Transcriptomic Analysis of Root Restriction Effects on the Primary Metabolites during Grape Berry Development and Ripening
Abstract
:1. Introduction
2. Materials and Methods
3. Results
3.1. Differential Gene Expression in the Primary Metabolic Pathways
3.2. Compounds in the Primary Metabolic Pathways
3.3. Validation of Different Gene Expression Using qRT-PCR
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Niculcea, M.; Martinez-Lapuente, L.; Guadalupe, Z.; Sanchez-Diaz, M.; Morales, F.; Ayestaran, B.; Antolin, M.C. Effects of Water-Deficit Irrigation on Hormonal Content and Nitrogen Compounds in Developing Berries of Vitis vinifera L. cv. Tempranillo. J. Plant Growth Regul. 2013, 32, 551–563. [Google Scholar] [CrossRef]
- Deluc, L.G.; Grimplet, J.; Wheatley, M.D.; Tillett, R.L.; Quilici, D.R.; Osborne, C.; Schooley, D.A.; Schlauch, K.A.; Cushman, J.C.; Cramer, G.R. Transcriptomic and metabolite analyses of Cabernet Sauvignon grape berry development. BMC Genom. 2007, 8, 429. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zoccatelli, G.; Zenoni, S.; Savoi, S.; Dal, S.S.; Tononi, P.; Zandona, V.; Dal, C.A.; Guantieri, V.; Pezzotti, M.; Tornielli, G.B. Skin pectin metabolism during the postharvest dehydration of berries from three distinct grapevine cultivars. Aust. J. Grape Wine Res. 2013, 19, 171–179. [Google Scholar] [CrossRef]
- Dai, Z.W.; Leon, C.; Feil, R.; Lunn, J.E.; Delrot, S.; Gomes, E. Metabolic profiling reveals coordinated switches in primary carbohydrate metabolism in grape berry (Vitis vinifera L.), a non-climacteric fleshy fruit. J. Exp. Bot. 2013, 64, 1345–1355. [Google Scholar] [CrossRef] [PubMed]
- Deluc, L.G.; Quilici, D.R.; Decendit, A.; Grimplet, J.; Wheatley, M.D.; Schlauch, K.A.; Merillon, J.M.; Cushman, J.C.; Cramer, G.R. Water deficit alters differentially metabolic pathways affecting important flavor and quality traits in grape berries of Cabernet Sauvignon and Chardonnay. BMC Genom. 2009, 10, 212. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Castellarin, S.D.; Pfeiffer, A.; Sivilotti, P.; Degan, M.; Peterlunger, E.; Di, G.G. Transcriptional regulation of anthocyanin biosynthesis in ripening fruits of grapevine under seasonal water deficit. Plant Cell Environ. 2007, 30, 1381–1399. [Google Scholar] [CrossRef] [Green Version]
- Berdeja, M.; Nicolas, P.; Kappel, C.; Dai, Z.W.; Hilbert, G.; Peccoux, A.; Lafontaine, M.; Ollat, N.; Gomes, E.; Delrot, S. Water limitation and rootstock genotype interact to alter grape berry metabolism through transcriptome reprogramming. Hortic. Res. 2015, 2, 15012. [Google Scholar] [CrossRef] [Green Version]
- Kyraleou, M.; Koundouras, S.; Kallithraka, S.; Nikolaos, T.; Niki, P.; Yorgos, K. Effect of irrigation regime on anthocyanin content and antioxidant activity of Vitis vinifera L. cv. Syrah grapes under semiarid conditions. J. Sci. Food Agric. 2015, 96, 988–996. [Google Scholar] [CrossRef]
- Lee, H.; Patrick, R.R.; Makihiko, I.; Anderson, V.; Shepard, M.; Rebecca, S.; Gary, T.; Lu, Z.; Marquet, P.A.; Hijmans, R.J. Climate change, wine, and conservation. Proc. Natl. Acad. Sci. USA 2013, 110, 6907–6912. [Google Scholar]
- Cramer, G.R.; Ergul, A.; Grimplet, J.; Tillett, R.L.; Tattersall, E.A.R.; Bohlman, M.C.; Vincent, D.; Sonderegger, J.; Evans, J.; Osborne, C.; et al. Water and salinity stress in grapevines: Early and late changes in transcript and metabolite profiles. Funct. Integr. Genom. 2007, 7, 111–134. [Google Scholar] [CrossRef]
- Berli, F.J.; Fanzone, M.; Piccoli, P.; Bottini, R. Solar UV-B and ABA Are Involved in Phenol Metabolism of Vitis vinifera L. Increasing Biosynthesis of Berry Skin Polyphenols. J. Agric. Food Chem. 2011, 59, 4874–4884. [Google Scholar] [CrossRef] [PubMed]
- Carbonell-Bejerano, P.; Maria, E.S.; Torres-Perez, R.; Royo, C.; Lijavetzky, D.; Bravo, G.; Aguirreolea, J.; Sanchez-Diaz, M.; Antolin, M.C.; Martinez-Zapater, J.M. Thermotolerance Responses in Ripening Berries of Vitis vinifera L. cv Muscat Hamburg. Plant Cell Physiol. 2013, 54, 1200–1216. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, C.; Jia, H.; Wu, W.M.; Wang, X.C.; Fang, J.G.; Wang, C. Functional conservation analysis and expression modes of grape anthocyanin synthesis genes responsive to low temperature stress. Gene 2015, 574, 168–177. [Google Scholar] [CrossRef]
- Mierziak, J.; Kostyn, K.; Kulma, A. Flavonoids as Important Molecules of Plant Interactions with the Environment. Molecules 2014, 19, 16240–16265. [Google Scholar] [CrossRef]
- Shinomiya, R.; Fujishima, H.; Muramoto, K.; Shiraishi, M. Impact of temperature and sunlight on the skin coloration of the ‘Kyoho’ table grape. Sci. Hortic. 2015, 193, 77–83. [Google Scholar] [CrossRef]
- Alessandra, F.; Claudio, L. Abiotic stress effects on grapevine (Vitis vinifera L.): Focus on abscisic acid-mediated consequences on secondary metabolism and berry quality. Environ. Exp. Bot. 2014, 103, 138–147. [Google Scholar]
- Yang, T.Y.; Zhu, L.N.; Wang, S.P.; Gu, W.J.; Huang, D.F.; Xu, W.P.; Jiang, A.L.; Li, S.C. Nitrate uptake kinetics of grapevine under root restriction. Sci. Hortic. 2007, 111, 358–364. [Google Scholar] [CrossRef]
- Xie, Z.S.; Li, B.; Forney, C.F.; Xu, W.P.; Wang, S.P. Changes in sugar content and relative enzyme activity in grape berry in response to root restriction. Sci. Hortic. 2009, 123, 39–45. [Google Scholar] [CrossRef]
- Wang, B.; He, J.J.; Bai, Y.; Yu, X.M.; Li, J.F.; Zhang, C.X.; Xu, W.P.; Bai, X.J.; Cao, X.J.; Wang, S.P. Root restriction affected anthocyanin composition and up-regulated the transcription of their biosynthetic genes during berry development in ‘Summer Black’ grape. Acta Physiol. Plant. 2013, 35, 2205–2217. [Google Scholar] [CrossRef]
- Wang, B.; He, J.J.; Duan, C.Q.; Yu, X.M.; Zhu, L.N.; Xie, Z.S.; Zhang, C.X.; Xu, W.P.; Wang, S.P. Root restriction affects anthocyanin accumulation and composition in berry skin of ‘Kyoho’ grape (Vitis vinifera L. x Vitis labrusca L.) during ripening. Sci. Hortic. 2012, 137, 20–28. [Google Scholar] [CrossRef]
- Broeckling, C.D.; Huhman, D.V.; Farag, M.A.; Smith, J.T.; May, G.D.; Mendes, P.; Dixon, R.A.; Sumner, L.W. Metabolic profiling of Medicago truncatula cell cultures reveals the effects of biotic and abiotic elicitors on metabolism. J. Exp. Bot. 2005, 56, 323–336. [Google Scholar] [CrossRef] [Green Version]
- Li, M.Y.; Bahn, S.C.; Guo, L.; Musgrave, W.; Berg, H.; Welti, R.; Wang, X.M. Patatin-Related Phospholipase pPLAIII beta-Induced Changes in Lipid Metabolism Alter Cellulose Content and Cell Elongation in Arabidopsis. Plant Cell 2011, 23, 1107–1123. [Google Scholar] [CrossRef] [Green Version]
- Dietz, J.H.; Rouse, A.H. Evaluation of a Rapid Method for Estimating Pectic Substances in Citrus Juices. Food Technol. 1952, 6, S11. [Google Scholar]
- Shan, L.L.; Li, X.; Wang, P.; Cai, C.; Zhang, B.; Sun, C.D.; Zhang, W.S.; Xu, C.J.; Ferguson, I.; Chen, K.S. Characterization of cDNAs associated with lignification and their expression profiles in loquat fruit with different lignin accumulation. Planta 2008, 227, 1243–1254. [Google Scholar] [CrossRef]
- Jaillon, O.; Aury, J.M.; Noel, B.; Policriti, A.; Clepet, C.; Casagrande, A.; Choisne, N.; Aubourg, S.; Vitulo, N.; Jubin, C.; et al. The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla. Nature 2007, 449, 463–467. [Google Scholar]
- Trapnell, C.; Pachter, L.; Salzberg, S.L. TopHat: Discovering splice junctions with RNA-Seq. Bioinformatics 2009, 25, 1105–1111. [Google Scholar] [CrossRef]
- Wang, L.G.; Wang, S.Q.; Li, W. RSeQC: Quality control of RNA-seq experiments. Bioinformatics 2012, 28, 2184–2185. [Google Scholar] [CrossRef] [Green Version]
- Li, B.; Dewey, C.N. RSEM: Accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinform. 2011, 12, 323. [Google Scholar] [CrossRef] [Green Version]
- Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26, 139–140. [Google Scholar] [CrossRef] [Green Version]
- Tang, H.B.; Wang, X.Y.; Bowers, J.E.; Ming, R.; Alam, M.; Paterson, A.H. Unraveling ancient hexaploidy through multiply-aligned angiosperm gene maps. Genome Res. 2008, 18, 1944–1954. [Google Scholar] [CrossRef] [Green Version]
- Leng, F.; Cao, J.P.; Ge, Z.W.; Wang, Y.; Zhao, C.N.; Wang, S.P.; Li, X.; Zhang, Y.L.; Sun, C.D. Transcriptomic Analysis of Root Restriction Effects on Phenolic Metabolites during Grape Berry Development and Ripening. J. Agric. Food Chem. 2020, 68, 9090–9099. [Google Scholar] [CrossRef]
- Leng, F.; Lin, Q.; Wu, D.; Wang, S.P.; Wang, D.L.; Sun, C.D. Comparative Transcriptomic Analysis of Grape Berry in Response to Root Restriction during Developmental Stages. Molecules 2016, 21, 1431. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Agudelo-Romero, P.; Erban, A.; Sousa, L.; Pais, M.S.; Kopka, J.; Fortes, A.M. Search for Transcriptional and Metabolic Markers of Grape Pre-Ripening and Ripening and Insights into Specific Aroma Development in Three Portuguese Cultivars. PLoS ONE 2013, 8, e60422. [Google Scholar]
- Sweetman, C.; Deluc, L.G.; Cramer, G.R.; Ford, C.M.; Soole, K.L. Regulation of malate metabolism in grape berry and other developing fruits. Phytochemistry 2009, 70, 1329–1344. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Sun, X.L.; Weiszmann, J.; Weckwerth, W. System-Level and Granger Network Analysis of Integrated Proteomic and Metabolomic Dynamics Identifies Key Points of Grape Berry Development at the Interface of Primary and Secondary Metabolism. Front. Plant Sci. 2017, 8, 1066. [Google Scholar] [CrossRef] [Green Version]
- Zhu, S.M.; Liang, Y.L.; An, X.J.; Kong, F.C.; Gao, D.K.; Yin, H.F. Changes in sugar content and related enzyme activities in table grape (Vitis vinifera L.) in response to foliar selenium fertilizer. J. Sci. Food Agric. 2017, 97, 4094–4102. [Google Scholar] [CrossRef]
- Dai, Z.W.; Ollat, N.; Gomes, E.; Decroocq, S.; Tandonnet, J.P.; Bordenave, L.; Pieri, P.; Hilbert, G.; Kappel, C.; van Leeuwen, C.; et al. Ecophysiological, Genetic, and Molecular Causes of Variation in Grape Berry Weight and Composition: A Review. Am. J. Enol. Vitic. 2011, 62, 413–425. [Google Scholar] [CrossRef] [Green Version]
- Xie, Z.S.; Forney, C.F.; Xu, W.P.; Wang, S.P. Effects of Root Restriction on Ultrastructure of Phloem Tissues in Grape Berry. Hortscience 2009, 44, 1334–1339. [Google Scholar] [CrossRef] [Green Version]
- Wang, D.D.; Yeats, T.H.; Uluisik, S.; Rose, J.K.C.; Seymour, G.B. Fruit Softening: Revisiting the Role of Pectin. Trends Plant Sci. 2018, 23, 302–310. [Google Scholar] [CrossRef]
- Fasoli, M.; Dell’Anna, R.; Dal, S.S.; Balestrini, R.; Sanson, A.; Pezzotti, M.; Monti, F.; Zenoni, S. Pectins, Hemicelluloses and Celluloses Show Specific Dynamics in the Internal and External Surfaces of Grape Berry Skin During Ripening. Plant Cell Physiol. 2016, 57, 1332–1349. [Google Scholar] [CrossRef] [Green Version]
- Zogaj, X.; Nimtz, M.; Rohde, M.; Bokranz, W.; Romling, U. The multicellular morphotypes of Salmonella typhimurium and Escherichia coli produce cellulose as the second component of the extracellular matrix. Mol. Microbiol. 2001, 39, 1452–1463. [Google Scholar] [CrossRef] [PubMed]
- Molhoj, M.; Verma, R.; Reiter, W.D. The biosynthesis of D-galacturonate in plants. Functional cloning and characterization of a membrane-anchored UDP-D-Glucuronate 4-epimerase from Arabidopsis. Plant Physiol. 2004, 135, 1221–1230. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Somkuwar, R.G.; Bahetwar, A.; Khan, I.; Satisha, J.; Ramteke, S.D.; Itroutwar, P.; Bhongale, A.; Oulkar, D. Changes in growth, photosynthetic activities, biochemical parameters and amino acid profile of Thompson Seedless grapes (Vitis vinifera L.). J. Environ. Biol. 2014, 35, 1157–1163. [Google Scholar] [PubMed]
- Fortes, A.M.; Agudelo-Romero, P.; Silva, M.S.; Ali, K.; Sousa, L.; Maltese, F.; Choi, Y.H.; Grimplet, J.; Martinez-Zapater, J.M.; Verpoorte, R.; et al. Transcript and metabolite analysis in Trincadeira cultivar reveals novel information regarding the dynamics of grape ripening. BMC Plant Biol. 2011, 11, 149. [Google Scholar] [CrossRef] [Green Version]
- Martinez-Esteso, M.J.; Selles-Marchart, S.; Lijavetzky, D.; Pedreno, M.A.; Bru-Martinez, R. A DIGE-based quantitative proteomic analysis of grape berry flesh development and ripening reveals key events in sugar and organic acid metabolism. J. Exp. Bot. 2011, 62, 2521–2569. [Google Scholar] [CrossRef] [Green Version]
- Grimplet, J.; Wheatley, M.D.; Jouira, H.B.; Deluc, L.G.; Cramer, G.R.; Cushman, J.C. Proteomic and selected metabolite analysis of grape berry tissues under well-watered and water-deficit stress conditions. Proteomics 2009, 9, 2503–2528. [Google Scholar] [CrossRef] [Green Version]
- Munoz-Robredo, P.; Robledo, P.; Manriquez, D.; Molina, R.; Defilippi, B.G. Characterization of Sugars and Organic Acids in Commercial Varieties of Table Grapes. Chil. J. Agric. Res. 2011, 71, 452–458. [Google Scholar] [CrossRef] [Green Version]
- Zaharah, S.S.; Razi, I.M. Growth, stomata aperture, biochemical changes and branch anatomy in mango (Mangifera indica) cv. Chokanan in response to root restriction and water stress. Sci. Hortic. 2009, 123, 58–67. [Google Scholar] [CrossRef]





| Gene | Forward Primer (5’ to 3’) | Reverse Primer (5’ to 3’) |
|---|---|---|
| GAPDH | TGGAGCTGAATTTGTTGT | GTGGAGTTCTGGCTTGTA |
| VIT_01s0010g02460 | ACTACCAACTGTCTTGCTCCTCTG | AGTAAGGTCCACGACTGAAACATC |
| VIT_06s0004g02620 | CCTCAACGCCAACATTAG | GCCAAACCAGACCCTACT |
| VIT_07s0005g00750 | GATGTAGGGCGGCAGAAACT | GAACAGCAATAGCCACAAAAGG |
| VIT_13s0019g04460 | ACTGCTGTTGGGTCTGGC | GAGGGCGTATCGGTCTTG |
| VIT_13s0074g00390 | AAACACCCTCCCACCTAC | TATCCTTCGCCCTACTCC |
| Gene ID | Log2FC | Functional Annotation | ||||
|---|---|---|---|---|---|---|
| S1RR/ S1Control | S2RR/ S2Control | S3RR/ S3Control | S4RR/ S4Control | S5RR/ S5Control | ||
| VIT_01s0011g00690 | 1.44 | - | - | - | - | UDP-glucose 6-dehydrogenase |
| VIT_01s0010g02460 | 1.50 | 1.95 | - | - | - | glyceraldehyde 3-phosphate dehydrogenase |
| VIT_07s0005g00750 | 1.69 | - | - | - | - | sucrose synthase |
| VIT_11s0016g00470 | −1.33 | - | - | - | - | sucrose synthase |
| VIT_18s0089g00410 | - | - | - | 1.55 | - | sucrose-phosphate synthase |
| VIT_00s0391g00070 | - | - | - | 1.30 | - | 3-deoxy-7-phosphoheptulonate synthase |
| VIT_18s0001g08420 | 1.93 | - | −1.60 | - | - | branched-chain amino acid aminotransferase |
| VIT_02s0025g02170 | −1.17 | - | - | - | - | alpha-trehalase |
| VIT_12s0059g02150 | −1.03 | - | - | - | - | aconitate hydratase |
| VIT_16s0022g01770 | 1.30 | - | - | - | - | enolase |
| VIT_06s0004g06830 | 1.32 | 2.25 | - | - | - | asparagine synthase |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Leng, F.; Wang, Y.; Cao, J.; Wang, S.; Wu, D.; Jiang, L.; Li, X.; Bao, J.; Karim, N.; Sun, C. Transcriptomic Analysis of Root Restriction Effects on the Primary Metabolites during Grape Berry Development and Ripening. Genes 2022, 13, 281. https://doi.org/10.3390/genes13020281
Leng F, Wang Y, Cao J, Wang S, Wu D, Jiang L, Li X, Bao J, Karim N, Sun C. Transcriptomic Analysis of Root Restriction Effects on the Primary Metabolites during Grape Berry Development and Ripening. Genes. 2022; 13(2):281. https://doi.org/10.3390/genes13020281
Chicago/Turabian StyleLeng, Feng, Yue Wang, Jinping Cao, Shiping Wang, Di Wu, Ling Jiang, Xian Li, Jinsong Bao, Naymul Karim, and Chongde Sun. 2022. "Transcriptomic Analysis of Root Restriction Effects on the Primary Metabolites during Grape Berry Development and Ripening" Genes 13, no. 2: 281. https://doi.org/10.3390/genes13020281
APA StyleLeng, F., Wang, Y., Cao, J., Wang, S., Wu, D., Jiang, L., Li, X., Bao, J., Karim, N., & Sun, C. (2022). Transcriptomic Analysis of Root Restriction Effects on the Primary Metabolites during Grape Berry Development and Ripening. Genes, 13(2), 281. https://doi.org/10.3390/genes13020281

