Quantitative Real-Time Analysis of Differentially Expressed Genes in Peripheral Blood Samples of Hypertension Patients
Abstract
1. Introduction
2. Results
2.1. Normalization, Meta-Analysis, and Cross-Validation of Gene Expression Data
2.2. Gene Ontology and Pathway Enrichment Analyses
2.3. Transcription and Motif Analysis
2.4. Mutation Analysis
2.5. Protein Product Co-Expression Network Analysis
2.6. Clinical Description of Samples
2.7. Validation of qRT-PCR Assay and Expression Profiling
3. Discussion
4. Materials and Methods
4.1. Normalization and Differential Expression Analysis
4.2. Meta-Analysis
4.3. K-Fold Cross-Validation
4.4. Gene Ontology (GO) and Pathway Enrichment Analyses
4.5. Examination of Transcription and Regulatory Motifs of DEGs
4.6. Mutation Analysis
4.7. Protein Product Co-Expression Network Analysis
4.8. Ethical Approval, Collection of Blood Samples, and Clinical Description
4.8.1. Inclusion Criteria
4.8.2. Exclusion Criteria
4.9. RNA Extraction and Quantification
4.10. cDNA Synthesis
4.11. Quantitative Real-Time PCR Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Grell, A.-S.; Frederiksen, S.D.; Edvinsson, L.; Ansar, S. Cerebrovascular gene expression in spontaneously hypertensive rats. PLoS ONE 2017, 12, e0184233. [Google Scholar] [CrossRef] [Scilit]
- Mills, K.T.; Stefanescu, A.; He, J. The global epidemiology of hypertension. Nat. Rev. Nephrol. 2020, 16, 223–237. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ishtiaq, S.; Ilyas, U.; Naz, S.; Altaf, R.; Afzaal, H.; Muhammad, S.A.; uz Zaman, S.; Imran, M.; Ali, F.; Sohail, F. Assessment of the risk factors of hypertension among adult & elderly group in twin cities of Pakistan. J. Pak. Med. Assoc. 2017, 67, 1664–1669. [Google Scholar]
- Redina, O.E.; Markel, A.L. Stress, genes, and hypertension. Contribution of the ISIAH rat strain study. Curr. Hypertens. Rep. 2018, 20, 66. [Google Scholar] [CrossRef] [Scilit]
- Chen, J.; Wang, S.; Tsai, C.; Lin, C. Selection of differentially expressed genes in microarray data analysis. Pharm. J. 2007, 7, 212–220. [Google Scholar] [CrossRef] [Scilit]
- Simon, R.; Wang, S. Use of genomic signatures in therapeutics development in oncology and other diseases. Pharm. J. 2006, 6, 166–173. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Puddu, P.; Puddu, G.M.; Cravero, E.; Ferrari, E.; Muscari, A. The genetic basis of essential hypertension. Acta Cardiol. 2007, 62, 281–293. [Google Scholar] [CrossRef] [Scilit]
- Weder, A.B. Genetics and hypertension. J. Clin. Hypertens. 2007, 9, 217–223. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bauer, M.; Wilkens, H.; Langer, F.; Schneider, S.O.; Lausberg, H.; Schäfers, H.-J. Selective upregulation of endothelin B receptor gene expression in severe pulmonary hypertension. Circulation 2002, 105, 1034–1036. [Google Scholar] [CrossRef] [Scilit]
- Yagil, C.; Hubner, N.; Monti, J.; Schulz, H.; Sapojnikov, M.; Luft, F.C.; Ganten, D.; Yagil, Y. Identification of hypertension-related genes through an integrated genomic-transcriptomic approach. Circ. Res. 2005, 96, 617–625. [Google Scholar] [CrossRef] [Scilit]
- Yang, Y.-L.; Mo, Y.-P.; He, Y.-S.; Yang, F.; Xu, Y.; Li, C.-C.; Wang, J.; Reng, H.-M.; Long, L. Correlation between renin-angiotensin system gene polymorphisms and essential hypertension in the Chinese Yi ethnic group. J. Renin-Angiotensin-Aldosterone Syst. 2015, 16, 975–981. [Google Scholar] [CrossRef] [Scilit]
- Han, C.; Han, X.-K.; Liu, F.-C.; Huang, J.-F. Ethnic differences in the association between angiotensin-converting enzyme gene insertion/deletion polymorphism and peripheral vascular disease: A meta-analysis. Chronic Dis. Transl. Med. 2017, 3, 230–241. [Google Scholar] [CrossRef] [Scilit]
- Charoen, P.; Eu-Ahsunthornwattana, J.; Thongmung, N.; Jose, P.A.; Sritara, P.; Vathesatogkit, P.; Kitiyakara, C. Contribution of four polymorphisms in renin-angiotensin-aldosterone-related genes to hypertension in a Thai population. Int. J. Hypertens. 2019, 2019, 4861081. [Google Scholar] [CrossRef] [Scilit]
- Bustin, S. INVITED REVIEW Quantification of mRNA using real-time reverse transcription PCR (RT-PCR): Trends and problems. J. Mol. Endocrinol. 2002, 29, 23–39. [Google Scholar] [CrossRef] [Scilit]
- Bustin, S.A.; Nolan, T. Pitfalls of quantitative real-time reverse-transcription polymerase chain reaction. J. Biomol. Tech. JBT 2004, 15, 155. [Google Scholar] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Ibrahim, M.M.; Damasceno, A. Hypertension in developing countries. Lancet 2012, 380, 611–619. [Google Scholar] [CrossRef] [Scilit]
- Kaplan, N.M.; Opie, L.H. Controversies in hypertension. Lancet 2006, 367, 168–176. [Google Scholar] [CrossRef] [Scilit]
- Emilsson, V.; Thorleifsson, G.; Zhang, B.; Leonardson, A.S.; Zink, F.; Zhu, J.; Carlson, S.; Helgason, A.; Walters, G.B.; Gunnarsdottir, S. Genetics of gene expression and its effect on disease. Nature 2008, 452, 423–428. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alanni, R.; Hou, J.; Azzawi, H.; Xiang, Y. A novel gene selection algorithm for cancer classification using microarray datasets. BMC Med. Genom. 2019, 12, 10. [Google Scholar] [CrossRef] [Scilit]
- Li, Q.-F.; Dai, A.-G. Hypoxia-inducible factor-1 alpha regulates the role of vascular endothelial growth factor on pulmonary arteries of rats with hypoxia-induced pulmonary hypertension. Chin. Med. J. 2004, 117, 1023–1028. [Google Scholar] [PubMed]
- Ikeda, S.; Ushio-Fukai, M.; Zuo, L.; Tojo, T.; Dikalov, S.; Patrushev, N.A.; Alexander, R.W. Novel role of ARF6 in vascular endothelial growth factor–induced signaling and angiogenesis. Circ. Res. 2005, 96, 467–475. [Google Scholar] [CrossRef] [Scilit]
- Kohan, D.E. Endothelin, hypertension, and chronic kidney disease: New insights. Curr. Opin. Nephrol. Hypertens. 2010, 19, 134. [Google Scholar] [CrossRef] [Scilit]
- Iyinikkel, J.; Murray, F. GPCRs in pulmonary arterial hypertension: Tipping the balance. Br. J. Pharmacol. 2018, 175, 3063–3079. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Carnevale, D.; Lembo, G. PI3Kγ in hypertension: A novel therapeutic target controlling vascular myogenic tone and target organ damage. Cardiovasc. Res. 2012, 95, 403–408. [Google Scholar] [CrossRef] [Scilit]
- Gao, Y.; Chen, G.; Tian, H.; Lin, L.; Lu, J.; Weng, J.; Jia, W.; Ji, L.; Xiao, J.; Zhou, Z. Prevalence of hypertension in China: A cross-sectional study. PLoS ONE 2013, 8, e65938. [Google Scholar] [CrossRef] [Scilit]
- Dhungana, R.R.; Pandey, A.R.; Bista, B.; Joshi, S.; Devkota, S. Prevalence and associated factors of hypertension: A community-based cross-sectional study in municipalities of Kathmandu, Nepal. Int. J. Hypertens. 2016, 2016, 1656938. [Google Scholar] [CrossRef] [Scilit]
- Tabrizi, J.S.; Sadeghi-Bazargani, H.; Farahbakhsh, M.; Nikniaz, L.; Nikniaz, Z. Prevalence and associated factors of prehypertension and hypertension in Iranian population: The Lifestyle Promotion Project (LPP). PLoS ONE 2016, 11, e0165264. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Singh, S.; Shankar, R.; Singh, G.P. Prevalence and associated risk factors of hypertension: A cross-sectional study in urban Varanasi. Int. J. Hypertens. 2017, 2017, 5491838. [Google Scholar] [CrossRef] [Scilit]
- Ahmed, A.; Rahman, M.; Hasan, R.; Shima, S.A.; Faruquee, M.; Islam, T.; Haque, S.E. Hypertension and associated risk factors in some selected rural areas of Bangladesh. Int. J. Res. Med. Sci. 2014, 2, 925. [Google Scholar] [CrossRef] [Scilit]
- Adnan, M.; Morton, G.; Hadi, S. Analysis of rpoS and bolA gene expression under various stress-induced environments in planktonic and biofilm phase using 2−ΔΔCT method. Mol. Cell. Biochem. 2011, 357, 275–282. [Google Scholar] [CrossRef] [Scilit]
- Kvandova, M.; Barancik, M.; Balis, P.; Puzserova, A.; Majzunova, M.; Dovinova, I. The peroxisome proliferator-activated receptor gamma agonist pioglitazone improves nitric oxide availability, renin-angiotensin system and aberrant redox regulation in the kidney of pre-hypertensive rats. J. Physiol. Pharmacol. 2018, 69, 10–26402. [Google Scholar]
- Schönauer, R.; Els-Heindl, S.; Beck-Sickinger, A.G. Adrenomedullin–new perspectives of a potent peptide hormone. J. Pept. Sci. 2017, 23, 472–485. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hu, W.; Zhou, P.H.; Zhang, X.B.; Xu, C.G.; Wang, W. Plasma concentrations of adrenomedullin and natriuretic peptides in patients with essential hypertension. Exp. Ther. Med. 2015, 9, 1901–1908. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wong, H.K.; Cheung, T.T.; Cheung, B.M. Adrenomedullin and cardiovascular diseases. JRSM Cardiovasc. Dis. 2012, 1, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Murakami, S.; Kimura, H.; Kangawa, K.; Nagaya, N. Physiological significance and therapeutic potential of adrenomedullin in pulmonary hypertension. Cardiovasc. Haematol. Disord.-Drug Targets (Former. Curr. Drug Targets-Cardiovasc. Hematol. Disord.) 2006, 6, 123–130. [Google Scholar] [CrossRef] [Scilit]
- Yim, J.; Cho, H.; Rabkin, S.W. Gene expression and gene associations during the development of heart failure with preserved ejection fraction in the Dahl salt sensitive model of hypertension. Clin. Exp. Hypertens. 2018, 40, 155–166. [Google Scholar] [CrossRef] [Scilit]
- Aryal, B.; Price, N.L.; Suarez, Y.; Fernández-Hernando, C. ANGPTL4 in metabolic and cardiovascular disease. Trends Mol. Med. 2019, 25, 723–734. [Google Scholar] [CrossRef] [Scilit]
- Sillén, A.; Brohede, J.; Lilius, L.; Forsell, C.; Andrade, J.; Odeberg, J.; Ebise, H.; Winblad, B.; Graff, C. Linkage to 20p13 including the ANGPT4 gene in families with mixed alzheimer’s disease and vascular dementia. J. Hum. Genet. 2010, 55, 649–655. [Google Scholar] [CrossRef] [Scilit]
- Abu-Farha, M.; Cherian, P.; Qaddoumi, M.G.; AlKhairi, I.; Sriraman, D.; Alanbaei, M.; Abubaker, J. Increased plasma and adipose tissue levels of ANGPTL8/Betatrophin and ANGPTL4 in people with hypertension. Lipids Health Dis. 2018, 17, 35. [Google Scholar] [CrossRef] [Scilit]
- Yang, J.; Li, X.; Xu, D. Research progress on the involvement of ANGPTL4 and loss-of-function variants in lipid metabolism and coronary heart disease: Is the “Prime Time” of ANGPTL4-targeted therapy for coronary heart disease approaching? Cardiovasc. Drugs Ther. 2021, 35, 467–477. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Grootaert, C.; Van de Wiele, T.; Verstraete, W.; Bracke, M.; Vanhoecke, B. Angiopoietin-like protein 4: Health effects, modulating agents and structure–function relationships. Expert Rev. Proteom. 2012, 9, 181–199. [Google Scholar] [CrossRef] [Scilit]
- Li, H.; Ge, C.; Zhao, F.; Yan, M.; Hu, C.; Jia, D.; Tian, H.; Zhu, M.; Chen, T.; Jiang, G. Hypoxia-inducible factor 1 alpha–activated angiopoietin-like protein 4 contributes to tumor metastasis via vascular cell adhesion molecule-1/integrin β1 signaling in human hepatocellular carcinoma. Hepatology 2011, 54, 910–919. [Google Scholar] [CrossRef] [Scilit]
- Nakaya, K.; Takiguchi, S.; Ikewaki, K. A new frontier for reverse cholesterol transport: The impact of intestinal microbiota on reverse cholesterol transport. Arterioscler. Thromb. Vasc. Biol. 2017, 37, 385–386. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ruixing, Y.; Jinzhen, W.; Weixiong, L.; Yuming, C.; Dezhai, Y.; Shangling, P. The environmental and genetic evidence for the association of hyperlipidemia and hypertension. J. Hypertens. 2009, 27, 251–258. [Google Scholar] [CrossRef] [Scilit]
- Zhu, X.; Zhang, X.; Cong, X.; Zhu, L.; Ning, Z. ANGPTL4 attenuates ang II-induced atrial fibrillation and fibrosis in mice via PPAR pathway. Cardiol. Res. Pract. 2021, 2021, 9935310. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, R.; Tomkovicz, V.R.; Butler, P.L.; Ochoa, L.A.; Peterson, Z.J.; Snyder, P.M. Ubiquitin-specific peptidase 8 (USP8) regulates endosomal trafficking of the epithelial Na+ channel. J. Biol. Chem. 2013, 288, 5389–5397. [Google Scholar] [CrossRef] [Scilit]
- Qiu, H.; Kong, J.; Cheng, Y.; Li, G. The expression of ubiquitin-specific peptidase 8 and its prognostic role in patients with breast cancer. J. Cell. Biochem. 2018, 119, 10051–10058. [Google Scholar] [CrossRef] [Scilit]
- Jian, F.; Cao, Y.; Bian, L.; Sun, Q. USP8: A novel therapeutic target for Cushing’s disease. Endocrine 2015, 50, 292–296. [Google Scholar] [CrossRef] [Scilit]
- Cicala, M.V.; Mantero, F. Hypertension in Cushing’s syndrome: From pathogenesis to treatment. Neuroendocrinology 2010, 92, 44–49. [Google Scholar] [CrossRef] [Scilit]
- Carvalho, L.J.D.M.; Moreira, A.D.S.; Daniel-Ribeiro, C.T.; Martins, Y.C. Vascular dysfunction as a target for adjuvant therapy in cerebral malaria. Mem. Do Inst. Oswaldo Cruz 2014, 109, 577–588. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schiffrin, E.L. Vascular endothelin in hypertension. Vasc. Pharmacol. 2005, 43, 19–29. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rautureau, Y.; Schiffrin, E.L. Endothelin in hypertension: An update. Curr. Opin. Nephrol. Hypertens. 2012, 21, 128–136. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schiffrin, E.L. Does endothelin-1 raise or lower blood pressure in humans? Nephron 2018, 139, 47–50. [Google Scholar] [CrossRef] [Scilit]
- Wiltshire, S.; Powell, B.L.; Jennens, M.; McCaskie, P.A.; Carter, K.W.; Palmer, L.J.; Thompson, P.L.; McQuillan, B.M.; Hung, J.; Beilby, J.P. Investigating the association between K198N coding polymorphism in EDN1 and hypertension, lipoprotein levels, the metabolic syndrome and cardiovascular disease. Hum. Genet. 2008, 123, 307–313. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ueno, S.; Ohki, R.; Hashimoto, T.; Takizawa, T.; Takeuchi, K.; Yamashita, Y.; Ota, J.; Choi, Y.L.; Wada, T.; Koinuma, K. DNA microarray analysis of in vivo progression mechanism of heart failure. Biochem. Biophys. Res. Commun. 2003, 307, 771–777. [Google Scholar] [CrossRef] [Scilit]
- Lian, Y.-H.; Fang, M.-X.; Chen, L.-G. Constructing protein-protein interaction network of hypertension with blood stasis syndrome via digital gene expression sequencing and database mining. J. Integr. Med. 2014, 12, 476–482. [Google Scholar] [CrossRef] [Scilit]
- Hou, S.; Chen, D.; Liu, J.; Chen, S.; Zhang, X.; Zhang, Y.; Li, M.; Pan, W.; Zhou, D.; Guan, L. Profiling and molecular mechanism analysis of long non-coding RNAs and mRNAs in pulmonary arterial hypertension rat models. Front. Pharmacol. 2021, 12, 709816. [Google Scholar] [CrossRef] [Scilit]
- Kubo, M. Diurnal rhythmicity programs of microbiota and transcriptional oscillation of circadian regulator, NFIL3. Front. Immunol. 2020, 11, 552188. [Google Scholar] [CrossRef] [Scilit]
- Simeone, S.M.; Li, M.W.; Paradis, P.; Schiffrin, E.L. Vascular gene expression in mice overexpressing human endothelin-1 targeted to the endothelium. Physiol. Genom. 2011, 43, 148–160. [Google Scholar] [CrossRef] [Scilit]
- Baos, S.; Calzada, D.; Cremades, L.; Sastre, J.; Quiralte, J.; Florido, F.; Lahoz, C.; Cárdaba, B. Biomarkers associated with disease severity in allergic and nonallergic asthma. Mol. Immunol. 2017, 82, 34–45. [Google Scholar] [CrossRef] [Scilit]
- Zhang, M.; Han, Z.; Yan, Z.; Cui, Q.; Jiang, Y.; Gao, M.; Yu, W.; Hua, J.; Huang, H. Genetic variants of the class A scavenger receptor gene are associated with essential hypertension in Chinese. J. Thorac. Dis. 2015, 7, 1891. [Google Scholar] [PubMed]
- Cagnin, S.; Biscuola, M.; Patuzzo, C.; Trabetti, E.; Pasquali, A.; Laveder, P.; Faggian, G.; Iafrancesco, M.; Mazzucco, A.; Pignatti, P.F. Reconstruction and functional analysis of altered molecular pathways in human atherosclerotic arteries. BMC Genom. 2009, 10, 13. [Google Scholar] [CrossRef] [Scilit]
- Kitami, Y.; Fukuoka, T.; Hiwada, K.; Inagami, T. A high level of CCAAT-enhancer binding protein-δ expression is a major determinant for markedly elevated differential gene expression of the platelet-derived growth factor-α receptor in vascular smooth muscle cells of genetically hypertensive rats. Circ. Res. 1999, 84, 64–73. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, F.; Demura, M.; Cheng, Y.; Zhu, A.; Karashima, S.; Yoneda, T.; Demura, Y.; Maeda, Y.; Namiki, M.; Ono, K. Dynamic CCAAT/enhancer binding protein–associated changes of DNA methylation in the angiotensinogen gene. Hypertension 2014, 63, 281–288. [Google Scholar] [CrossRef] [Scilit]
- Balamurugan, K.; Sterneck, E. The many faces of C/EBPδ and their relevance for inflammation and cancer. Int. J. Biol. Sci. 2013, 9, 917. [Google Scholar] [CrossRef] [Scilit]
- Sá, A.C.C.; Webb, A.; Gong, Y.; McDonough, C.W.; Datta, S.; Langaee, T.Y.; Turner, S.T.; Beitelshees, A.L.; Chapman, A.B.; Boerwinkle, E. Whole transcriptome sequencing analyses reveal molecular markers of blood pressure response to thiazide diuretics. Sci. Rep. 2017, 7, 16068. [Google Scholar] [CrossRef] [Scilit]
- Troyanskaya, O.; Cantor, M.; Sherlock, G.; Brown, P.; Hastie, T.; Tibshirani, R.; Botstein, D.; Altman, R.B. Missing value estimation methods for DNA microarrays. Bioinformatics 2001, 17, 520–525. [Google Scholar] [CrossRef] [Scilit]
- Bolstad, B.M.; Irizarry, R.A.; Åstrand, M.; Speed, T.P. A comparison of normalization methods for high density oligonucleotide array data based on variance and bias. Bioinformatics 2003, 19, 185–193. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, Z.; Irizarry, R.A.; Gentleman, R.; Martinez-Murillo, F.; Spencer, F. A model-based background adjustment for oligonucleotide expression arrays. J. Am. Stat. Assoc. 2004, 99, 909–917. [Google Scholar] [CrossRef] [Scilit]
- Fujita, A.; Sato, J.R.; de Oliveira Rodrigues, L.; Ferreira, C.E.; Sogayar, M.C. Evaluating different methods of microarray data normalization. BMC Bioinform. 2006, 7, 469. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Obenchain, V.; Lawrence, M.; Carey, V.; Gogarten, S.; Shannon, P.; Morgan, M. VariantAnnotation: A Bioconductor package for exploration and annotation of genetic variants. Bioinformatics 2014, 30, 2076–2078. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Affymetrix, I. Affymetrix Microarray Suite User Guide; Santa Clara, CA, USA, 2000; pp. 295–316. [Google Scholar]
- Manual, A. Affymetrix Mircoarray Suite User Guide Version 5.0; Santa Clara, CA, USA, 2001. [Google Scholar]
- Tusher, V.G.; Tibshirani, R.; Chu, G. Significance analysis of microarrays applied to the ionizing radiation response. Proc. Natl. Acad. Sci. USA 2001, 98, 5116–5121. [Google Scholar] [CrossRef] [Scilit]
- Benjamini, Y.; Hochberg, Y. Controlling the false discovery rate: A practical and powerful approach to multiple testing. J. R. Stat. Soc. Ser. B 1995, 57, 289–300. [Google Scholar] [CrossRef] [Scilit]
- Jin, Y.; Da, W. RETRACTED ARTICLE: Screening of key genes in gastric cancer with DNA microarray analysis. Europ. J. Med. Res. 2013, 18, 37. [Google Scholar] [CrossRef] [Scilit]
- Matlock, M.K.; Holehouse, A.S.; Naegle, K.M. ProteomeScout: A repository and analysis resource for post-translational modifications and proteins. Nucleic Acids Res. 2015, 43, D521–D530. [Google Scholar] [CrossRef] [Scilit]
- Chini, V.; Foka, A.; Dimitracopoulos, G.; Spiliopoulou, I. Absolute and relative real-time PCR in the quantification of tst gene expression among methicillin-resistant Staphylococcus aureus: Evaluation by two mathematical models. Lett. Appl. Microbiol. 2007, 45, 479–484. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Likhite, N.; Warawdekar, U.M. A unique method for isolation and solubilization of proteins after extraction of RNA from tumor tissue using trizol. J. Biomol. Tech. JBT 2011, 22, 37. [Google Scholar]
- Reimand, J.; Arak, T.; Adler, P.; Kolberg, L.; Reisberg, S.; Peterson, H.; Vilo, J. g: Profiler—A web server for functional interpretation of gene lists (2016 update). Nucleic Acids Res. 2016, 44, W83–W89. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Chen, G.; Yan, Y.; Fan, Q. CASC15 promotes epithelial to mesenchymal transition and facilitates malignancy of hepatocellular carcinoma cells by increasing TWIST1 gene expression via miR-33a-5p sponging. Eur. J. Pharmacol. 2019, 860, 172589. [Google Scholar] [CrossRef] [Scilit]
- Kutmon, M.; van Iersel, M.P.; Bohler, A.; Kelder, T.; Nunes, N.; Pico, A.R.; Evelo, C.T. PathVisio 3: An extendable pathway analysis toolbox. PLoS Comput. Biol. 2015, 11, e1004085. [Google Scholar] [CrossRef] [Scilit]
- Pavesi, G.; Mereghetti, P.; Mauri, G.; Pesole, G. Weeder Web: Discovery of transcription factor binding sites in a set of sequences from co-regulated genes. Nucleic Acids Res. 2004, 32, W199–W203. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Krassowski, M.; Paczkowska, M.; Cullion, K.; Huang, T.; Dzneladze, I.; Ouellette, B.F.F.; Yamada, J.T.; Fradet-Turcotte, A.; Reimand, J. ActiveDriverDB: Human disease mutations and genome variation in post-translational modification sites of proteins. Nucleic Acids Res. 2018, 46, D901–D910. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Obesity, P. Managing the Global Epidemic; World Health Organization (WHO): Geneva, Switzerland, 1998. [Google Scholar]
- Korkor, M.T.; Meng, F.B.; Xing, S.Y.; Zhang, M.C.; Guo, J.R.; Zhu, X.X.; Yang, P. Microarray analysis of differential gene expression profile in peripheral blood cells of patients with human essential hypertension. Int. J. Med. Sci. 2011, 8, 168. [Google Scholar] [CrossRef] [Scilit]
- Tao, Z.; Shen, M.; Zheng, Y.; Mao, X.; Chen, Z.; Yin, Y.; Yu, K.; Weng, Z.; Xie, H.; Li, C. PCA3 gene expression in prostate cancer tissue in a Chinese population: Quantification by real-time FQ-RT-PCR based on exon 3 of PCA3. Exp. Mol. Pathol. 2010, 89, 58–62. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.; Spandidos, A.; Wang, H.; Seed, B. PrimerBank: A PCR primer database for quantitative gene expression analysis, 2012 update. Nucleic Acids Res. 2012, 40, D1144–D1149. [Google Scholar] [CrossRef] [Scilit]
- Watson, J.D. The Polymerase Chain Reaction; Springer Science & Business Media: Berlin/Heidelberg, Germany, 2012. [Google Scholar]
- Hamasuna, R.; Osada, Y.; Jensen, J.S. Antibiotic susceptibility testing of Mycoplasma genitalium by TaqMan 5′ nuclease real-time PCR. Antimicrob. Agents Chemother. 2005, 49, 4993–4998. [Google Scholar] [CrossRef] [Scilit]
- Kubista, M.; Andrade, J.M.; Bengtsson, M.; Forootan, A.; Jonák, J.; Lind, K.; Sindelka, R.; Sjöback, R.; Sjögreen, B.; Strömbom, L. The real-time polymerase chain reaction. Mol. Asp. Med. 2006, 27, 95–125. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wilhelm, J.; Pingoud, A. Real-time polymerase chain reaction. Chembiochem 2003, 4, 1120–1128. [Google Scholar] [CrossRef] [Scilit]
- Hu, N.; Qian, L.; Hu, Y.; Shou, J.-Z.; Wang, C.; Giffen, C.; Wang, Q.-H.; Wang, Y.; Goldstein, A.M.; Emmert-Buck, M. Quantitative real-time RT-PCR validation of differential mRNA expression of SPARC, FADD, Fascin, COL7A1, CK4, TGM3, ECM1, PPL and EVPL in esophageal squamous cell carcinoma. BMC Cancer 2006, 6, 33. [Google Scholar] [CrossRef] [Scilit]
- Mane, V.P.; Heuer, M.A.; Hillyer, P.; Navarro, M.B.; Rabin, R.L. Systematic method for determining an ideal housekeeping gene for real-time PCR analysis. J. Biomol. Tech. JBT 2008, 19, 342. [Google Scholar] [PubMed]
- Yuan, J.S.; Reed, A.; Chen, F.; Stewart, C.N. Statistical analysis of real-time PCR data. BMC Bioinform. 2006, 7, 85. [Google Scholar] [CrossRef] [Scilit]
- Muhammad, S.A.; Fatima, N.; Wu, X.; Yang, X.F.; Chen, J.Y. MicroRNA expression profiling of human respiratory epithelium affected by invasive Candida infection. PLoS ONE 2015, 10, e0136454. [Google Scholar]
- Babicki, S.; Arndt, D.; Marcu, A.; Liang, Y.; Grant, J.R.; Maciejewski, A.; Wishart, D.S. Heatmapper: Web-enabled heat mapping for all. Nucleic Acids Res. 2016, 44, W147–W153. [Google Scholar] [CrossRef] [Scilit] [PubMed]








| Probe ID | Gene Symbol | Uniport ID | Protein Name |
|---|---|---|---|
| 203973_s_at | CEBPD | CEBPD_HUMAN | CCAAT/enhancer-binding protein delta (CEBPD) |
| 222802_at | EDN1 | EDN1_HUMAN | Endothelin 1(EDN1) |
| 203574_at | NFIL3 | NFIL3_HUMAN | Nuclear factor, interleukin-3-regulated (NFIL3) |
| 221009_s_at | ANGPTL4 | ANGL4_HUMAN | Angiopoietin-related protein 4 (ANGPTL4) |
| 202912_at | ADM | ADML_HUMAN | Adrenomedullin (ADM) |
| 208423_s_at | MSR1 | MSRE_HUMAN | Macrophage scavenger receptor 1(MSR1) |
| 202745_at | USP8 | H0YM17_HUMAN | Ubiquitin-specific peptidase 8(USP8) |
| Estimate | Std. Error | t. Value | Pr (>|t|) | |
|---|---|---|---|---|
| (Intercept) | 0.000116 | 0.000312 | 3.99 | <1.00 × 10−11 *** |
| x1 | 0.040024 | 0.001702 | 19.018 | <1.00 × 10−10 *** |
| x2 | −0.01042 | 0.001105 | −4.017 | <1.96 × 10−9 *** |
| x3 | 0.120113 | 0.003201 | 27.015 | <1.00 × 10−10 *** |
| x4 | 0.210420 | 0.001412 | 20.200 | <1.00 × 10−12 *** |
| x5 | 0.026013 | 0.002140 | 29.003 | <1.00 × 10−13 *** |
| x6 | 0.231420 | 0.003263 | 25.012 | <1.00 × 10−11 *** |
| x7 | −0.01601 | 0.001561 | −27.112 | <1.00 × 10−9 *** |
| x8 | 0.001412 | 0.002211 | 19.115 | <1.00 × 10−11 *** |
| x9 | 0.102122 | 0.003602 | 61.0716 | <1.00 × 10−13 *** |
| x10 | 0.010010 | 0.000511 | 4.001 | <1.00 × 10−11 *** |
| x11 | 0.030821 | 0.001403 | 21.003 | <1.00 × 10−10 *** |
| x12 | −0.01109 | 0.002014 | −2.014 | 0.0078 * |
| x13 | −0.14522 | 0.002919 | −49.023 | <1.00 × 10−8 *** |
| x14 | 0.010051 | 0.001240 | 1.312 | 5.28 × 10−9 *** |
| x15 | −0.017581 | 0.001200 | −18.102 | <1.00 × 10−10 *** |
| Pathway | Description | Count | Strength | False Discovery Rate |
|---|---|---|---|---|
| hsa04710 | Circadian rhythm | 6 of 30 | 2.02 | 3.75 × 10−9 |
| hsa04979 | Cholesterol metabolism | 6 of 48 | 1.82 | 2.43 × 10−8 |
| hsa03320 | PPAR signaling pathway | 4 of 72 | 1.47 | 0.00021 |
| hsa04270 | Vascular smooth muscle contraction | 5 of 119 | 1.35 | 7.85 × 10−5 |
| hsa04926 | Relaxin signaling pathway | 3 of 130 | 1.09 | 0.0200 |
| hsa04020 | Calcium signaling pathway | 3 of 179 | 0.95 | 0.0412 |
| hsa04144 | Endocytosis | 4 of 242 | 0.94 | 0.0157 |
| hsa04080 | Neuroactive ligand receptor interaction | 4 of 272 | 0.89 | 0.0200 |
| Reactome pathways | ||||
| Pathway | Description | Count | Strength | False discovery rate |
| hsa400253 | Circadian clock | 3 of 8 | 2.6 | 4.55 × 10−6 |
| hsa1368108 | BMAL1: activates circadian gene expression | 3 of 11 | 2.16 | 6.66 × 10−6 |
| hsa1227986 | Signaling by ERBB2 | 3 of 22 | 1.86 | 3.11 × 10−5 |
| hsa162582 | Signal transduction | 15 of 1358 | 0.77 | 8.60 × 10−8 |
| Annotated keywords (UniProt) | ||||
| Keywords | Description | Count | Strength | False discovery rate |
| KW-0839 | Vasoconstriction | 4 of 5 | 2.63 | 3.59 × 10−8 |
| KW-0162 | Chylomicron | 5 of 9 | 2.47 | 3.83 × 10−9 |
| KW-0380 | Hyperlipidemia | 2 of 4 | 2.42 | 0.00037 |
| KW-0850 | VLDL | 4 of 10 | 2.33 | 1.92 × 10−7 |
| KW-0427 | LDL | 3 of 9 | 2.25 | 1.44 × 10−5 |
| KW-0367 | Hirschsprung disease | 3 of 10 | 2.2 | 1.70 × 10−5 |
| KW-0897 | Waardenburg syndrome | 2 of 7 | 2.18 | 0.00078 |
| KW-0345 | HDL | 2 of 16 | 1.82 | 0.0028 |
| KW-0730 | Sialic acid | 2 of 20 | 1.72 | 0.0038 |
| KW-0027 | Amidation | 4 of 44 | 1.68 | 1.76 × 10−5 |
| KW-0090 | Biological rhythms | 7 of 138 | 1.43 | 1.92 × 10−7 |
| KW-0372 | Hormones | 4 of 87 | 1.39 | 0.00021 |
| KW-0445 | Lipid transport | 4 of 110 | 1.28 | 0.00041 |
| KW-0358 | Heparin binding | 3 of 87 | 1.26 | 0.0033 |
| KW-0442 | Lipid degradation | 3 of 102 | 1.19 | 0.0047 |
| KW-0165 | cleavage on pair of basic residues | 7 of 277 | 1.13 | 1.05 × 10−5 |
| KW-0443 | Lipid metabolism | 6 of 447 | 0.85 | 0.0011 |
| KW-0964 | Secreted | 6 of 1814 | 0.67 | 8.00 × 10−7 |
| KW-0675 | Receptor | 11 of 1423 | 0.61 | 0.00034 |
| Variables | Cases (n = 50) | Control (n = 50) |
|---|---|---|
| Age group | ||
| 18–65 | 50 | 50 |
| Gender | ||
| Male | 28 | 28 |
| Female | 22 | 22 |
| BMI (kg/m2) | ||
| Normal | 6 | 28 |
| Overweight | 22 | 16 |
| Obese | 22 | 6 |
| Mean blood pressure | ||
| Systolic BP (mean ± SD) | 152.2 ± 6.02 | 125.7 ± 7.42 |
| Diastolic BP mean ± SD) | 94.9 ± 4.23 | 82.8 ± 3.65 |
| S. No. | Dataset Accession | AffyIDs | Total Samples | Size of Arrays | Tissues | Conditions |
|---|---|---|---|---|---|---|
| 1 | GSE6489 | 54675 | 6 | 1164 × 1164 | Endothelial cells | Hypertensive vs. normatensive |
| 2 | GSE6573 | 54675 | 6 | 1164 × 1164 | Adipose tissue | Hypertensive vs. normatensive |
| 3 | GSE10767 | 54675 | 7 | 1164 × 1164 | Endothelial Cell | Hypertensive vs. normatensive |
| 4 | GSE17814 | 54675 | 18 | 1164 × 1164 | Endothelial cells | Hypertensive vs. normatensive |
| 5 | GSE19136 | 54675 | 12 | 1164 × 1164 | lLft mammary artery | Hypertensive vs. normatensive |
| 6 | GSE22255 | 54675 | 40 | 1164 × 1164 | Blood cells | Hypertensive vs. normatensive |
| 7 | GSE22356 | 54675 | 38 | 1164 × 1164 | Blood cells | Hypertensive vs. normatensive |
| 8 | GSE24752 | 54675 | 6 | 1164 × 1164 | Blood cells | Hypertensive vs. normatensive |
| 9 | GSE37455 | 54675 | 41 | 1164 × 1164 | Kidney | Hypertensive vs. normatensive |
| 10 | GSE38783 | 54675 | 24 | 1164 × 1164 | Endothelial cell | Hypertensive vs. normatensive |
| 11 | GSE28345 | 32321 | 8 | 1050 × 1050 | Kidney | Hypertensive vs. normatensive |
| 12 | GSE71994 | 32321 | 40 | 1050 × 1050 | Blood cells | Hypertensive vs. normatensive |
| 13 | GSE87493 | 32321 | 32 | 1050 × 1050 | Blood cells | Hypertensive vs. normatensive |
| 14 | GSE113439 | 32321 | 26 | 1050 × 1050 | Lung tissue | Hypertensive vs. normatensive |
| 15 | GSE124114 | 32321 | 18 | 1050 × 1050 | Endothelial Cell | Hypertensive vs. normatensive |
| 16 | GSE3356 | 22283 | 9 | 712 × 712 | Smooth muscle | Hypertensive vs. normatensive |
| 17 | GSE11341 | 22283 | 12 | 712 × 712 | Endothelial cells | Hypertensive vs. normatensive |
| 18 | GSE28360 | 32321 | 14 | 1050 × 1050 | Kidney | Hypertensive vs. normatensive |
| 19 | GSE42955 | 32321 | 29 | 1050 × 1050 | Heart | Hypertensive vs. normatensive |
| 20 | GSE67492 | 32321 | 6 | 1050 × 1050 | Heart | Hypertensive vs. normatensive |
| 21 | GSE69601 | 32321 | 6 | 1050 × 1050 | Blood cells | Hypertensive vs. normatensive |
| 22 | GSE70456 | 49495 | 16 | 732 × 732 | Endothelial Cell | Hypertensive vs. normatensive |
| Gene Symbol | Forward Primer | Reverse Primer | Amplicon Sizes (bp) |
|---|---|---|---|
| ADM | ATGAAGCTGGTTTCCGTCG | GACATCCGCAGTTCCCTCTT | 146 |
| EDN1 | AAGGCAACAGACCGTGAAAAT | CGACCTGGTTTGTCTTAGGTG | 237 |
| ANGPTL4 | GTCCACCGACCTCCCGTTA | CCTCATGGTCTAGGTGCTTGT | 212 |
| NFIL3 | AGAACAAACTAATTGCACTGGGA | GCTCGTCCACAAATGAACTCAC | 192 |
| MSR1 | CCAGGTCCAATAGGTCCTCC | CTGGCCTTCCGGCATATCC | 94 |
| CEBPD | CGCCATGTACGACGACGAGA | TGCTGTTGAAGAGGTCGGCG | 116 |
| USP8 | GTCCAGGAGTCACTGCTAGTT | AGGAGCCAGTTTTCATAGCCT | 238 |
| GAPDH (Reference gene) | GGAGCGAGATCCCTCCAAAAT | GGCTGTTGTCAACTTCTCATGG | 197 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ali, F.; Khan, A.; Muhammad, S.A.; Hassan, S.S.u. Quantitative Real-Time Analysis of Differentially Expressed Genes in Peripheral Blood Samples of Hypertension Patients. Genes 2022, 13, 187. https://doi.org/10.3390/genes13020187
Ali F, Khan A, Muhammad SA, Hassan SSu. Quantitative Real-Time Analysis of Differentially Expressed Genes in Peripheral Blood Samples of Hypertension Patients. Genes. 2022; 13(2):187. https://doi.org/10.3390/genes13020187
Chicago/Turabian StyleAli, Fawad, Arifullah Khan, Syed Aun Muhammad, and Syed Shams ul Hassan. 2022. "Quantitative Real-Time Analysis of Differentially Expressed Genes in Peripheral Blood Samples of Hypertension Patients" Genes 13, no. 2: 187. https://doi.org/10.3390/genes13020187
APA StyleAli, F., Khan, A., Muhammad, S. A., & Hassan, S. S. u. (2022). Quantitative Real-Time Analysis of Differentially Expressed Genes in Peripheral Blood Samples of Hypertension Patients. Genes, 13(2), 187. https://doi.org/10.3390/genes13020187

