N.W.; Pacheco, M.A.; Escalante, A.A.; et al. Complement component 3 mutations alter the longitudinal risk of pediatric malaria and severe malarial anemia. Exp. Biol. Med. 2022, 247, 672–682. [Google Scholar] [CrossRef]
- Yuan, Z.H.; Zhao, J.; Zhang, Y.; Zhu, P. [Impact of vWF gene A1381T polymorphism and ABO blood group on von Willebrand factor level in plasma]. Zhongguo Shi Yan Xue Ye Xue Za Zhi 2010, 18, 967–971. [Google Scholar]
- Arning, A.; Jeibmann, A.; Köhnemann, S.; Brokinkel, B.; Ewelt, C.; Berger, K.; Wellmann, J.; Nowak-Göttl, U.; Stummer, W.; Stoll, M.; et al. ADAMTS genes and the risk of cerebral aneurysm. J. Neurosurg. 2016, 125, 269–274. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Wang, Y.; Zhang, Y. ResQ: An Approach to Unified Estimation of B-Factor and Residue-Specific Error in Protein Structure Prediction. J. Mol. Biol. 2016, 428, 693–701. [Google Scholar] [CrossRef]
- Mandyam, S.; Fatmi, S.S.; Banzon, G.; Kaur, P.; Katamreddy, Y.; Parghi, D.; Farooq, A.; Liaqat, H.; Basarakodu, K. A Rare Case of Severe Manifestation of COVID-19 Infection Presenting as Immune-Related Thrombotic Thrombocytopenic Purpura With Multiorgan Involvement Treated With Plasmapheresis, Steroids, Rituximab, and Caplacizumab. Cureus 2022, 14, e26961. [Google Scholar] [CrossRef] [PubMed]
- Lim, E.H.T.; Vlaar, A.P.J.; Bos, L.D.J.; van Vught, L.A.; Boer, A.M.T.; Dujardin, R.W.G.; Habel, M.; Xu, Z.; Brouwer, M.C.; van de Beek, D.; et al. Anti-C5a antibody vilobelimab treatment and the effect on biomarkers of inflammation and coagulation in patients with severe COVID-19: A substudy of the phase 2 PANAMO trial. Respir. Res. 2022, 23, 375. [Google Scholar] [CrossRef] [PubMed]
- Turecek, P.L.; Peck, R.C.; Rangarajan, S.; Reilly-Stitt, C.; Laffan, M.A.; Kazmi, R.; James, I.; Dushianthan, A.; Schrenk, G.; Gritsch, H.; et al. Recombinant ADAMTS13 reduces abnormally up-regulated von Willebrand factor in plasma from patients with severe COVID-19. Thromb. Res. 2021, 201, 100–112. [Google Scholar] [CrossRef]
- Declercq, J.; Van Damme, K.F.A.; De Leeuw, E.; Maes, B.; Bosteels, C.; Tavernier, S.J.; De Buyser, S.; Colman, R.; Hites, M.; Verschelden, G.; et al. Effect of anti-interleukin drugs in patients with COVID-19 and signs of cytokine release syndrome (COV-AID): A factorial, randomised, controlled trial. Lancet. Respir. Med. 2021, 9, 1427–1438. [Google Scholar] [CrossRef]
- Anastassopoulou, C.; Gkizarioti, Z.; Patrinos, G.P.; Tsakris, A. Human genetic factors associated with susceptibility to SARS-CoV-2 infection and COVID-19 disease severity. Hum. Genom. 2020, 14, 40. [Google Scholar] [CrossRef]
- Fricke-Galindo, I.; Falfán-Valencia, R. Genetics Insight for COVID-19 Susceptibility and Severity: A Review. Front. Immunol. 2021, 12, 622176. [Google Scholar] [CrossRef]
- Cruz, R.; Almeida, S.D.-D.; de Heredia, M.L.; Quintela, I.; Ceballos, F.C.; Pita, G.; Lorenzo-Salazar, J.M.; González-Montelongo, R.; Gago-Domínguez, M.; Porras, M.S.; et al. Novel genes and sex differences in COVID-19 severity. Hum. Mol. Genet. 2022, 31, 3789–3806. [Google Scholar] [CrossRef]
- Abu-Farha, M.; Al-Sabah, S.; Hammad, M.M.; Hebbar, P.; Channanath, A.M.; John, S.E.; Taher, I.; Almaeen, A.; Ghazy, A.; Mohammad, A.; et al. Prognostic Genetic Markers for Thrombosis in COVID-19 Patients: A Focused Analysis on D-Dimer, Homocysteine and Thromboembolism. Front. Pharmacol. 2020, 11, 587451. [Google Scholar] [CrossRef]
- Papadopoulou, A.; Musa, H.; Sivaganesan, M.; McCoy, D.; Deloukas, P.; Marouli, E. COVID-19 susceptibility variants associate with blood clots, thrombophlebitis and circulatory diseases. PLoS ONE 2021, 16, e0256988. [Google Scholar] [CrossRef] [PubMed]
- Lapić, I.; Antolic, M.R.; Horvat, I.; Premužić, V.; Palić, J.; Rogić, D.; Zadro, R. Association of polymorphisms in genes encoding prothrombotic and cardiovascular risk factors with disease severity in COVID-19 patients: A pilot study. J. Med. Virol. 2022, 94, 3669–3675. [Google Scholar] [CrossRef] [PubMed]
- Kraisin, S.; Naka, I.; Patarapotikul, J.; Nantakomol, D.; Nuchnoi, P.; Hananantachai, H.; Tsuchiya, N.; Ohashi, J. Association of ADAMTS13 polymorphism with cerebral malaria. Malar. J. 2011, 10, 366. [Google Scholar] [CrossRef]
- Tanka-Salamon, A.; Kolev, K.; Machovich, R.; Komorowicz, E. Proteolytic resistance conferred to fibrinogen by von Willebrand factor. Thromb. Haemost. 2010, 103, 291–298. [Google Scholar] [CrossRef] [PubMed]
- Togashi, K.; Suzuki, S.; Morita, S.; Ogasawara, Y.; Imamura, Y.; Shin, Y. Excessively activated plasminogen in human plasma cleaves VWF multimers and reduces collagen-binding activity. J. Biochem. 2020, 168, 355–363. [Google Scholar] [CrossRef] [PubMed]
- Wick, T.M.; Moake, J.L.; Udden, M.M.; McIntire, L.V. Unusually large von Willebrand factor multimers preferentially promote young sickle and nonsickle erythrocyte adhesion to endothelial cells. Am. J. Hematol. 1993, 42, 284–292. [Google Scholar] [CrossRef]
Polymorphism | rs2301612 | rs28729234 | rs216321 |
---|---|---|---|
primers | 5′ CCCGGGGTTTTCCCATCAA 3′ 5′ TCAGAGATGGGATGTCAGTGC 3′ | 5′ CTCACAAAAGGCCACGCTTC 3′ 5′ AGCAGGTTCTCACCATGCAC 3′ | 5′ CCTACCGCTTCAGGCACTTC 3′ 5′ CACACTCCACGCTACAGGTC 3′ |
length of PCR product (bp) | 520 | 370 | 457 |
restriction endonuclease | Hpy88 I (TCN^GA) | Hpa II (C^CGG) | Nla IV (GGN^NCC) |
length of digestion products (bp) | C: 378, 140, 2 G: 231, 147, 140, 2 | C: 65, 12, 11, 11, 60, 20, 108, 83 T: 65, 12, 11, 11, 60, 20, 191 | C: 46, 291, 56, 47, 17 T: 337, 56, 47, 17 |
WHO Clinical Progression Score | 4 (n = 10) | 5 (n = 35) | 6 or 7 (n = 10) | 8 or 9 (n = 17) |
---|---|---|---|---|
ratio of males (%) | 70 | 69 | 70 | 88 |
mean age (years) | 50.6 (12.5) | 49.1 (11.3) | 52.8 (10.1) | 49.8 (8.5) |
body mass index (BMI) (kg/m2) | 26.5 (2.7) | 30.1 (10.1) | 28.6 (2.7) | 33.1 (7.1) |
body mass index (BMI) > 30 (%) | 25 | 37 | 40 | 57 |
red blood cell count (T/L) | 4.6 (0.5) | 4.7 (0.5) | 4.9 (0.6) | 4.7 (0.6) |
hemoglobin (g/L) | 139.6 (17.2) | 140.1 (14.7) | 142.9 (16.6) | 142.8 (18) |
creatinine (µM) | 77.1 (30.7) | 89.6 (35.4) | 92.3 (28.7) | 91.4 (35) |
treatment in hospital (days) | 9.2 (6.1) | 10.6 (4.2) | 19.5 (10.5) | 24.5 (23.3) |
treatment in intensive care unit (days) | 0.2 (0.6) | 0.3 (0.8) | 4.1 (5.5) | 12.9 (8.6) |
lobar involvement | 1.6 (1.9) | 3.2 (1.9) | 4.8 (0.5) | 4.4 (1.1) |
respiratory rate (1/min) | 16.2 (2.3) | 19.9 (5.6) | 28.5 (5.2) | 34.5 (6.0) |
Horowitz coefficient (PaO2/FiO2 Hgmm) | – | 150.5 (100.6) | 100.3 (74.2) | 61.2 (14.5) |
interleukin-6 (IL-6) (pg/mL) | 11.1 (12.3) | 85.3 (158.9) | 83 (149.8) | 64.4 (60.2) |
C reactive protein (CRP) (mg/L) | 75.3 (69.9) | 149 (99) | 168 (107.2) | 153.5 (105) |
fibrinogen (g/L) | 5.4 (0.2) | 7.5 (1.2) | 7.7 (1.6) | 6.9 (2.5) |
D-dimer (mg/L) | 3.4 (7.2) | 1.8 (3.5) | 5.2 (9.2) | 9.6 (18.3) |
international normalized ratio (INR) | 1.3 (0.2) | 1.2 (0.1) | 1.3 (0.3) | 1.3 (0.2) |
hypertension (%) | 33 | 44 | 33 | 38 |
alteplase treatment (%) | 0 | 0 | 33 | 62 |
noradrenalin treatment (%) | 0 | 3 | 0 | 85 |
Gene | SNP | Allele | Genomic Location | Type of Polymorphism | Amino Acid Exchange | Protein Domain Affected |
---|---|---|---|---|---|---|
vWF | rs1800383 | C/G | 12:6,128,170 | missense | His1472Asp | A1 |
vWF | rs216311 | C/T | 12:6,128,443 | missense | Ala1381Thr | A1 |
vWF | rs216321 | C/T | 12:6,143,984 | missense | Ala852Gln | D’ |
vWF | rs1063856 | T/C | 12:6,153,534 | missense | Thr789Ala | D’ |
vWF | rs1800378 | C/T | 12:6,172,202 | missense | Arg484His | D2 |
ADAMTS13 | rs34024143 | C/T | 9:136,287,582 | missense | Arg7Trp | S |
ADAMTS13 | rs28729234 | C/T | 9:136,295,232 | intronic | – | – |
ADAMTS13 | rs2301612 | C/G | 9:136,301,982 | missense | Gln448Glu | Cys-rich |
Major Allele Homozygote | Heterozygote | Minor Allele Homozygote | HWE (p) | MAF | Genotyping Method | |
---|---|---|---|---|---|---|
rs1800383 | 0.89 (CC) | 0.11 (CG) | 0.00 (GG) | 0.87 | 5% G | TaqMan |
rs216311 | 0.37 (CC) | 0.48 (CT) | 0.15 (TT) | 0.99 | 39% T | TaqMan |
rs216321 | 0.53 (CC) | 0.46 (CT) | 0.01 (TT) | 0.11 | 24% T | PCR-RFLP |
rs1063856 | 0.50 (TT) | 0.35 (CT) | 0.15 (CC) | 0.23 | 32% C | TaqMan |
rs1800378 | 0.40 (CC) | 0.48 (CT) | 0.12 (TT) | 0.94 | 36% T | TaqMan |
rs34024143 | 0.91 (CC) | 0.08 (CT) | 0.01 (TT) | 0.20 | 5% T | TaqMan |
rs28729234 | 0.93 (CC) | 0.07 (CT) | 0.00 (TT) | 0.96 | 4% T | PCR-RFLP |
rs2301612 | 0.34 (CC) | 0.45 (CG) | 0.21 (GG) | 0.78 | 44% G | both |
SNP | MAF Genotype | Genotype Frequencies in Cohorts | p Value | |||
---|---|---|---|---|---|---|
4 | 5 | 6–7 | 8–9 | |||
rs1800383 | GG | 0.00 | 0.00 | 0.00 | 0.00 | 0.62 |
rs216311 | TT | 0.06 | 0.24 | 0.22 | 0.00 | 0.15 |
rs216321 | TT | 0.00 | 0.03 | 0.00 | 0.00 | 0.67 |
rs1063856 | CC | 0.13 | 0.18 | 0.11 | 0.13 | 0.96 |
rs1800378 | TT | 0.13 | 0.09 | 0.22 | 0.13 | 0.89 |
rs34024143 | TT | 0.06 | 0.00 | 0.00 | 0.00 | 0.54 |
rs28729234 | TT | 0.06 | 0.00 | 0.00 | 0.00 | 0.59 |
rs2301612 | GG | 0.06 | 0.26 | 0.11 | 0.25 | 0.61 |
Panel A | ||||||||||
Clinical Parameter | ADAMTS13 SNPs | vWF SNPs | ||||||||
rs2301612 | rs28729234 | rs34024143 | rs1800383 | rs216311 | rs216321 | rs1063856 | rs1800378 | |||
RBC | 0.728 | 0.754 | 0.853 | 0.545 | 0.667 | 0.610 | 0.049 | 0.086 | ||
hemoglobin | 0.646 | 0.692 | 0.652 | 0.625 | 0.543 | 0.358 | 0.029 | 0.060 | ||
INR | 0.505 | 1.000 | 1.000 | 0.779 | 0.039 | 0.976 | 0.686 | 0.570 | ||
fibrinogen | 0.461 | 1.000 | 1.000 | 0.032 | 0.441 | 0.917 | 0.836 | 0.332 | ||
creatinine | 0.753 | 0.933 | 0.927 | 0.549 | 0.976 | 0.958 | 0.008 | 0.544 | ||
Panel B | ||||||||||
SNP | clinical parameter | major homozygote | heterozygote | minor homozygote | ||||||
rs1063856 | RBC (T/L) | TT | 4.59 | (2.33) | CT | 4.89 | (2.17) | CC | 5.00 | (1.86) |
rs1063856 | hemoglobin (g/L) | TT | 134.94 | (68.36) | CT | 145.00 | (64.45) | CC | 147.18 | (54.82) |
rs216311 | INR | CC | 1.20 | (0.41) | CT | 1.23 | (0.50) | TT | 1.45 | (0.38) |
rs1800383 | fibrinogen (g/L) | CC | 6.64 | (3.23) | CG | 17.62 | (4.71) | GG | – | – |
rs1063856 | creatinine (µM) | TT | 84.78 | (46.52) | CT | 71.45 | (35.38) | CC | 111.00 | (44.73) |
vWF | ADAMTS13 | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
Haplotype | SS | SA | COV | BFP | RSQ | Haplotype | SS | SA | COV | BFP | RSQ |
Arg484His | Arg7Trp | ||||||||||
nt: CTCCC aa: RTRAH | S | B | 0.62 | −0.47 | 3.80 | nt: CC aa: RQ | C | E | 0.10 | 0.16 | 28.16 |
nt: TTCCC aa: HTRAH | S | B | 0.62 | −0.49 | 3.88 | nt: TC aa: WQ | C | E | 0.09 | 0.11 | 33.08 |
Thr789Ala | Gln448Glu | ||||||||||
nt: CTCCC aa: RTRAH | C | B | 0.39 | −0.26 | 4.17 | nt: CC aa: RQ | H | B | 0.57 | −0.43 | 3.74 |
nt: CCCCC aa: RARAH | C | B | 0.41 | −0.21 | 4.14 | nt: CG aa: RE | C | B | 0.63 | −0.28 | 4.72 |
Arg852Gln | |||||||||||
nt: CTCCC aa: RTRAH | C | E | 0.56 | −0.02 | 4.18 | ||||||
nt: CTTCC aa: RTQAH | C | B | 0.55 | −0.13 | 3.92 | ||||||
Ala1381Thr | |||||||||||
nt: CTCCC aa: RTRAH | S | B | 0.28 | −0.94 | 4.34 | ||||||
nt: CTCTC aa: RTRTH | S | B | 0.26 | −0.88 | 4.25 | ||||||
His1472Asp | |||||||||||
nt: CTCCC aa: RTRAH | C | E | 0.23 | 0.04 | 4.83 | ||||||
nt: CTCCG aa: RTRAD | C | E | 0.19 | −0.11 | 6.94 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Elek, Z.; Losoncz, E.; Maricza, K.; Fülep, Z.; Bánlaki, Z.; Kovács-Nagy, R.; Keszler, G.; Rónai, Z. Missense Variants of von Willebrand Factor in the Background of COVID-19 Associated Coagulopathy. Genes 2023, 14, 617. https://doi.org/10.3390/genes14030617
Elek Z, Losoncz E, Maricza K, Fülep Z, Bánlaki Z, Kovács-Nagy R, Keszler G, Rónai Z. Missense Variants of von Willebrand Factor in the Background of COVID-19 Associated Coagulopathy. Genes. 2023; 14(3):617. https://doi.org/10.3390/genes14030617
Chicago/Turabian StyleElek, Zsuzsanna, Eszter Losoncz, Katalin Maricza, Zoltán Fülep, Zsófia Bánlaki, Réka Kovács-Nagy, Gergely Keszler, and Zsolt Rónai. 2023. "Missense Variants of von Willebrand Factor in the Background of COVID-19 Associated Coagulopathy" Genes 14, no. 3: 617. https://doi.org/10.3390/genes14030617
APA StyleElek, Z., Losoncz, E., Maricza, K., Fülep, Z., Bánlaki, Z., Kovács-Nagy, R., Keszler, G., & Rónai, Z. (2023). Missense Variants of von Willebrand Factor in the Background of COVID-19 Associated Coagulopathy. Genes, 14(3), 617. https://doi.org/10.3390/genes14030617