Next Article in Journal
Whole Exome Sequencing Reveals Novel Candidate Genes in Familial Forms of Glaucomatous Neurodegeneration
Next Article in Special Issue
Effect of 11-Deoxycorticosterone in the Transcriptomic Response to Stress in Rainbow Trout Skeletal Muscle
Previous Article in Journal
Differential Repeat Accumulation in the Bimodal Karyotype of Agave L.
Previous Article in Special Issue
A Transcriptomic Analysis of Phenotypic Plasticity in Crassostrea virginica Larvae under Experimental Acidification
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Brief Report

The Coding Mitogenome of the Freshwater Crayfish Pontastacus leptodactylus (Decapoda:Astacidea:Astacidae) from Lake Vegoritida, Greece and Its Taxonomic Classification

by
Maria V. Alvanou
1,
Apostolos P. Apostolidis
2,
Athanasios Lattos
3,
Basile Michaelidis
3 and
Ioannis A. Giantsis
1,*
1
Department of Animal Science, Faculty of Agricultural Sciences, University of Western Macedonia, 53100 Florina, Greece
2
Laboratory of Ichthyology & Fisheries, Department of Animal Production, Faculty of Agriculture, Forestry and Natural Environment, Aristotle University of Thessaloniki, 54124 Thessaloniki, Greece
3
Laboratory of Animal Physiology, Department of Zoology, Faculty of Science, School of Biology, Aristotle University of Thessaloniki, 54124 Thessaloniki, Greece
*
Author to whom correspondence should be addressed.
Genes 2023, 14(2), 494; https://doi.org/10.3390/genes14020494
Submission received: 2 January 2023 / Revised: 5 February 2023 / Accepted: 13 February 2023 / Published: 15 February 2023
(This article belongs to the Special Issue Aquaculture Genetics: Latest Advances and Prospects)

Abstract

Pontastacus leptodactylus (Eschscholtz, 1823) (Decapoda:Astacidea:Astacidae) constitutes an ecologically and economically highly important species. In the present study, the mitochondrial genome of the freshwater crayfish P. leptodactylus from Greece is analyzed for the first time, using 15 newly designed primer pairs based on available sequences of closely related species. The analyzed coding part of the mitochondrial genome of P. leptodactylus consists of 15,050 base pairs including 13 protein-coding genes (PCGs), 2 ribosomal RNA gene (rRNAs), and 22 transfer RNA genes (tRNAs). These newly designed primers may be particularly useful in future studies for analyzing different mitochondrial DNA segments. Based on the entire mitochondrial genome sequence, compared to other haplotypes from related species belonging in the same family (Astacidae) available in the GenBank database, a phylogenetic tree was constructed depicting the phylogenetic relationships of P. leptodactylus. Based on the results, the genetic distance between Astacus astacus and P. leptodactylus is smaller than the genetic distance between Austropotamobius pallipes and Austropotamobius torrentium, despite the fact that the latter two are classified within the same genus, questioning the phylogenetic position of A. astacus as a different genus than P. leptodactylus. In addition, the sample from Greece seems genetically distant compared with a conspecific haplotype available in the GenBank database, possibly implying a genetic distinction of P. leptodactylus from Greece.

1. Introduction

The narrow-clawed crayfish Pontastacus leptodactylus (Eschscholtz, 1823) (Decapoda:Astacidea:Astacidae), apart from representing a keystone species operating as a benthic scavenger, is, in parallel, a food product of high economic value. Although it is characterized as least concern in IUCN [1], there are several studies addressing its population decline within specific basins [2,3,4]. Furthermore, in Lake Vegoritida, as well as in Lake Polifitou in northern Greece, such phenomena have been observed leading to the periodical prohibition of crayfishing [5]. The narrow-clawed crayfish can, generally, reach a relatively large size and can tolerate altered water conditions [5,6], as it has been found in brackish waters as well, implying its tolerance towards fluctuating salinity levels [7]. Additionally, it seems to be more tolerant towards diseases in comparison with other indigenous species [8].
Four freshwater crayfish species are found in Greece. More specifically, there are three indigenous (Astacus astacus, P. leptodactylus, Austropotamobius torrentium) and one alien (Pacifastacus leniusculus) species. Previous studies concerning its geographic spread report that P. leptodactylus is native to the Evros region in Greece [9,10]. However, due to its high economic significance and export orientation, many translocations and introductions of P. leptodactylus have been carried out in new habitats where it had not been recorded in the past. Lakes Vegoritida and Volvi in north Greece are included in the above category, as P. leptodactylus was recently recorded there, probably reflecting recent translocation events [5]. It should be also highlighted that this species presents a high aquaculture potential in north Greece [5]. An interesting question rises regarding translocation events that requires the investigation of the genetic influence (if existing) on the populations due to the different environmental conditions existing in the new habitats or the co-occurrence with other species, and, subsequently, the hybrids that may exist. Hybrids have been observed in a previous study, indicating the high possibility they also exist in several ecosystems that freshwater crayfish inhabit [11].
P. leptodactylus is the second most widespread freshwater crayfish indigenous species in Europe, widely distributed and found in 32 countries [12]. More specifically, it is indigenous to Europe and Anatolia [13] and its native range is associated with the Ponto–Caspian water bodies [14]. Despite its economic value, its broad distribution, and its declining populations, the phylogenetic relationships between populations of this species with other members of the family Astacidae are not completely clear, resulting in confusion regarding its systematic classification. The above situation is reflected in the different proposed names such as P. leptodactylus, Astacus leptodactylus, or as Astacus leptodactylus-complex species [6,15,16,17,18,19]. Additionally, many different assumptions for the number of subgenera and subspecies have been proposed in an attempt to define the taxonomic position of the group [5,16,17,20,21]. Its most prevalent classification at the genus level is considered the P. leptodactylus [19]. However, it is worth mentioning that the majority of above interferences are based on specific mitochondrial genes’ analyses and a more comprehensive analysis, including the complete mitochondrial genome, is needed to enlighten the taxonomy.
Mitochondrial genomes have been widely used for phylogenetic analyses, being considered as a very useful tool for reconstructing phylogenies. In animals, the typical mitochondrial genome is a circular duplex molecule, which contains 13 protein-coding genes (PCGs), 22 transfer RNA (tRNA) genes, 2 ribosomal RNA (rRNA) genes, and the control region (D-loop), which is usually an AT-rich noncoding sequence [22]. Previous genetic studies on P. leptodactylus were mainly focused on genetic markers such as allozymes, single mitochondrial genes, and microsatellites [11,23,24,25], with a remarkable absence of complete mitochondrial-genome-based studies. Previous phylogenetic studies based on COI revealed two different phylogroups, one including European populations and another including Asian populations [23]. Furthermore, among the species, two subspecies have been identified in Turkey, with one distributed in the western and central Anatolia region of Turkey, and the second distributed in the eastern Thrace and Marmara regions of Turkey [12]. The lack of a comprehensive phylogenetic study of P. leptodactylus is also highlighted from more recent studies [26]. However, in Greece, scarce data exist regarding the genetic identity of this species.
DNA barcoding, especially when cytochrome oxidase 1 (cox1) is used as a reference [27], has raised some concerns [28]. More specifically, it has been revealed that for some taxonomic groups, including crustaceans [29], DNA barcoding is not a completely reliable method. The above is mainly supported by the uncertainty existing towards the impact of mitochondrial DNA copies in the nuclear genome (NUMTS). NUMTs are referred to as copies of mitochondrial genomic elements that are transferred into the nuclear genome [30]. NUMTS have also been identified in freshwater crayfish including in the Cherax genus [27,31]. The combination of limited genomic information with the limited data regarding the molecular basis of gene expression and phenotypic variation may pose obstacles towards the aquaculture perspective of the species [32]. One major issue in phylogenetic analysis is data exclusion. Most of the studies are based on one or two mt genes or exclude some protein-coding genes from the whole mt sequence [33]. Therefore, whole mitogenome analysis regarding crustacean species may provide remarkable results towards understanding their phylogenetic gaps. In the past, whole mt genome phylogenies resolved problems existing in the phylogenetic groups of all arthropods such as intraordinal relationships [34].
Hence, taken all together, it is clear that a more robust analysis, including more mtDNA concatenated sequences or even the whole mitogenome, will provide a clearer picture regarding the phylogenetic position of the narrow-clawed crayfish inhabiting Greece. Therefore, the aim of the present study was firstly to analyze the entire mitochondrial genome of the specific species collected from Greece for the first time, in an attempt to further clarify its systematic classification. The development of a low cost and easy-to-use tool for the whole mitogenome analysis will be the first step towards future studies regarding the reconstruction of the phylogeny of the family Astacidae. More specifically, the phylogenetic investigation of P. leptodactylus species complex will provide information to fill the existing gap and reveal more details regarding the species status after and before translocations, as well as shedding light on the investigation of existence of specific species and subspecies within this genus.

2. Materials and Methods

Genomic DNA was extracted from the abdominal muscle tissue sample of P. leptodactylus from 5 crayfish individuals caught in Lake Vegoritida, northwestern Greece. The samples were immediately embedded in liquid nitrogen prior to DNA extraction. Forty (40) μg muscle tissue were obtained for DNA isolation, performed using the kit Nucleospin tissue (Machenery Nagel, Duren, Germany) following the recommendations of the manufacturer. The concentration and the purity of the DNA were evaluated using a Q5000 microvolume spectrophotometer (Quawell Technology Inc, San Jose, CA, USA). Fifteen primer sets were designed using the Primer 3 software (Primer3_masker, Tartu, Estonia) [35] according to mtDNA sequences obtained from NCBI of members of Astacidae family (Table 1). More specifically, the sequences with GenBank accession numbers KX279349.1 and KX279347.1 were utilized. The above accession numbers correspond to A. leptodactylus and A. astacus, respectively.
The 15 mtDNA segments were amplified in 15 separate PCRs for each individual. Each 20 μL PCR reaction contained 10 μL FastGene Taq 2X Ready Mix (NIPPON Genetics, Duren, Germany), 0.6 μL of each primer (10 μM), 1 μL of DNA (50 ng/μL), and ultrapure water up to the final volume. The conditions of each reaction were 95 °C for 3 min, 94 °C for 30 s, annealing temperature (Table 1) for 40 s, 72 °C for 50 s, and a final amplification step at 72 °C for 5 min. The PCR products were run on a 2% agarose for 40 min at 100 V. The fifteen PCR products from one individual are depicted in Figure 1. The DNA ladder used was 100 bp (H3 RTU, GeneDireX, Taoyuan, Taiwan). After purification of the PCR products using the commercial NucleoSpin Gel and PCR clean up kit (MAcherey-Nagel, Duren, Germany), the purified products were bidirectionally sequenced applying the Sanger methodology.
The nucleotide composition and the relative synonymous codon usage (RSCU) were determined using MEGAΧ [36]. AT skew = (A − T)/(A + T) and GC skew = (G − C)/(G + C) analysis were performed in order to describe the base composition of the coding mitogenome.
Finally, using the MEGAX software [36], the results from sequencing were aligned using the ClustalW algorithm and a maximum likelihood (ML) phylogenetic tree was created including five sequences retrieved from GenBank with accession numbers: NC_033509.1, NC_033504.1, NC_026560.1, KX279349.1, and KX279347.1. Only sequences of the same lengths were included in the analysis. For ML tree construction with MEGAX, the best-fit substitution model (GTR  +  G) was determined applying the Akaike information criterion (AIC). The tree was visualized with MEGAX. The annotation of the coding mitogenome of P. leptodactylus was conducted according to the sequence with accession number KX279349, which is deposited in the GenBank database. The preliminary annotation was conducted using MITOS, which revealed the locations of the protein-coding and rRNA genes. The start and stop codons were identified using ORF finder and Blastn of NCBI [37].

3. Results

Overall, 15 mtDNA PCR products from P. leptodactylus sample were amplified (Figure 1). However, due to sequencing problems attributed to lack of reference sequences of D-loop, and, thus, uncertainties in annotation, 14 of them were successfully sequenced. The characterized haplotype was deposited in the GenBank database and assigned the accession number OQ131122.

3.1. Genome Composition

Hence, we present here the complete mitochondrial coding of P. leptodactylus genome. The coding part of the mitochondrial genome of P. leptodactylus, according to the sequencing results, consists of 15,050 base pairs. The part of the control region missing is evaluated to be approximately 1500–2000 base pairs, according to the amplified PCR product, which is in line with the mitochondrial sequences existing in the NCBI. Within the mitochondrial genome, 13 protein-coding genes, 2 ribosomal RNA, and 22 transfer RNAs are included (Table 2). Eleven out of thirteen PCGs are coded on the plus (+) strand while the other two are on the minus (−) strand. Both rRNAs and 15 tRNAs are coded on the + strand, while 7 tRNAs are on the minus. Furthermore, all the genes are closely aligned with only a small number of overlapping base pairs. The schematic illustration of the mitochondrial genome of P. leptodactylus is depicted in Figure 2. Thus, from the complete mitochondrial genome, we are probably missing the D-loop according to the typical mitochondrial genome structure observed in animals. The D-loop in length is approx. 1500–2000 bp (as depicted in Figure 1, in number 5 well), which is considered as a moderate or slightly big size for this region. However, fluctuations regarding the size of the D-loop are common among species as, generally, this region is considered to exhibit the most significant length variation in the mitogenome [38].
The base composition of the coding mitogenome of P. leptodactylus presents a strong A + T bias (71.4%). More specifically, the base composition is found to be T: 39.1%, C: 11.3%, A: 32.3%, and G: 17.3%. Additionally, a negative AT skew (−0.095) and a positive GC skew (0.210) are observed.

3.2. Protein-Coding Genes, tRNAs, and rRNAs

The PCG region is calculated to be 11,153 bp in length, which corresponds to 74.11% of the whole coding mitogenome of P. leptodactylus. For the tRNA and rRNA region, the length is found to be 1427 bp and 2139 bp, corresponding to 9.48% and 14.57%, respectively, of the whole coding mitogenome of narrow-clawed crayfish. The length of the 13 PCGs ranges between 159 bp (atp8) and 1734 bp (nad5), while the length of 22 tRNAs ranges between 62 bp and 70 bp. Eleven of the PCGs are initiated by a canonical ATN codon while the other two (atp8; nad2) are initiated by near-cognate GTG codon. Furthermore, ten of them terminate with a typical TAA stop codon while the other three (cox1; atp8; cytb) terminate with TTA, TAG, and ATT, respectively. The rRNA genes (rrnS; rrnL) are located between trnN and trnV and between trnV and trnL1, and they are 814 bp and 1379 bp in length, respectively. The D-loop region is located between trnE and trnQ and it is estimated to be between 1500 and 2000 bp in length.
The average codon frequencies of the PCGs were calculated. From the results, it is shown that the RSCU values of the preference codons are all greater than 1 (Figure 3). Furthermore, the RSCU analysis reveals that the codons of all the PCGs have a strong preference, as RSCU values of NNU and NNA (which correspond to the codon that have U or A on the third position) are mostly higher than 1, and the frequency of usage is higher.

3.3. Phylogenetic Analysis

The phylogenetic relationships of P. leptodactylus sample from Greece (OQ131122) in comparison with other species (five haplotypes retrieved from GenBank with accession numbers: NC_033509.1, NC_033504.1, NC_026560.1, KX279349.1, and KX279347.1 belonging to the same family (Astacidae) are depicted in the maximum likelihood dendrogram of Figure 4. More specifically, NC_033509.1, NC_033504.1, NC_026560.1, KX279349.1, and KX279347.1 correspond to P. leniusculus, A. pallipes, A. torrentium, A. leptodactylus, and A. astacus, respectively. After alignment, these haplotypes were trimmed and eventually only sequences of the same length were compared. Further, branch lengths were included in the phylogenetic tree to evaluate the differences in the lengths of the branches.

4. Discussion

P. leptodactylus is a species with no clear systematic classification due to its various different morphological characteristics. Its most prevalent classification at the genus level is P. leptodactylus [19]. However, in Greece, there are limited data regarding the genetic identity of this species.
Even among the same basin, in the Caspian Sea the genetic structure of seven populations revealed significant haplotype diversity and nucleotide diversity [32]. Furthermore, many studies report the genetic variation existing among freshwater crayfish populations in many lakes and rivers [10,11,32,39,40,41]. This observation could be expected, as lakes and rivers operate as natural barriers for the population leading to distinct phylogenetic lineages, in contrast with marine species where typically low levels of genetic differentiation are observed mainly due to lack of natural boundaries and the high levels of dispersal potential [42].
The translocations that took place during the last years to new habitats were carried out by humans, where the narrow-clawed crayfish established populations. In most of these cases, there is a co-occurrence of P. leptodactylus with other freshwater crayfish species, such as A. astacus [10,43] and A. torrentium [5,9]. Therefore, the co-occurrence of P. leptodactylus with other freshwater species sharing common habitats can probably led to inbreeding and potential hybrids [11,23]. Therefore, it is of high importance to determine its genetic profile, as its populations are well-established in the new habitats after translocations. Hence, apart from the existing limited genetic data, after the translocation events, there is a major question rising regarding the assumption if this species developed distinct genetic identity in the new habitats. It is possible for P. leptodactylus to survive in the places where it has been transferred and established populations. From all the above, it is clear that these data from the mitochondrial genome sequence will provide useful information regarding translocations events for future biogeography analysis.
The present study, to the best of our knowledge, represents the first attempt to analyze the mitochondrial genome of P. leptodactylus in Greece, as well as representing the first step towards the investigation of its phylogenetic position based on the entire mitochondrial genome. The complete coding mitogenome of P. leptodactylus was submitted to GenBank, and given the Accession number OQ131122. Furthermore, we report 15 primer pairs that can be used for both P. leptodactylus and A. astacus for further analyses of different mitochondrial segments. The majority of P. leptodactylus genetic studies, so far, are mainly focused on genetic markers such as allozyme, single mitochondrial genes, and microsatellites [11,23,24,25] and limited information exists regarding the analysis of whole mitogenome. Furthermore, this specific genetic tool (15 primer sets and PCR conditions), as well as being cheaper, is also more user-friendly regarding the analysis process in comparison with Illumina method.
We observed that P. leptodactylus from Greece is genetically closer to A. astacus, and, indeed, has a smaller genetic distance compared to that of A. torrentium and A. pallipes, which belong to the same genus. In addition, the genetic distance between the analyzed sample and the unique sequence of P. leptodactylus submitted to GenBank (KX279349.1) is quite high, even though the individuals belong to the same species. The above observation suggests that the years after its translocation and population establishment, together with potential introgression with other species, has probably exerted an impact on the mitochondrial genome of wild P. leptodactylus individuals, leading to a distinct genetic identity after local adaptation. Of course, further research at population genetic level, including other Greek habitats where crayfish occur naturally or have been translocated, is necessary to draw conclusions regarding the genetic profile of the species and the potential existence of founder effects or cryptic species. Determination and enlightening of stock complexity at different locations is crucial for efficient species management strategies and stock assessment for aquaculture development [44,45]. Further, our results do not fully support the current taxonomic evaluation of Astacus and Pontastacus genera, which is based either on partial genes or on morphological data. Instead, complete mitochondrial-genome-based analysis seems to question the assignment of Astacus and Pontastacus in different genera, as well as raises concerns regarding the genetic distance of introduced populations in comparison with native ones.
Genetic analysis of the populations inhabiting Greece could lead to proper management in cases where the natural populations decline, omitting negative impacts in the ecosystem. Freshwater habitats, due to the existence of natural barriers, are characterized by restricted gene flow. Thus, the limited gene flow in combination with the co-occurrence of different freshwater crayfish species could result in different genetic structures as the years pass by. The improper management of translocations and restocking could lead to reduced genetic diversity and increased inbreeding levels. From all the above, it can be assumed that the genetic characterization of P. leptodactylus in Greece is of major importance for three main reasons: firstly, for a more efficient management of bloodstocks towards restocking purposes when populations decline; secondly, as a useful tool for aquaculture, as it can be used for genetic diversity, bloodstock management, and species identification [46]; and thirdly, for shedding light on the phylogenetic status of Greek populations inhabiting both natural and translocated habitats.

5. Conclusions

Here, we provide the first analysis of mitogenome of P. leptodactylus from Greece. It should be mentioned at this point that although one P. leptodactylus mitochondrial complete genome haplotype was already available in GenBank database, to the best of our knowledge, there was no study discussing this submission. Thus, this is the first study that describes the P. leptodactylus mitochondrial genome as well. The analyzed mitogenome of P. leptodactylus consists of 15,050 base pairs including 13 protein-coding genes, 2 rRNAs, and 22 tRNAs. From the phylogenetic relationships between the species studied, it is revealed that P. leptodactylus and A. astacus are closer than A. torrentium and A. pallipes, although the latter are classified in the same genera. Furthermore, high genetic distance is observed between the sample from Greece with the sequence existing in the GenBank. Hence, this partial mitogenome, together with the primer sets we describe, can operate as important and valuable information to support ongoing comparative genomic, phylogenomics, and molecular-based breeding studies for aquaculture, conservation, and biodiversity-related studies and can be improved upon over time, with the generation of additional data. To conclude, in addition to providing a fully annotated coding mitogenome of P. leptodactylus depicting its phylogenetic position, we developed a useful set of primers for further comprehensive analysis.

Author Contributions

Conceptualization, M.V.A. and I.A.G.; methodology, M.V.A.; software, M.V.A. and A.L.; validation, B.M. and A.P.A.; formal analysis, A.P.A.; investigation, M.V.A. and A.L.; resources, I.A.G.; data curation, M.V.A.; writing—original draft preparation, M.V.A.; writing—review and editing, A.P.A. and I.A.G.; visualization, A.P.A.; supervision, I.A.G.; project administration, A.L.; funding acquisition, I.A.G. All authors have read and agreed to the published version of the manuscript.

Funding

This research project was supported by the Hellenic Foundation for Research and Innovation (H.F.R.I.) under the “2nd Call for H.F.R.I. Research Projects to support Faculty Members & Researchers” (Project Number: 3245).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are openly available in GenBank® NIH genetic sequence database under the accession number OQ131122.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Gherardi, F.; Souty-Grosset, C. Pontastacus leptodactylus (Amended Version of 2016 Assessment). The IUCN Red List of Threatened Species 2017: E.T153745A120103207. Available online: https://www.iucnredlist.org/species/153745/120103207 (accessed on 8 December 2022).
  2. Diler, O.; Bolat, Y. Isolation of Acremonium species from crayfish, Astacus leptodactylus in Egirdir Lake. Bull. Eur. Assoc. Fish Pathol. 2001, 21, 164–168. [Google Scholar]
  3. Souty-Grosset C’Reynolds, J.D. Current ideas on methodological approaches in European crayfish conservation and restocking procedures. Knowl. Manag. Aquat. Ecosyst. 2009, 394–395, 1. [Google Scholar] [CrossRef]
  4. Harlioğlu, A.G.; Harlioğlu, M.M. The status of freshwater crayfish (Astacus leptodactylus Eschscholtz) fisheries in Turkey. Rev. Fish. Sci. 2009, 17, 187–189. [Google Scholar] [CrossRef]
  5. Alvanou, M.V.; Papadopoulos, D.K.; Lattos, A.; Georgoulis, I.; Feidantsis, K.; Apostolidis, A.P.; Michaelidis, B.; Giantsis, I. Biology, distribution, conservation status and stocking perspective of freshwater crayfish in Greece: An updated review. Aquac. Res. 2022, 53, 5115–5128. [Google Scholar] [CrossRef]
  6. Holdich, D.M.; Haffner, P.; Noël, P.Y.; Carral, J.; Füreder, L.; Gherardi, F.; Machino, Y.; Madec, J.; Pöckl, M.; Śmietana, P.; et al. Species files. In Atlas of Crayfish in Europe; Souty-Grosset, C., Holdich, D.M., Noël, P.V., Haffner, P., Eds.; Muséum Nationale d’Histoire Naturelle: Paris, France, 2006; pp. 50–129. [Google Scholar]
  7. Holdich, D.M.; Harlioğlu, M.M.; Firkins, I. Salinity Adaptations of Crayfish in British Waters with Particular Reference to Austropotamobius pallipes, Astacus leptodactylus and Pacifastacus leniusculus. Estuar. Coast. Shelf Sci. 1997, 44, 147–154. [Google Scholar] [CrossRef]
  8. Kokko, H.; Koistinen, L.; Harlioğlu, M.M.; Makkonen, J.; Aydın, H.; Jussila, J. Recovering Turkish narrow clawed crayfish (Astacus leptodactylus) populations carry Aphanomyces astaci. Knowl. Manag. Aquat. Ecosyst. 2012, 404, 12. [Google Scholar] [CrossRef]
  9. Perdikaris, C.; Konstantinidis, E.; Georgiadis, C.; Kouba, A. Freshwater crayfish distribution update and maps for Greece: Combining literature and citizen-science data. Knowl. Manag. Aquat. Ecosyst. 2017, 418, 51. [Google Scholar] [CrossRef]
  10. Laggis, A.; Baxevanis, A.D.; Charalampidou, A.; Maniatsi, S.; Triantafyllidis, A.; Abatzopoulos, T.J. Microevolution of the noble crayfish (Astacus astacus) in the Southern Balkan Peninsula. BMC Evol. Biol. 2017, 17, 122. [Google Scholar] [CrossRef]
  11. Gross, R.; Kõiv, K.; Pukk, L.; Kaldre, K. Development and characterization of novel tetranucleotide microsatellite markers in the noble crayfish (Astacus astacus) suitable for highly multiplexing and for detecting hybrids between the noble crayfish and narrow-clawed crayfish (A. leptodactylus). Aquaculture 2017, 472, 50–56. [Google Scholar] [CrossRef]
  12. Holdich, D.M.; Reynolds, J.D.; Souty-Grosset, C.; Sibley, P.J. A review of the ever increasing threat to European crayfish from non-indigenous crayfish species. Knowl. Manag. Aquat. Ecosyst. 2009, 394-395, 11. [Google Scholar] [CrossRef]
  13. Akhan, S.; Bektas, Y.; Berber, S.; Kalayci, G. Population structure and genetic analysis of narrow-clawed crayfish (Astacus leptodactylus) populations in Turkey. Genetica 2014, 142, 381–395. [Google Scholar] [CrossRef] [PubMed]
  14. Kȯksal, G. Astacus leptodactylus in Europe. In Freshwater Crayfish. Biology, Management and Exploitation; Holdich, D.M., Lowery, R.S., Eds.; Croom Helm: London, UK, 1988; pp. 365–400. [Google Scholar]
  15. Karaman, M.S. Studie der Astacidae (Crustacea, Decapoda) II. Teil. Hydrobiologia 1963, 22, 111–132. [Google Scholar] [CrossRef]
  16. Strarobogatov, Y.I. Taxonomy and geographical distribution of crayfishes of Asia and East Europe (Crustacea Decapoda Astacoidei). Arthropoda Sel. 1995, 4, 3–25. [Google Scholar]
  17. Śmietana, P.; Schuz, H.K.; Keszka, S.; Schulz, R.; Schulz, H.K.; Keszka, S.; Schulz, R. A proposal for accepting Pontastacus as a genus of European crayfish within the family Astacidae based on a revision of the West and East European taxonomic literature. Bull. Français Pêche Piscic. 2006, 380–381, 1041–1052. [Google Scholar] [CrossRef]
  18. Kostyuk, V.S.; Garbar, A.V.; Mezhzherin, S.V. Karyotypes and morphological variability of crayfish Pontastacus leptodactylus and P. angulosus (Malacostraca, Decapoda). Vestn. Zool. 2013, 47, 11–16. [Google Scholar] [CrossRef]
  19. Crandall, K.A.; De Grave, S. An updated classification of the freshwater crayfishes (Decapoda: Astacidea) of the world, with a complete species list. J. Crust. Biol. 2017, 37, 615–653. [Google Scholar] [CrossRef]
  20. Brodski, S.Y. On the systematics of palaearctic crayfishes (Crustacea, Astacidae). Freshw. Crayfish 1983, 5, 464–469. [Google Scholar]
  21. Grandjean, F.; Gouin, N.; Keith, P.; Noėl, P.; Persat, H.; Reynolds, J.; Schulz, H.; Smietana, P.; Souty-Grosset, C. Systematics and phylogeny of freshwater crayfish, with particular reference to historical biogeography of Europe. In Atlas of Crayfish in Europe; Souty-Grosset, C., Holdich, D.M., Noël, P.V., Haffner, P., Eds.; Muséum Nationale d’Histoire Naturelle: Paris, France, 2006; pp. 11–23. [Google Scholar]
  22. Wolstenholme, D.R. Animal mitochondrial DNA: Structure and evolution. Int. Rev. Cytol. 1992, 141, 173–216. [Google Scholar]
  23. Maguire, I.; Podnar, M.; Jelic, M.S.Ï.; Tambuk, A.; Schrimpf, A.; Schulz, H. Two distinct evolutionary lineages of the Astacus leptodactylus species-complex (Decapoda: Astacidae) inferred by phylogenetic analyses. Invertebr. Syst. 2014, 28, 117–123. [Google Scholar] [CrossRef]
  24. Khoshkholgh, M.R.; Nazari, S. Genetic variation in popula- tions of the narrow-clawed crayfish (Astacus leptodactylus) as assessed by PCR-RFLP of mitochondrial COI gene. Mol. Biol. Res. Commun. 2015, 4, 225–237. [Google Scholar]
  25. Khoshkholgh, M.R.; Nazari, S. Application of microsatellite markers for the delineation of the narrow-clawed crayfish (Astacus leptodactylus) populations from Caspian Sea Basin. WJFMS 2016, 8, 142–150. [Google Scholar]
  26. Blaha, M.; Patoka, J.; Japoshvili, B.; Let, M.; Buřič, M.; Kouba, A.; Mumladze, L. Genetic diversity, phylogenetic position and morphometric analysis of Astacus colchicus (Decapoda, Astacidae): A new insight into Eastern European crayfish fauna. Integr. Zool. 2021, 16, 368–378. [Google Scholar] [CrossRef] [PubMed]
  27. Tan, M.H.; Gan, H.M.; Lee, Y.P.; Grandjean, F.; Croft, L.J.; Austin, C.M. A giant genome for a giant crayfish (Cherax quadricarinatus) with insights into cox1 pseudogenes in decapod genomes. Front. Gen. 2020, 11, 201. [Google Scholar] [CrossRef] [PubMed]
  28. Collins, R.A.; Cruickshank, R.H. The seven deadly sins of DNA barcoding. Mol. Ecol. Resour. 2013, 13, 969–975. [Google Scholar] [CrossRef] [PubMed]
  29. Song, H.; Buhay, J.E.; Whiting, M.F.; Crandall, K.A. Many species in one: DNA barcoding overestimates the number of species when nuclear mitochondrial pseudogenes are coamplified. PNAS 2008, 105, 13486–13491. [Google Scholar] [CrossRef]
  30. Hazkani-Covo, E.; Zeller, R.M.; Martin, W. Molecular poltergeists: Mitochondrial DNA copies (numts) in sequenced nuclear genomes. PLoS Genet. 2010, 6, e1e000834. [Google Scholar] [CrossRef]
  31. Munasinghe, D.H.N.; Murphy, N.P.; Austin, C.M. Utility of mitochondrial DNA sequences from four gene regions for systematic studies of Australian freshwater crayfish of the genus Cherax (Decapoda: Parastacidae). J. Crustacean Biol. 2003, 23, 402–417. [Google Scholar] [CrossRef]
  32. Khoshkholgh, M.; Nazari, S. The genetic diversity and differentiation of narrow-clawed crayfish Pontastacus leptodactylus (Eschscholtz, 1823) (Decapoda:Astacidea:Astacidae) in the Caspian Sea Basin, Iran as determined with mitochondrial and microsatellite DNA markers. J. Crust. Biol. 2019, 39, 112–120. [Google Scholar] [CrossRef]
  33. Jia, X.N.; Xu, S.X.; Bai, J.; Wang, Y.F.; Nie, Z.H.; Zhu, C.C.; Wang, Y.; Cai, Y.X.; Zou, J.X.; Zhou, X.M. The complete mitochondrial genome of Somanniathelphusa boyangensis and phylogenetic analysis of Genus Somanniathelphusa (Crustacea: Decapoda: Parathelphusidae). PLoS ONE 2018, 13, 0192601. [Google Scholar] [CrossRef]
  34. Cameron, S.L.; Lambkin, C.L.; Barker, S.C.; Whiting, M.F. A mitochondrial genome phylogeny of Diptera: Whole genome sequence data accurately resolve relationships over broad timescales with high precision. Syst. Entomol. 2007, 32, 40–59. [Google Scholar] [CrossRef]
  35. Kõressaar, T.; Lepamets, M.; Kaplinski, L.; Raime, K.; Andreson, R.; Remm, M. Primer3_masker: Integrating masking of template sequence with primer design software. Bioinformatics 2018, 34, 1937–1938. [Google Scholar] [CrossRef] [PubMed]
  36. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGAX: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
  37. Bernt, M.; Donath, A.; Jühling, F.; Externbrink, F.; Florentz, C.; Fritzsch, G.; Pütz, J.; Middendorf, M.; Stadler, P.F. MITOS: Improved de Novo Metazoan Mitochondrial Genome Annotation. Mol. Phylogenet. Evol. 2013, 69, 313–319. [Google Scholar] [CrossRef]
  38. Boore, J.L.; Brown, W.M. Big Trees from Little Genomes: Mitochondrial Gene Order as a Phylogenetic Tool. Curr. Opin. Genet. Dev. 1998, 8, 668–674. [Google Scholar] [CrossRef] [PubMed]
  39. Gouin, N.; Grandjean, F.; Souty-Grosset, C. Disentangling the impact of demographic factors on population differentiation of an endangered freshwater crayfish (Austropotamobius pallipes) using population density and microsatellite data. Freshw. Biol. 2011, 56, 2105–2118. [Google Scholar] [CrossRef]
  40. Gouin, N.; Souty-Grosset, C.; Ropiquet, A.; Grandjean, F. High dispersal ability of Austropotamobius pallipes revealed by microsatellite markers in a French brook. Bull. Français Pêche Piscic. 2002, 367, 681–689. [Google Scholar] [CrossRef][Green Version]
  41. Fetzner, J.W.; Crandall, K.A. Genetic variability within and among populations of the golden crayfish (Orconectes luteus): A comparison using amplified fragment length polymorphism (AFLPs) and mitochondrial 16s gene sequences. Freshw. Crayfish 1999, 12, 396–412. [Google Scholar]
  42. Palumbi, S.R. Genetic divergence, reproductive isolation, and marine speciation. Ecol. Evol. Syst. 1994, 25, 547–572. [Google Scholar] [CrossRef]
  43. Perdikaris, C.; Georgiadis, C. Co-occurrence of narrow-clawed crayfish (Astacus leptodactylus sensu lato) and noble crayfish (Astacus astacus L.) in the southwestern Balkans: The case of Lake Pamvotida (NW Greece). North West. J. Zool. 2017, 13, 18–26. [Google Scholar]
  44. Largiader, C.R.; Herger, F.; Lörtscher, M.; Scholl, A. Assessment of natural and artificial propagation of the white-clawed crayfish (Austropotamobius pallipes species complex) in the Alpine region with nuclear and mitochondrial markers. Mol. Ecol. 2000, 9, 25–37. [Google Scholar] [CrossRef]
  45. Schulz, R. Status of the noble crayfish Astacus astacus (L.) in Germany: Monitoring protocol and the use of RAPD markers to assess the genetic structure of populations. Bull. Français Pêche Piscic. 2000, 356, 123–138. [Google Scholar] [CrossRef]
  46. Liu, Z.J.; Cordes, J.F. DNA marker technologies and their applications in aquaculture genetics. Aquaculture 2004, 238, 1–37. [Google Scholar] [CrossRef]
Figure 1. The fifteen PCR products from one individual amplified. Primer pair numbers according to Table 1. L: 100 bp Ladder (H3 RTU, GeneDireX).
Figure 1. The fifteen PCR products from one individual amplified. Primer pair numbers according to Table 1. L: 100 bp Ladder (H3 RTU, GeneDireX).
Genes 14 00494 g001
Figure 2. The annotated mitogenome of Pontastacus leptodactylus. Protein-coding, rRNA, and tRNA genes are shown with standard abbreviations and different colors. Arrows indicate transcription directions. The genes shown above the line indicate that the genes are on the direct strand, while genes depicted under the line are located on the reverse strand.
Figure 2. The annotated mitogenome of Pontastacus leptodactylus. Protein-coding, rRNA, and tRNA genes are shown with standard abbreviations and different colors. Arrows indicate transcription directions. The genes shown above the line indicate that the genes are on the direct strand, while genes depicted under the line are located on the reverse strand.
Genes 14 00494 g002
Figure 3. RSCU in the Pontastacus leptodactylus mitogenome. RSCU values are depicted on the y-axis while on the x-axis the codon families for amino acids and stop codons are shown. The asterisk “*” indicates the stop codon.
Figure 3. RSCU in the Pontastacus leptodactylus mitogenome. RSCU values are depicted on the y-axis while on the x-axis the codon families for amino acids and stop codons are shown. The asterisk “*” indicates the stop codon.
Genes 14 00494 g003
Figure 4. Maximum likelihood dendrogram depicting the phylogenetic position of Greek haplotype among the species Pontastacus leptodactylus, Astacus astacus, Austropotamobius torrentium, Austropotamobius pallipes, and Pacifastacus leniusculus.
Figure 4. Maximum likelihood dendrogram depicting the phylogenetic position of Greek haplotype among the species Pontastacus leptodactylus, Astacus astacus, Austropotamobius torrentium, Austropotamobius pallipes, and Pacifastacus leniusculus.
Genes 14 00494 g004
Table 1. Primer sets designed for the sequencing of mtDNA of Pontastacus leptodactylus.
Table 1. Primer sets designed for the sequencing of mtDNA of Pontastacus leptodactylus.
Primer SetNameSequenceTm (°C)Product Length (bp)Genes Included
1MtAst1F
MtAst1R
5′ CAAATCATAAAGATATTGGAAC 3′
5′ AATGTTGRGGRAAGAATGT 3′
491259coxI partial
2MtAst2F
MtAst2R
5′ CAGTKGGRGGTTTAACAGGAG 3′
5′ GTTATCRRGTGATTATTCTGAAC 3′
541255coxI (partial)
trnL2
coxII
trnK (partial)
3MtAst3F
MtAst3R
5′ CATTCTTGAACTGTACCTTC 3′
5′ CTACTAAATGATATGCATGGTG 3′
521201coxII (partial)
trnK
trnD
atp8
atp6
coxIII (partial)
4MtAst4.2F
MtAst4.2R
5′ GCTGTTGCAATTATTCAGTC 3′
5′ CCAAAGGTATAAGAAGMGTA 3′
501394atp6 (partial)
coxIII
trnG
nad3 (partial)
5MtAst5F
MtAst5R
5′ GGCTTCCAACCAAAAGGTC 3′
5′ AGTWTAACCGCGACTGCTG 3′
49~1500–2000D-loop
6MtAst6F
MtAst6R
5′ GAATTTAACCGCTCAAGAAC 3′
5′ CCTAACTATTTCTCTTCCGAG 3′
521287trnN
rrnS
trnV
rrnL (partial)
7MtAst7F
MtAst7R
5′ AGCATCTCATTTACACCGA 3′
5′ ABTCBAACATGTCTAAGCATC 3′
511424rrnL
trnL1
nad1 (partial)
8MtAst8F
MtAst8R
5′ TACTTTAGGGATAACAGCGTA 3′
5′ GGTCAAATTCTTTCACTCCT 3′
521502rrnL (partial)
trnL1
nad1
trnP
trnS2
cytb (partial)
9MtAst9F
MtAst9R
5′ TACCTCGGTTTCGTTATGA 3′
5′ ATACYCCYAATATTGAATCAG 3′
511243nad1 (partial)
trnP
trnS2
cytb (partial)
10MtAst10F
MtAst10R
5′ GACCTCARGGTAAGACATATC 3′
5′ TCTCTCCCTAAYTGATTTCC 3′
541463cytb (partial)
nad6
trnT
nad4l
11MtAst11F
MtAst11R
5′ GTCCGCTCRCARGGTAATG 3′
5′ AAAGGAAGYCAATGAAGAC 3′
511339nad4l (partial)
nad4
trnH (partial)
12MtAst12F
MtAst12R
5′ GTCATGGTTTATGTTCATCTG 3′
5′ ACTCAAAATTAGCTCCRAGC 3′
521285nad4l (partial)
nad4
trnH
nad5 (partial)
13MtAst13F
MtAst13R
5′ CGTGTCRGCATTAGTACATTC 3′
5′ CCCCAAAYCAAGAATTTGAAG 3′
541377nad5 (partial)
trnF
trnI
trnM
nad2 (partial)
14MtAst14F
MtAst14R
5′ CTACATTGAAGCTGTAGAAGAG 3′
5′ TTTGACAACTTTGAAGGATG 3′
511213trnW (partial)
nad2
trnW (partial)
15MtAst15F
MtAst15R
5′ TCAGCAGGCCTATCATTT 3′
5′ CAAAAGCATGAGCAGTTACTAC 3′
51668nad2 (partial)
trnW
trnC
trnY
coxI (partial)
Table 2. Annotation of the coding mitogenome of Pontastacus leptodactylus.
Table 2. Annotation of the coding mitogenome of Pontastacus leptodactylus.
PositionGeneNameStrandStart CodonStop CodonAnticodonGene Length/bp
1–1537Cytochrome c oxidase subunit 1cox1+ATTTTA 1537
1539–1601tRNAtrnL2+ TAA63
1602–2288Cytochrome c oxidase subunit 2cox2+ATGTAA 687
2290–2353tRNAtrnK+ TTT64
2355–2420tRNAtrnD+ GTC66
2421–2579ATP synthase F0 subunit 8atp8+GTGTAG 159
2573–3247ATP synthase F0 subunit 6atp6+ATGTAA 675
3247–4035Cytochrome c oxidase subunit 3cox3+ATGTAA 789
4034–4095tRNAtrnG+ TCC62
4096–4449NADH dehydrogenase subunit 3nad3+ATTTAA 354
4451–4512tRNAtrnA+ TGC62
4511–4575tRNAtrnR+ TCG65
4576-4645tRNAtrnE+ TTC70
~1500–2000 base pairsGapdloop
4858–4926tRNAtrnQ TTG69
4935–5001tRNAtrnS1 TCT67
5002–5065tRNAtrnN GTT64
5143–5956rRNArrnS+ 814
5959–6027tRNAtrnV+ TAC69
5993–7371rRNA (partial)rrnL+ 1379
7318–7380tRNAtrnL1+ TAG63
7405–8343NADH dehydrogenase subunit 1nad1+ATATAA 939
8363–8424tRNAtrnP+ TGG62
8429–8495tRNAtrnS2 TGA67
8496–9630Cytochrome bcytbATGATT 1135
9630–10,139NADH dehydrogenase subunit 6nad6ATTTAA 510
10,167–10,232tRNAtrnT TGT66
10,235–10,528NADH dehydrogenase subunit 4nad4L+ATGTAA 294
10,525–11,871NADH dehydrogenase subunit 4nad4+ATATAA 1347
11,871–11,932tRNAtrnH+ GTG62
11,933–13,666NADH dehydrogenase subunit 5nad5+ATGTAA 1734
13,666–13,727tRNAtrnF+ GAA62
13,735–13,798tRNAtrnI+ GAT64
13,798–13,862tRNAtrnM+ CAT65
13,863–14,855NADH dehydrogenase subunit 2nad2+GTGTAA 993
14,855–14,921tRNAtrnW+ TCA67
14,923–14,986tRNAtrnC GCA64
14,987–15,050tRNAtrnY GTA64
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Alvanou, M.V.; Apostolidis, A.P.; Lattos, A.; Michaelidis, B.; Giantsis, I.A. The Coding Mitogenome of the Freshwater Crayfish Pontastacus leptodactylus (Decapoda:Astacidea:Astacidae) from Lake Vegoritida, Greece and Its Taxonomic Classification. Genes 2023, 14, 494. https://doi.org/10.3390/genes14020494

AMA Style

Alvanou MV, Apostolidis AP, Lattos A, Michaelidis B, Giantsis IA. The Coding Mitogenome of the Freshwater Crayfish Pontastacus leptodactylus (Decapoda:Astacidea:Astacidae) from Lake Vegoritida, Greece and Its Taxonomic Classification. Genes. 2023; 14(2):494. https://doi.org/10.3390/genes14020494

Chicago/Turabian Style

Alvanou, Maria V., Apostolos P. Apostolidis, Athanasios Lattos, Basile Michaelidis, and Ioannis A. Giantsis. 2023. "The Coding Mitogenome of the Freshwater Crayfish Pontastacus leptodactylus (Decapoda:Astacidea:Astacidae) from Lake Vegoritida, Greece and Its Taxonomic Classification" Genes 14, no. 2: 494. https://doi.org/10.3390/genes14020494

APA Style

Alvanou, M. V., Apostolidis, A. P., Lattos, A., Michaelidis, B., & Giantsis, I. A. (2023). The Coding Mitogenome of the Freshwater Crayfish Pontastacus leptodactylus (Decapoda:Astacidea:Astacidae) from Lake Vegoritida, Greece and Its Taxonomic Classification. Genes, 14(2), 494. https://doi.org/10.3390/genes14020494

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop