Genetic Diversity and Population Structure of Fusarium commune Causing Strawberry Root Rot in Southcentral China
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Isolation of F. commune Strains
2.3. DNA Extraction, PCR Amplification, and Species Identification
2.4. Development of SSR Markers for F. commune
2.5. SSR Genotyping for F. commune Isolates
2.6. Data Analysis
3. Results
3.1. Isolation and Molecular Identification of F. commune by tef1α Sequencing
3.2. SSR Marker Development
3.3. Allele and Genotype Characteristics of the Seven SSR Markers
3.4. Allelic and Genotypic Variations within Geographical Populations of F. commune
3.5. Relationships among Geographic Populations of F. commune
3.6. STRUCTURE Results
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Afrin, S.; Gasparrini, M.; Forbes-Hernandez, T.Y.; Reboredo-Rodriguez, P.; Mezzetti, B.; Varela-López, A.; Giampieri, F.; Battino, M. Promising Health Benefits of the Strawberry: A Focus on Clinical Studies. J. Agric. Food Chem. 2016, 64, 4435–4449. [Google Scholar] [CrossRef] [PubMed]
- Darrow, G.M. Strawberry: History, Breeding and Physiology; Holt, Rinehart and Winston: New York, NY, USA, 1966; p. 515. [Google Scholar]
- Liang, R. Global: Strawberry Production Increased by Nearly 40% in Ten Years. China Fruit News 2019, 37, 10. [Google Scholar]
- Shu, R.; Jiao, J.; Zang, C.; Liu, S.; Sun, Y.; Yue, L. The Current Situation and Development Suggestions of Strawberry Industry in China. China Fruit Veg. 2019, 39, 57–59. [Google Scholar]
- Wang, M.; Xue, L.; Zhao, J.; Dai, H.; Lie, J. Current Status of Strawberry Production and Trade in the World. China Fruits 2021, 1309, 104–108. [Google Scholar]
- Shu, R.; Jiao, J.; Zang, C.; Liu, S.; Sun, Y.; Qiu, L. The status quo of my country’s strawberry industry and development suggestions. China Fruit Veg. 2019, 39, 51–53. [Google Scholar]
- Ye, Q.; Wang, R.; Ruan, M.; Yao, Z.; Cheng, Y.; Wan, H.; Li, Z.; Yang, Y.; Zhou, G. Genetic Diversity and Identification of Wilt and Root Rot Pathogens of Tomato in China. Plant Dis. 2020, 104, 1715–1724. [Google Scholar] [CrossRef]
- Gibert, S.; Edel-Hermann, V.; Gautheron, E.; Gautheron, N.; Sol, J.M.; Capelle, G.; Galland, R.; Bardon-Debats, A.; Lambert, C.; Steinberg, C. First Report of Fusarium avenaceum, Fusarium oxysporum, Fusarium redolens, and Fusarium solani Causing Root Rot in Pea in France. Plant Dis. 2022, 106, 1297. [Google Scholar] [CrossRef]
- Jang, Y.; Yi, H.; Maharjan, R.; Jeong, M.; Yoon, Y. First Report of Root Rot Caused by Fusarium armeniacum on soybean in Korea. Plant Dis. 2022, 106, 1306. [Google Scholar] [CrossRef]
- Fang, D.; Liu, X.; Chen, X.; Yan, W.; He, Y.; Cheng, Y.; Chen, J.; Li, Z.; Guo, L.; Wang, T.; et al. Fusarium Species and Fusarium oxysporum Species Complex Genotypes Associated with Yam Wilt in South-Central China. Front Microbiol. 2020, 11, 1964. [Google Scholar]
- De la Lastra, E.; Villarino, M.; Astacio, J.D.; Larena, I.; De Cal, A.; Capote, N. Genetic Diversity and Vegetative Compatibility of Fusarium solani Species Complex of Strawberry in Spain. Phytopathology 2019, 109, 2142–2151. [Google Scholar] [CrossRef]
- Gao, W.; Yang, L.; Liu, Y.; Tian, Y.; Wang, Y.; Zhang, C.; Ma, J. Research Progress on the Pathogen and Integrated Management of Strawberry Root Rot in Greenhouse. Tianjin Agric. Sci. 2021, 27, 36–39. [Google Scholar]
- Maas, J.L. Compendium of Strawberry Diseases, 2nd ed.; APS Press: St. Paul, MN, USA, 1998; p. 128. [Google Scholar]
- Berkeley, G.H. Strawberry Root Rot. Annual Report East Malling Research Station Jan. to Dec. 1934; pp. 154–155. Available online: https://catalogue.nla.gov.au/Record/1678744 (accessed on 15 March 2022).
- Yao, Y.; Huo, J.; Hao, Y.; Liu, C.; Wang, W. Isolation and Identification of Strawberry Root Rot Pathogen in Tianjin and Virulence Determination Indoor. Shandong Agric. Sci. 2019, 51, 107–110. [Google Scholar]
- Wu, C.; Zhang, R.; Han, Z.; Zhang, Q. Strawberry Root Diseases and Control Measures. Plant Dis. Pests 2020, 11, 12–14. [Google Scholar]
- Kukkonen, S.; Vestberg, M.; Tuovinen, T.; Järvinen, O. Influence of soil and planting material on the development of strawberry root rot. Acta Hortic. 2004, 635, 19–24. [Google Scholar] [CrossRef]
- Chin, T.; Bloemberg, G.; Bij, A.; Drift, K.; Schripsema, J.; Kroon, B.; Scheffer, R.; Keel, C.; Bakker, P.A.H.M.; Tichy, H.V.; et al. Biocontrol by Phenazine-1-carboxamide-Producing Pseudomonas chlororaphis PCL1391 of Tomato Root Rot Caused by Fusarium oxysporum f. sp. radicis-lycopersici. Mol. Plant Microbe Interact. 1998, 11, 1069–1077. [Google Scholar] [CrossRef] [Green Version]
- Chen, Q.; Yin, S.L.; Zhang, X.G.; Ma, X.Y.; Zhong, S.; Zhang, Z. Dactylonectria species associated with black root rot of strawberry in China. Australas. Plant Pathol. 2021, 50, 501–511. [Google Scholar] [CrossRef]
- Yin, S.; Zhong, S.; Liu, Q.; Zhang, G. Identification of Rhizoctonia species causing root rot of strawberry and inhibition effects of seven fungicides. Plant Prot. 2019, 45, 132–136. [Google Scholar]
- Zhan, Y.; Peng, W.; Xu, Z.; Feng, X.; Xu, H. First report on Neofusicoccum kwambonambiense causing strawberry root rot on strawberry in China. J. Plant Pathol. 2021, 103, 1003–1004. [Google Scholar] [CrossRef]
- Sun, Q.; Harishchandra, D.; Jia, J.; Zuo, Q.; Zhang, G.; Wang, Q.; Yan, J.; Zhang, W.; Li, X. Role of Neopestalotiopsis rosae in causing root rot of strawberry in Beijing, China. Crop Prot. 2021, 147, 105710. [Google Scholar] [CrossRef]
- Erper, I.; Ozer, G.; Alkan, M.; Zholdoshbekova, S.; Turkkan, M. First report of Dactylonectria torresensis causing black root rot of strawberries in Kyrgyzstan. J. Plant Pathol. 2021, 103, 379–380. [Google Scholar] [CrossRef]
- Korfanty, G.A.; Dixon, M.; Jia, H.; Yoell, H.; Xu, J. Genetic Diversity and Dispersal of Aspergillus fumigatus in Arctic Soils. Genes 2022, 13, 19. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Wang, J.; Yang, L.; Niu, J.; Huang, R.; Yuan, F.; Liang, Q. Development of SSR and SNP markers for identifying opium poppy. Int. J. Leg. Med. 2022. [Google Scholar] [CrossRef] [PubMed]
- Zeng, Y.; Xiong, T.; Liu, B.; Carstens, E.; Chen, X.; Xu, J.; Li, H. Genetic Diversity and Population Structure of Phyllosticta citriasiana in China. Phytopathology 2021, 111, 850–861. [Google Scholar] [CrossRef] [PubMed]
- Yang, Q.; Jiang, Y.; Wang, Y.; Han, R.; Liang, Z.; He, Q.; Jia, Q. SSR Loci Analysis in Transcriptome and Molecular Marker Development in Polygonatum sibiricum. BioMed Res. Int. 2022, 2022, 4237913. [Google Scholar] [CrossRef]
- Pouralibaba, H.R.; Šatović, Z.; Cobos, M.J.; Rubiales, D.; Fondevilla, S. Genetic diversity and structure of Fusarium oxysporum f.sp. lentis isolates from Iran, Syria and Algeria. Eur. J. Plant Pathol. 2019, 153, 1019–1029. [Google Scholar]
- O’Donnell, K.; Ward, T.J.; Robert, V.A.R.G.; Crous, P.W.; Geiser, D.M.; Kang, S. DNA sequence-based identification of Fusarium: Current status and future directions. Phytoparasitica 2015, 43, 583–595. [Google Scholar] [CrossRef] [Green Version]
- Sudhir, K.; Glen, S.; Koichiro, T. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870. [Google Scholar]
- Letunic, I.; Bork, P. Interactive Tree of Life (iTOL) v4: Recent Updates and New Developments. Nucleic Acids Res. 2019, 47, W256–W259. [Google Scholar] [CrossRef] [Green Version]
- Sun, J.; Peng, G.; Xiong, L.; Tan, C.; Li, Y.; Bai, X. Genome-Wide SSR Marker Development and Application in Genetic Diversity Analysis of the Red Swamp Crayfish, Procambarus clarkii (Girard, 1852) in China. Crustaceana 2021, 94, 189–205. [Google Scholar] [CrossRef]
- Evanno, G.; Regnaut, S.; Goudet, J. Detecting the number of clusters of individuals using the software Structure: A Simulation Study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef] [Green Version]
- Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic Analysis in Excel. Population genetic software for teaching and research—An update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Skovgaard, K.; Rosendahl, S.; O’Donnell, K.; Nirenberg, H.I. Fusarium commune is a new species identified by morphological and molecular phylogenetic data. Mycologia 2003, 95, 630–636. [Google Scholar] [CrossRef] [PubMed]
- Wu, A.; Cheng, Y.; Wu, S.; Liu, G.; Zhang, S.; Xiao, S. Identification of tobacco Fusarium root rot pathogen. Acta Tab. Sin. 2018, 24, 135–140. [Google Scholar]
- Osawa, H.; Sakamoto, Y.; Akino, S.; Kondo, N. Autumn potato seedling failure due to potato dry rot in Nagasaki Prefecture, Japan, caused by Fusarium acuminatum and Fusarium commune. J. Gen. Plant Pathol. 2021, 87, 46–50. [Google Scholar] [CrossRef]
- Husna, A.; Zakaria, L.; Mohamed Nor, N.M.I. Fusarium commune associated with wilt and root rot disease in rice. Plant Pathol. 2021, 70, 123–132. [Google Scholar] [CrossRef]
- Ying-Ying, Y.U.; Liang, C.; Zhao, H.H. The pathogen causing bower kiwifruit Fusarium root rot. Mycosystema 2017, 36, 1369–1375. [Google Scholar]
- Zhang, H.; Xi, Y.; Chen, L.; Xiang, J.; Han, S.; Wu, J. Identification of a new pathogen for cowpea root rot and fungicide screening. Plant Prot. 2018, 44, 177–183. [Google Scholar]
- Deng, S.; Ma, X.; Chen, Y.; Feng, H.; Zhou, D.; Wang, X.; Zhang, Y.; Zhao, M.; Zhang, J.; Daly, P.; et al. LAMP Assay for Distinguishing Fusarium oxysporum and Fusarium commune in Lotus (Nelumbo nucifera) Rhizomes. Plant Dis. 2022, 106, 231–246. [Google Scholar] [CrossRef]
- Xu, J. Origins and spread of plant fungal and oomycete disease outbreaks. J. Plant Prot. 2022, 49, 283–297. [Google Scholar]
- Moncrief, I.; Garzon, C.; Marek, S.; Stack, J.; Gamliel, A.; Garrido, P.; Proano, F.; Gard, M.; Dehne, H.; Fletcher, J. Development of simple sequence repeat (SSR) markers for discrimination among isolates of Fusarium proliferatum. J. Microbiol. Methods 2016, 126, 12–17. [Google Scholar] [CrossRef]
- Laraba, I.; Boureghda, H.; Abdallah, N.; Bouaicha, O.; Obanor, F.; Moretti, A.; Geiser, D.M.; Kim, H.S.; McCormick, S.P.; Proctor, R.H.; et al. Population genetic structure and mycotoxin potential of the wheat crown rot and head blight pathogen Fusarium culmorum in Algeria. Fungal Genet. Biol. 2017, 103, 34–41. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Santillán-Mendoza, R.; Pineda-Vaca, D.; Fernández-Pavía, S.P.; Montero-Castro, J.C.; Goss, E.M.; Benítez-Malvido, J.; Rodríguez-Alvarado, J. Genetic diversity of Fusarium mexicanum, causal agent of mango and big-leaf mahogany malformation in Mexico. Mol. Biol. Rep. 2019, 46, 3887–3897. [Google Scholar] [CrossRef] [PubMed]
- Mezzalama, M.; Guarnaccia, V.; Martino, I.; Tabome, G.; Gullino, M.L. First report of Fusarium commune causing root and crown rot on maize in Italy. Plant Dis. 2021, 105, 4156. [Google Scholar] [CrossRef] [PubMed]
- Sneideris, D.; Ivanauskas, A.; Prakas, P.; Butkauskas, D.; Treikale, O.; Kadziene, G.; Rasiukeviciute, N.; Kelpsiene, J.; Suproniene, S. Population structure of Fusarium graminearum isolated from different sources in one area over the course of three years. Phytopathology 2020, 110, 1312–1318. [Google Scholar] [CrossRef] [PubMed]
Province | Local Site | Geographic Coordinates | Time of Sampling | Population Code |
---|---|---|---|---|
Hunan | Zhoujia, Guiyang County | 112.72 E 25.80 N | 2019.04.17 | GY |
Hunan | Xiangyangqiao, Hengnan County | 112.73 E 26.72 N | 2019.2.23 | HN |
Hunan | Huamenlou, Xiangxiang City | 112.05 E 27.86 N | 2019.04.17 | XX |
Hunan | Baomin Embankment, Yuanjiang City | 112.42 E 28.79 N | 2019.04.08 | YJ |
Hunan | Songmuqiao, Huarong County | 112.70 E 29.54 N | 2019.04.17 | HR |
Hunan | Langzhou Road, Wuling District | 111.70 E 29.09 N | 2019.04.18 | WL1 |
Hunan | Nanhupu, Wuling District | 111.62 E 29.03 N | 2019.04.18 | WL2 |
Hunan | East of District Government, Yongding District | 110.54 E 29.12 N | 2019.04.10 | YD1 |
Hunan | Houping, Yongding District | 110.43 E 29.12 N | 2019.04.11 | YD2 |
Hunan | Xinglong Street, Longshan County | 109.45 E 29.46 N | 2019.04.26 | LS |
Hubei | Laifeng County Government | 109.42 E 29.50 N | 2019.04.25 | LF |
Locus | Primer Sequence (5′ -> 3′) | Sizes of SSR Alleles (bp) among the 354 Isolates | Allele Number in Population | Repeated Sequence in Reference Genome |
---|---|---|---|---|
CM15 | FAM-ACTGAAGACGGAAGAAGCCA CTTGGCGTTCAAAAGGAGAG | 202, 208, 210, 212, 214, 216, 218, 220, 232, 233 | 10 | (AG)12 |
CM18 | HEX-GTGAAGGTCTTTGAGGCGAG AGAAGCCCCCTAAAGCTCAG | 139, 142, 145, 149, 152, 153, 155, 158, 161, 164, 167, 170, 173, 176, 179, 182, 185, 191 | 18 | (TCC)10 |
CM22 | FAM-GTTGATCAATTCCCGCTGAT AATGGACCGAAAGATTGACG | 233, 239, 241, 243, 245, 246, 249, 251, 253, 256, 257, 260, 263, 264, 267, 268, 271, 272, 273, 276, 282, 283, 289, 290, 296, 300, 304, 316, 319, 323, 331, 335, 354, 357, 364, 398 | 36 | (GAAA)9 |
CM23 | HEX-ACTCTCCAGCGCCGTATCTA TGACCTTAACGATGCAGCAG | 216, 217, 220, 228, 232, 236 | 6 | (CTGGG)5 |
CM25 | FAM_CAATGCTTGCTTTCTCCACA CATTGAGATCGAGCAGGACA | 128, 140, 145, 146, 152, 157, 162, 168, 173, 183, 188, 193, 198, 200, 209, 215, 225 | 17 | (ATGTT)5 |
CM27 | HEX-GTCGATCACAGACGGGTTCT CTTTGGTTGCGATAAGCCAT | 245, 250, 255, 257, 262, 268, 274, 279, 280, 285, 316, 322, 358 | 13 | (ATGAAT)6 |
CM29 | FAM-ATTACATCAGGTGGCGGAAG CCTTGTTTGCACAGCCAGTA | 248, 250, 255, 261, 266, 272, 277, 283, 288, 294, 299, 305, 323, 335, 341 | 15 | (TTAGGG)15 |
Geographic Site | Fibrous Root | Main Root Epidermis | Main Root Pith | Total |
---|---|---|---|---|
GY | 20 | 14 | 6 | 40 |
HN | 12 | 2 | 6 | 20 |
XX | 27 | 24 | 5 | 56 |
YJ | 17 | 11 | 3 | 31 |
HR | 15 | 7 | 5 | 27 |
WL1 | 33 | 19 | 14 | 66 |
WL2 | 11 | 8 | 5 | 24 |
YD1 | 10 | 6 | 1 | 17 |
YD2 | 7 | 7 | 2 | 16 |
LS | 3 | 4 | 4 | 11 |
LF | 19 | 18 | 9 | 46 |
Total | 174 | 120 | 60 | 354 |
Population | GY | HN | HR | LF | LS | WL1 | WL2 | XX | YD1 | YD2 | YJ |
---|---|---|---|---|---|---|---|---|---|---|---|
Na | 7.857 | 4.286 | 4.286 | 6.429 | 3.714 | 7.429 | 5.143 | 5.714 | 3.286 | 4.286 | 7.286 |
Na (Freq. ≥5%) | 4.857 | 4.286 | 3.143 | 3.714 | 3.714 | 4.286 | 4.000 | 3.571 | 3.286 | 4.286 | 4.571 |
Ne | 2.906 | 2.896 | 2.456 | 3.420 | 2.464 | 4.101 | 3.381 | 2.661 | 1.821 | 2.872 | 4.258 |
I | 1.386 | 1.086 | 1.026 | 1.337 | 1.002 | 1.533 | 1.263 | 1.138 | 0.722 | 1.140 | 1.585 |
No. Private Alleles | 0.714 | 0.429 | 0.286 | 0.429 | 0.143 | 1.286 | 0.571 | 0.571 | 0.286 | 0.000 | 1.000 |
No. LComm Alleles (≤25%) | 0.286 | 0.429 | 0.143 | 0.286 | 0.143 | 0.571 | 0.286 | 0.429 | 0.429 | 0.286 | 0.714 |
No. LComm Alleles (≤50%) | 1.857 | 1.286 | 0.714 | 1.571 | 1.143 | 2.000 | 1.429 | 2.000 | 0.714 | 1.286 | 2.000 |
He | 0.619 | 0.566 | 0.542 | 0.649 | 0.548 | 0.724 | 0.619 | 0.560 | 0.396 | 0.599 | 0.732 |
uHe | 0.627 | 0.580 | 0.552 | 0.656 | 0.574 | 0.729 | 0.632 | 0.565 | 0.408 | 0.619 | 0.744 |
Data Type | Sample Category | Source of Variation | df | SS | MS | Est. Var. | % |
---|---|---|---|---|---|---|---|
Original data | Geographic | Among Pops | 10 | 508.374 | 50.837 | 1.340 | 13% *** |
Within Pops | 343 | 3059.166 | 8.919 | 8.919 | 87% *** | ||
Total | 353 | 3567.540 | 10.258 | 100% | |||
Root tissue | Among Pops | 2 | 33.657 | 16.829 | 0.062 | 1% | |
Within Pops | 351 | 3533.882 | 10.068 | 10.068 | 99% *** | ||
Total | 353 | 3567.540 | 10.130 | 100% | |||
Clone-corrected | Geographic | Among Pops | 10 | 208.195 | 20.819 | 0.571 | 6% *** |
Within Pops | 205 | 2009.828 | 9.804 | 9.804 | 94% *** | ||
Total | 215 | 2218.023 | 10.375 | 100% | |||
Root tissue | Among Pops | 2 | 167.173 | 8.359 | 0.000 | 0% | |
Within Pops | 213 | 2050.851 | 30.779 | 10.629 | 100% *** | ||
Total | 215 | 2218.023 | 10.629 | 100% |
Populations | GY | HN | HR | LF | LS | WL1 | WL2 | XX | YD1 | YD2 | YJ |
---|---|---|---|---|---|---|---|---|---|---|---|
GY | 0.001 | 0.001 | 0.001 | 0.001 | 0.001 | 0.001 | 0.001 | 0.001 | 0.001 | 0.001 | |
HN | 0.135 | 0.001 | 0.001 | 0.001 | 0.001 | 0.001 | 0.001 | 0.001 | 0.001 | 0.001 | |
HR | 0.067 | 0.108 | 0.001 | 0.001 | 0.001 | 0.001 | 0.001 | 0.001 | 0.001 | 0.001 | |
LF | 0.112 | 0.137 | 0.157 | 0.001 | 0.001 | 0.001 | 0.001 | 0.001 | 0.001 | 0.001 | |
LS | 0.115 | 0.149 | 0.133 | 0.089 | 0.001 | 0.017 | 0.001 | 0.001 | 0.001 | 0.001 | |
WL1 | 0.066 | 0.098 | 0.104 | 0.068 | 0.078 | 0.001 | 0.001 | 0.001 | 0.001 | 0.001 | |
WL2 | 0.095 | 0.113 | 0.148 | 0.059 | 0.036 | 0.071 | 0.001 | 0.001 | 0.001 | 0.002 | |
XX | 0.201 | 0.157 | 0.185 | 0.120 | 0.141 | 0.146 | 0.183 | 0.001 | 0.001 | 0.001 | |
YD1 | 0.315 | 0.303 | 0.310 | 0.312 | 0.284 | 0.227 | 0.273 | 0.333 | 0.001 | 0.001 | |
YD2 | 0.058 | 0.139 | 0.111 | 0.090 | 0.095 | 0.079 | 0.098 | 0.207 | 0.313 | 0.001 | |
YJ | 0.072 | 0.087 | 0.118 | 0.044 | 0.075 | 0.035 | 0.031 | 0.143 | 0.215 | 0.059 |
Population | GY | HN | HR | LF | LS | WL1 | WL2 | XX | YD1 | YD2 | YJ |
---|---|---|---|---|---|---|---|---|---|---|---|
GY | 0.002 | 0.020 | 0.013 | 0.003 | 0.032 | 0.035 | 0.001 | 0.001 | 0.150 | 0.194 | |
HN | 0.057 | 0.019 | 0.001 | 0.002 | 0.001 | 0.001 | 0.005 | 0.001 | 0.001 | 0.001 | |
HR | 0.029 | 0.045 | 0.001 | 0.005 | 0.004 | 0.001 | 0.001 | 0.002 | 0.080 | 0.001 | |
LF | 0.019 | 0.081 | 0.070 | 0.007 | 0.004 | 0.006 | 0.001 | 0.001 | 0.002 | 0.010 | |
LS | 0.053 | 0.083 | 0.071 | 0.047 | 0.011 | 0.036 | 0.002 | 0.001 | 0.002 | 0.005 | |
WL1 | 0.012 | 0.050 | 0.032 | 0.023 | 0.036 | 0.004 | 0.001 | 0.001 | 0.003 | 0.051 | |
WL2 | 0.015 | 0.090 | 0.072 | 0.028 | 0.034 | 0.029 | 0.001 | 0.001 | 0.001 | 0.043 | |
XX | 0.057 | 0.035 | 0.070 | 0.044 | 0.057 | 0.049 | 0.090 | 0.001 | 0.001 | 0.001 | |
YD1 | 0.165 | 0.200 | 0.099 | 0.214 | 0.198 | 0.120 | 0.214 | 0.176 | 0.001 | 0.001 | |
YD2 | 0.010 | 0.079 | 0.028 | 0.046 | 0.072 | 0.037 | 0.079 | 0.076 | 0.203 | 0.009 | |
YJ | 0.005 | 0.076 | 0.052 | 0.019 | 0.053 | 0.010 | 0.016 | 0.047 | 0.152 | 0.035 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
He, Y.; Chen, J.; Tang, C.; Deng, Q.; Guo, L.; Cheng, Y.; Li, Z.; Wang, T.; Xu, J.; Gao, C. Genetic Diversity and Population Structure of Fusarium commune Causing Strawberry Root Rot in Southcentral China. Genes 2022, 13, 899. https://doi.org/10.3390/genes13050899
He Y, Chen J, Tang C, Deng Q, Guo L, Cheng Y, Li Z, Wang T, Xu J, Gao C. Genetic Diversity and Population Structure of Fusarium commune Causing Strawberry Root Rot in Southcentral China. Genes. 2022; 13(5):899. https://doi.org/10.3390/genes13050899
Chicago/Turabian StyleHe, Yunlu, Jia Chen, Chao Tang, Qiao Deng, Litao Guo, Yi Cheng, Zhimin Li, Tuhong Wang, Jianping Xu, and Chunsheng Gao. 2022. "Genetic Diversity and Population Structure of Fusarium commune Causing Strawberry Root Rot in Southcentral China" Genes 13, no. 5: 899. https://doi.org/10.3390/genes13050899
APA StyleHe, Y., Chen, J., Tang, C., Deng, Q., Guo, L., Cheng, Y., Li, Z., Wang, T., Xu, J., & Gao, C. (2022). Genetic Diversity and Population Structure of Fusarium commune Causing Strawberry Root Rot in Southcentral China. Genes, 13(5), 899. https://doi.org/10.3390/genes13050899