Effect of Zeolite Supplementation on Gene Expression in the Intestinal Mucosa in the Context of Immunosafety Support in Poultry
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals and Rearing Period
2.2. Growth Performance and Slaughter Yield
2.3. Sample Collection and RNA Isolation
2.4. Gene Panel Selection
2.5. Relative Gene Expression in Cecal Mucosa
3. Results
3.1. Growth Performance and Slaughter Yield
3.2. Gene Panel Selection
3.3. Gene Expression in Cecal Mucosa
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zhou, P.; Tan, Y.Q.; Zhang, L.; Zhou, Y.M.; Gao, F.; Zhou, G.H. Effects of Dietary Supplementation with the Combination of Zeolite and Attapulgite on Growth Performance, Nutrient Digestibility, Secretion of Digestive Enzymes and Intestinal Health in Broiler Chickens. Asian-Australas. J. Anim. Sci. 2014, 27, 1311. [Google Scholar] [CrossRef] [PubMed]
- Wlazło, Ł.; Nowakowicz-Dębek, B.; Kapica, J.; Kwiecień, M.; Pawlak, H. Removal of ammonia from poultry manure by aluminosilicates. J. Environ. Manag. 2016, 183, 722–725. [Google Scholar] [CrossRef] [PubMed]
- Dashtestani, F.; Ma’mani, L.; Jokar, F.; Maleki, M.; Eskandari Fard, M.; Hosseini Salekdeh, G. Zeolite-based nanocomposite as a smart pH-sensitive nanovehicle for release of xylanase as poultry feed supplement. Sci. Rep. 2021, 11, 21386. [Google Scholar] [CrossRef]
- Abd El-Hady, A.M. Effect of incorporating natural zeolite with or without phytase enzyme into broilers diets on blood constituents and carcass traits. Egypt. Poult. Sci. J. 2020, 40, 225–242. [Google Scholar] [CrossRef]
- Biesek, J.; Dunisławska, A.; Banaszak, M.; Siwek, M.; Adamski, M. The Impact of Hydrated Aluminosilicates Supplemented in Litter and Feed on Chicken Growth, Muscle Traits and Gene Expression in the Intestinal Mucosa. Animals 2021, 11, 2224. [Google Scholar] [CrossRef]
- Park, S.Y.; Byeon, D.S.; Kim, G.W.; Kim, H.Y. Carcass and retail meat cuts quality properties of broiler chickenmeat based on the slaughter age. J. Anim. Sci. Technol. 2021, 63, 180. [Google Scholar] [CrossRef]
- Wen, C.; Yan, W.; Zheng, J.; Ji, C.; Zhang, D.; Sun, C.; Yang, N. Feed efficiency measures and their relationships with production and meat quality traits in slower growing broilers. Poult. Sci. 2018, 97, 2356–2364. [Google Scholar] [CrossRef]
- Baéza, E.; Guillier, L.; Petracci, M. Review: Production factors affecting poultry carcass and meat quality attributes. Animal 2022, 16, 100331. [Google Scholar] [CrossRef]
- Sindiyo, E.; Maganga, R.; Thomas, K.M.; Benschop, J.; Swai, E.; Shirima, G.; Zadoks, R.N. Food Safety, Health Management, and Biosecurity Characteristics of Poultry Farms in Arusha City, Northern Tanzania, Along a Gradient of Intensification. East Afr. Health Res. J. 2018, 2, 168–180. [Google Scholar] [CrossRef] [Green Version]
- Haque, M.H.; Sarker, S.; Islam, M.S.; Islam, M.A.; Karim, M.R.; Kayesh, M.E.H.; Shiddiky, M.J.A.; Anwer, M.S. Sustainable Antibiotic-Free Broiler Meat Production: Current Trends, Challenges, and Possibilities in a Developing Country Perspective. Biology 2020, 9, 411. [Google Scholar] [CrossRef]
- Yadav, M.P.; Singh, R.K.; Malik, Y.S. Emerging and Transboundary Animal Viral Diseases: Perspectives and Preparedness. In Emerging and Transboundary Animal Viruses; Springer: Singapore, 2020; pp. 1–25. [Google Scholar]
- Naseem, S.; King, A.J. Ammonia production in poultry houses can affect health of humans, birds, and the environment—Techniques for its reduction during poultry production. Environ. Sci. Pollut. Res. 2018, 25, 15269–15293. [Google Scholar] [CrossRef] [PubMed]
- Rukambile, E.; Sintchenko, V.; Muscatello, G.; Kock, R.; Alders, R. Infection, colonization and shedding of Campylobacter and Salmonella in animals and their contribution to human disease: A review. Zoonoses Public Health 2019, 66, 562–578. [Google Scholar] [CrossRef] [PubMed]
- Bilal, R.M.; Hassan, F.; Farag, M.R.; Nasir, T.A.; Ragni, M.; Mahgoub, H.A.M.; Alagawany, M. Thermal stress and high stocking densities in poultry farms: Potential effects and mitigation strategies. J. Therm. Biol. 2021, 99, 102944. [Google Scholar] [CrossRef] [PubMed]
- Slawinska, A.; Dunislawska, A.; Plowiec, A.; Radomska, M.; Lachmanska, J.; Siwek, M.; Tavaniello, S.; Maiorano, G. Modulation of microbial communities and mucosal gene expression in chicken intestines after galactooligosaccharides delivery in ovo. PLoS ONE 2019, 14, e0212318. [Google Scholar] [CrossRef]
- Dunislawska, A.; Slawinska, A.; Stadnicka, K.; Bednarczyk, M.; Gulewicz, P.; Jozefiak, D.; Siwek, M. Synbiotics for Broiler Chickens—In Vitro Design and Evaluation of the Influence on Host and Selected Microbiota Populations following In Ovo Delivery. PLoS ONE 2017, 12, e0168587. [Google Scholar] [CrossRef] [Green Version]
- Sevane, N.; Bialade, F.; Velasco, S.; Rebolé, A.; Rodríguez, M.L.; Ortiz, L.T.; Cañón, J.; Dunner, S. Dietary inulin supplementation modifies significantly the liver transcriptomic profile of broiler chickens. PLoS ONE 2014, 9, e98942. [Google Scholar]
- Brisbin, J.T.; Gong, J.; Parvizi, P.; Sharif, S. Effects of lactobacilli on cytokine expression by chicken spleen and cecal tonsil cells. Clin. Vaccine Immunol. 2010, 17, 1337–1343. [Google Scholar] [CrossRef] [Green Version]
- Slawinska, A.; Siwek, M.Z.; Bednarczyk, M.F. Effects of synbiotics injected in ovo on regulation of immune-related gene expression in adult chickens. Am. J. Vet. Res. 2014, 75, 997–1003. [Google Scholar] [CrossRef]
- Slawinska, A.; Mendes, S.; Dunislawska, A.; Siwek, M.; Zampiga, M.; Sirri, F.; Meluzzi, A.; Tavaniello, S.; Maiorano, G. Avian model to mitigate gut-derived immune response and oxidative stress during heat. BioSystems 2019, 178, 10–15. [Google Scholar] [CrossRef]
- Chiang, H.I.; Berghman, L.R.; Zhou, H. Inhibition of NF-kB 1 (NF-kBp50) by RNA interference in chicken macrophage HD11 cell line challenged with Salmonella enteritidis. Genet. Mol. Biol. 2009, 32, 507–515. [Google Scholar] [CrossRef] [Green Version]
- Rothwell, L.; Young, J.R.; Zoorob, R.; Whittaker, C.A.; Hesketh, P.; Archer, A.; Smith, A.L.; Kaiser, P. Cloning and characterization of chicken IL-10 and its role in the immune response to Eimeria maxima. J. Immunol. 2004, 173, 2675–2682. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, N.; Wang, J.; Deng, Q.; Gu, K.; Wang, J. Detoxification of aflatoxin B1 by lactic acid bacteria and hydrated sodium calcium aluminosilicate in broiler chickens. Livest. Sci. 2018, 208, 28–32. [Google Scholar] [CrossRef]
- Hcini, E.; Ben Slima, A.; Kallel, I.; Zormati, S.; Traore, A.I.; Gdoura, R. Does supplemental zeolite (clinoptilolite) affect growth performance, meat texture, oxidative stress and production of polyunsaturated fatty acid of Turkey poults? Lipids Health Dis. 2018, 17, 177. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ouachem, D.; Kaboul, N.; Meredef, A.; Abdessemed, F.; Ahmed Gaid, Z. Effects of clay on performance, moisture of droppings and health status of poultry: An overview. World’s Poult. Sci. J. 2015, 71, 184–189. [Google Scholar] [CrossRef]
- Shariatmadari, F. The application of zeolite in poultry production. World’s Poult. Sci. J. 2008, 64, 76–84. [Google Scholar] [CrossRef]
- Gilani, A.; Kermanshahi, H.; Golian, A.; Seifi, S. Appraisal of the impact of aluminosilicate use on the health and performance of poultry. Turk. J. Vet. Anim. Sci. 2016, 40, 255–262. [Google Scholar] [CrossRef]
- Semenenko, M.; Kuzminova, E.; Grin, V.; Rogaleva, E.; Semenenko, K. Possibilities of Using Natural Aluminosilicates in the Development of Medicines at Hepatosis in Poultry. In E3S Web of Conferences; EDP Sciences: Les Ulis, France, 2020; Volume 175, p. 04002. [Google Scholar]
- Dvm, G.L. Poultry Diseases Influenced by Gastrointestinal Health: Traditional Treatments and Innovative Solutions; Nottingham University Press: Nottingham, UK, 2010. [Google Scholar]
- Tan, Z.; Luo, L.; Wang, X.; Wen, Q.; Zhou, L.; Wu, K. Characterization of the cecal microbiome composition of Wenchang chickens before and after fattening. PLoS ONE 2019, 14, e0225692. [Google Scholar] [CrossRef] [Green Version]
- Asare, P.T.; Greppi, A.; Pennacchia, A.; Brenig, K.; Geirnaert, A.; Schwab, C.; Stephan, R.; Lacroix, C. In vitro Modeling of Chicken Cecal Microbiota Ecology and Metabolism Using the PolyFermS Platform. Front. Microbiol. 2021, 12, 3791. [Google Scholar] [CrossRef]
- Kominsky, D.J.; Campbell, E.L.; Colgan, S.P. Metabolic Shifts in Immunity and Inflammation. J. Immunol. 2010, 184, 4062–4068. [Google Scholar] [CrossRef] [Green Version]
- Yu, K.; Choi, I.; Yun, C.H. Immunosecurity: Immunomodulants enhance immune responses in chickens. Anim. Biosci. 2021, 34, 321. [Google Scholar] [CrossRef]
- Santhakumar, D.; Rubbenstroth, D.; Martinez-Sobrido, L.; Munir, M. Avian interferons and their antiviral effectors. Front. Immunol. 2017, 8, 49. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Khosravi, A.; Mazmanian, S.K. Disruption of the gut microbiome as a risk factor for microbial infections. Curr. Opin. Microbiol. 2013, 16, 221–227. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ma, X.; Yan, W.; Zheng, H.; Du, Q.; Zhang, L.; Ban, Y.; Li, N.; Wei, F. Regulation of IL-10 and IL-12 production and function in macrophages and dendritic cells. F1000Research 2015, 4, 1465. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Susta, L.; Diel, D.G.; Courtney, S.; Cardenas-Garcia, S.; Sundick, R.S.; Miller, P.J.; Brown, C.C.; Afonso, C.L. Expression of chicken interleukin-2 by a highly virulent strain of Newcastle disease virus leads to decreased systemic viral load but does not significantly affect mortality in chickens. Virol. J. 2015, 12, 122. [Google Scholar] [CrossRef] [Green Version]
- He, H.; Genovese, K.J.; Kogut, M.H. Modulation of chicken macrophage effector function by T(H)1/T(H)2 cytokines. Cytokine 2011, 53, 363–369. [Google Scholar] [CrossRef]
- Aden, K.; Breuer, A.; Rehman, A.; Geese, H.; Tran, F.; Sommer, J.; Waetzig, G.H.; Reinheimer, T.M.; Schreiber, S.; Rose-John, S.; et al. Classic IL-6R signalling is dispensable for intestinal epithelial proliferation and repair. Oncogenesis 2016, 5, e270. [Google Scholar] [CrossRef] [Green Version]
- Bergmann, S.; von Buenau, B.; Vidal-y-Sy, S.; Haftek, M.; Wladykowski, E.; Houdek, P.; Lezius, S.; Duplan, H.; Bäsler, K.; Dähnhardt-Pfeiffer, S.; et al. Claudin-1 decrease impacts epidermal barrier function in atopic dermatitis lesions dose-dependently. Sci. Rep. 2020, 10, 2024. [Google Scholar] [CrossRef]
- Vancamelbeke, M.; Vermeire, S. The intestinal barrier: A fundamental role in health and disease. Expert Rev. Gastroenterol. Hepatol. 2017, 11, 821–834. [Google Scholar] [CrossRef]
- Groschwitz, K.R.; Hogan, S.P. Intestinal barrier function: Molecular regulation and disease pathogenesis. J. Allergy Clin. Immunol. 2009, 124, 3–20. [Google Scholar] [CrossRef] [Green Version]
- Xu, D.; Lu, W. Defensins: A Double-Edged Sword in Host Immunity. Front. Immunol. 2020, 11, 764. [Google Scholar] [CrossRef]
- Shen, J.; Xiao, Z. Cathelicidin in Gastrointestinal Disorders. In Antimicrobial Peptides in Gastrointestinal Diseases; Academic Press: Cambridge, MA, USA, 2018; pp. 61–76. [Google Scholar]




| Components (%) | Zeolite |
|---|---|
| SiO2 (silicon dioxide) | 71.30 |
| Al2O3 (aluminium oxide) | 13.10 |
| CaO (calcium oxide) | 5.20 |
| K2O (potassium oxide) | 3.40 |
| Fe2O3 (iron (III) oxide) | 1.90 |
| MgO (magnesium oxide) | 1.20 |
| Na2O (sodium oxide) | 1.30 |
| TiO2 (titanium oxide) | 0.30 |
| Si/Al (silicon/aluminium) | 5.40 |
| Clinoptilolite | 84.00 |
| Cristobalit | 8.00 |
| Mica clay | 4.00 |
| Plagioclases | 3.50 |
| Rutile | 0.20 |
| Data based on the supplier declaration |
| Gene | Name | Primer Sequences | Ref. |
|---|---|---|---|
| ACTB | Actin β | F: CACAGATCATGTTTGAGACCTT R: CATCACAATACCAGTGGTACG | Adapted from Ref. [17] |
| G6PDH | Glucose-6-phosphate dehydrogenase | F: CGGGAACCAAATGCACTTCGT R: GGCTGCCGTAGAGGTATGGGA | Adapted from Ref. [17] |
| IFNG | Interferon γ | F: ACACTGACAAGTCAAAGCCGC R: AGTCGTTCATCGGGAGCTTG | Adapted from Ref. [18] |
| IFNB | Interferon β | F: ACCAGATCCAGCATTACATCCA R: CGCGTGCCTTGGTTTACG | Adapted from Ref. [19] |
| IL1B | Interleukin 1 β | F: GGAGGTTTTTGAGCCCGTC R: TCGAAGATGTCGAAGGACTG | Adapted from Ref. [15] |
| IL2 | Interleukin 2 | F: GCTTATGGAGCATCTCTATCATCA R: GGTGCACTCCTGGGTCTC | Adapted from Ref. [20] |
| IL4 | Interleukin 4 | F: GCTCTCAGTGCCGCTGATG R: GGAAACCTCTCCCTGGATGTC | Adapted from Ref. [19] |
| IL6 | Interleukin 6 | F: AGGACGAGATGTGCAAGAAGTTC R: TTGGGCAGGTTGAGGTTGTT | Adapted from Ref. [21] |
| IL8 (IL8L2) | Interleukin 8 | F: AAGGATGGAAGAGAGGTGTGCTT R: GCTGAGCCTTGGCCATAAGT | Adapted from Ref. [19] |
| IL10 | Interleukin 10 | F: CATGCTGCTGGGCCTGAA R: CGTCTCCTTGATCTGCTTGATG | Adapted from Ref. [22] |
| IL12 (IL12B) | Interleukin 12 | F: TTGCCGAAGAGCACCAGCCG R: CGGTGTGCTCCAGGTCTTGGG | Adapted from Ref. [18] |
| IL17 | Interleukin 17 | F: CCGTCTTCTGCTGAGAGGAGTG R: ACCGTTGTTCCGTCCCATCAC | Adapted from Ref. [20] |
| TNFAIP6 | Tumor necrosis factor-inducible gene 6 protein | F: CTGGCTGTCCCTGTGTGATT R: TCAGGTGCTATTGCTGCGAG | Adapted from Ref. [5] |
| NCF1C | Neutrophil Cytosolic Factor 1C | F: CTGTGGATGGTGTCACCGAA R: TGCCATTCTCACAGCCCTAC | Adapted from Ref. [5] |
| AvBD1 (GAL2) | Avian β-defensin 1 | F: AAACCATTGTCAGCCCTGTG R: TTCCTAGAGCCTGGGAGGAT | Adapted from Ref. [15] |
| CATHL2 (CAMP) | Cathelicidin | F: AGGAGAATGGGGTCATCAGG R: GGATCTTTCTCAGGAAGCGG | Adapted from Ref. [15] |
| MUC6 | Mucin 6 | F: TTCAACATTCAGTTCCGCCG R: TTGATGACACCGACACTCCT | Adapted from Ref. [15] |
| CLDN1 | Claudin 1 | F: TCTTCATCATTGCAGGTCTGTC R: AACGGGTGTGAAAGGGTCAT | Adapted from Ref. [15] |
| TJAP1 | Tight junction-associated protein 1 | F: AGGAAGCGATGAATCCCTGTT R: TCACTCAGATGCCAGATCCAA | Adapted from Ref. [15] |
| Item 1 | Group 2 | SEM 3 | p-Value | |
|---|---|---|---|---|
| C | Z | |||
| BW (g) | ||||
| 1-day old chicks | 46.69 | 46.64 | 0.28 | 0.933 |
| 14 day | 499.65 | 499.67 | 3.25 | 0.998 |
| 22 day | 1598.25 b | 1656.05 a | 12.73 | 0.019 |
| 42 day | 2822.65 b | 3088.16 a | 38.92 | <0.001 |
| BWG (g) | ||||
| 1–13 days | 452.96 | 448.16 | 3.51 | 0.509 |
| 14–21 days | 1098.60 b | 1143.92 a | 8.94 | 0.007 |
| 22–42 days | 1224.40 b | 1432.34 a | 33.47 | <0.001 |
| 1–42 days | 2775.96 b | 3024.42 a | 37.25 | <0.001 |
| FI (g; per bird) | ||||
| 1–13 days | 530.00 | 490.00 | 10.98 | 0.067 |
| 14–21 days | 1900.00 | 1965.00 | 58.16 | 0.590 |
| 22–42 days | 1615.00 | 1585.00 | 75.50 | 0.266 |
| 1–42 days | 5126.54 | 5556.40 | 202.06 | 0.300 |
| FCR (kg/kg) | ||||
| 1–13 days | 1.17 | 1.09 | 0.02 | 0.075 |
| 14–21 days | 1.73 | 1.72 | 0.06 | 0.888 |
| 22–42 days | 1.32 a | 1.11 b | 0.06 | 0.010 |
| 1–42 days | 1.85 | 1.84 | 0.07 | 0.932 |
| Item (%) | Group 1 | SEM 2 | p-Value | |
|---|---|---|---|---|
| C | Z | |||
| Slaughter yield | 78.03 | 78.74 | 0.34 | 0.300 |
| Breast muscles | 32.73 | 30.83 | 0.52 | 0.068 |
| Leg muscles | 19.75 | 21.61 | 0.48 | 0.053 |
| Skin with subcutaneous fat | 8.29 | 8.93 | 0.26 | 0.231 |
| Abdominal fat | 0.96 | 1.27 | 0.10 | 0.124 |
| Term ID | Term Description | Observed Gene Count | Background Gene Count | Strength | False Discovery Rate |
|---|---|---|---|---|---|
| GO:0006952 | Defence response | 11 | 588 | 1.23 | 2.44 × 10−8 |
| GO:0051707 | Response to another organism | 10 | 583 | 1.19 | 4.42 × 10−7 |
| GO:0002376 | Immune system process | 11 | 1140 | 0.94 | 4.56 × 10−6 |
| GO:0006955 | Immune response | 9 | 605 | 1.13 | 5.51 × 10−6 |
| GO:0098542 | Defence response to another organism | 8 | 423 | 1.24 | 7.62 × 10−6 |
| GO:0009617 | Response to bacterium | 6 | 266 | 1.31 | 2.70 × 10−4 |
| GO:0001775 | Cell activation | 6 | 322 | 1.23 | 0.00068 |
| GO:0006959 | Humoral immune response | 4 | 95 | 1.58 | 0.0025 |
| GO:0034097 | Response to cytokine | 6 | 420 | 1.12 | 0.0027 |
| GO:0045321 | Leukocyte activation | 5 | 271 | 1.23 | 0.0056 |
| GO:0045918 | Negative regulation of cytolysis | 2 | 4 | 2.66 | 0.01 |
| GO:0050727 | Regulation of inflammatory response | 4 | 150 | 1.39 | 0.0105 |
| GO:0070673 | Response to interleukin-18 | 2 | 5 | 2.56 | 0.0117 |
| GO:0071345 | Cellular response to cytokine stimulus | 5 | 378 | 1.08 | 0.0204 |
| GO:0080134 | Regulation of response to stress | 6 | 667 | 0.91 | 0.024 |
| GO:0002274 | Myeloid leukocyte activation | 3 | 68 | 1.6 | 0.0255 |
| GO:2000377 | Regulation of reactive oxygen species metabolic process | 3 | 72 | 1.58 | 0.0288 |
| GO:0006954 | Inflammatory response | 4 | 219 | 1.22 | 0.0335 |
| GO:0070887 | Cellular response to chemical stimulus | 8 | 1504 | 0.69 | 0.0335 |
| GO:0050832 | Defence response to fungus | 2 | 12 | 2.18 | 0.037 |
| GO:0006953 | Acute-phase response | 2 | 13 | 2.15 | 0.0411 |
| GO:0042221 | Response to chemical | 9 | 2126 | 0.59 | 0.0499 |
| GO:0048584 | Positive regulation of response to stimulus | 7 | 1186 | 0.73 | 0.0499 |
| GO:0061844 | Antimicrobial humoral immune response mediated by antimicrobial peptide | 2 | 15 | 2.09 | 0.0499 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dunislawska, A.; Biesek, J.; Banaszak, M.; Siwek, M.; Adamski, M. Effect of Zeolite Supplementation on Gene Expression in the Intestinal Mucosa in the Context of Immunosafety Support in Poultry. Genes 2022, 13, 732. https://doi.org/10.3390/genes13050732
Dunislawska A, Biesek J, Banaszak M, Siwek M, Adamski M. Effect of Zeolite Supplementation on Gene Expression in the Intestinal Mucosa in the Context of Immunosafety Support in Poultry. Genes. 2022; 13(5):732. https://doi.org/10.3390/genes13050732
Chicago/Turabian StyleDunislawska, Aleksandra, Jakub Biesek, Mirosław Banaszak, Maria Siwek, and Marek Adamski. 2022. "Effect of Zeolite Supplementation on Gene Expression in the Intestinal Mucosa in the Context of Immunosafety Support in Poultry" Genes 13, no. 5: 732. https://doi.org/10.3390/genes13050732
APA StyleDunislawska, A., Biesek, J., Banaszak, M., Siwek, M., & Adamski, M. (2022). Effect of Zeolite Supplementation on Gene Expression in the Intestinal Mucosa in the Context of Immunosafety Support in Poultry. Genes, 13(5), 732. https://doi.org/10.3390/genes13050732

