Radiosensitization-Related Cuproptosis LncRNA Signature in Non-Small Cell Lung Cancer
Abstract
1. Introduction
2. Materials and Methods
2.1. Data Sources
2.1.1. Construction of Predictive Signatures with Cuproptosis-Related LncRNAs
2.1.2. Survival Analysis and PFS Analysis
2.1.3. Co-Expression Network
2.1.4. Nomo and Calibration Plots
2.1.5. Tumor Immunoassay
2.1.6. Tumor Mutational Burden Analysis
2.1.7. Culture of Cells
2.2. Quantitative Real-Time PCR
2.3. Statistical Analysis
3. Results
3.1. Construction of the Cuproptosis-Related LncRNA Predictive Signature
3.2. Validation of Predictive Signature and Prognosis
3.3. Independent Analysis of Prognostic Factors
3.4. Nomogram and PCA Predictive Construction
3.5. Immune Correlation Analysis
3.6. Mutation Correlation Analysis
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2020. CA Cancer J. Clin. 2020, 70, 7–30. [Google Scholar] [CrossRef]
- Delaney, G.; Barton, M. Evidence-based Estimates of the Demand for Radiotherapy. Clin. Oncol. 2015, 27, 70–76. [Google Scholar] [CrossRef] [PubMed]
- Shafiq, J.; Hanna, T.; Vinod, S.; Delaney, G.; Barton, M. A Population-based Model of Local Control and Survival Benefit of Radiotherapy for Lung Cancer. Clin. Oncol. 2016, 28, 627–638. [Google Scholar] [CrossRef] [PubMed]
- Timmerman, R.; Paulus, R.; Galvin, J.; Michalski, J.; Straube, W.; Bradley, J.; Fakiris, A.; Bezjak, A.; Videtic, G.; Johnstone, D.; et al. Stereotactic Body Radiation Therapy for Inoperable Early Stage Lung Cancer. JAMA 2010, 303, 1070–1076. [Google Scholar] [CrossRef] [PubMed]
- Curran, W.J., Jr.; Paulus, R.; Langer, C.J.; Komaki, R.; Lee, J.S.; Hauser, S.; Movsas, B.; Wasserman, T.; Rosenthal, S.A.; Gore, E.; et al. Sequential vs. Concurrent Chemoradiation for Stage III Non-Small Cell Lung Cancer: Randomized Phase III Trial RTOG 9410. J. Natl. Cancer Inst. 2011, 103, 1452–1460, Erratum in J. Natl. Cancer Inst. 2012, 104, 79. [Google Scholar] [CrossRef]
- Bradley, J.D.; Paulus, R.; Komaki, R.; Masters, G.; Blumenschein, G.; Schild, S.; Bogart, J.; Hu, C.; Forster, K.; Magliocco, A.; et al. Standard-dose versus high-dose conformal radiotherapy with concurrent and consolidation carboplatin plus paclitaxel with or without cetuximab for patients with stage IIIA or IIIB non-small-cell lung cancer (RTOG 0617): A randomised, two-by-two factorial phase 3 study. Lancet Oncol. 2015, 16, 187–199. [Google Scholar] [CrossRef]
- Wang, Y.; Zhang, L.; Zhou, F. Cuproptosis: A new form of programmed cell death. Cell Mol. Immunol. 2022, 19, 867–868. [Google Scholar] [CrossRef]
- Baldari, S.; Di Rocco, G.; Toietta, G. Current Biomedical Use of Copper Chelation Therapy. Int. J. Mol. Sci. 2020, 21, 1069. [Google Scholar] [CrossRef]
- Vetlényi, E.; Rácz, G. A réz élettani funkciója, a rézfelhalmozódás és a rézhiány kóroktani szerepe [The physiological function of copper, the etiological role of copper excess and deficiency]. Orvosi Hetil. 2020, 161, 1488–1496. [Google Scholar] [CrossRef]
- Tsvetkov, P.; Coy, S.; Petrova, B.; Dreishpoon, M.; Verma, A.; Abdusamad, M.; Rossen, J.; Joesch-Cohen, L.; Humeidi, R.; Spangler, R.D.; et al. Copper induces cell death by targeting lipoylated TCA cycle proteins. Science 2022, 375, 1254–1261, Erratum in Science 2022, 376, eabq4855. [Google Scholar] [CrossRef]
- Tessmer, C.F.; Hrgovcic, M.; Thomas, F.B.; Fuller, L.M.; Castro, J.R. Serum Copper as an Index of Tumor Response to Radiotherapy. Radiology 1973, 106, 635–639. [Google Scholar] [CrossRef] [PubMed]
- Denoyer, D.; Masaldan, S.; La Fontaine, S.; Cater, M.A. Targeting copper in cancer therapy: ‘Copper That Cancer’. Metallomics 2015, 7, 1459–1476. [Google Scholar] [CrossRef] [PubMed]
- Rinn, J.L.; Chang, H.Y. Genome Regulation by Long Noncoding RNAs. Annu. Rev. Biochem. 2012, 81, 145–166. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Chen, Z.; Wang, X.; Huang, Z.; He, Z.; Chen, Y. Long non-coding RNA: A new player in cancer. J. Hematol. Oncol. 2013, 6, 37. [Google Scholar] [CrossRef] [PubMed]
- Prensner, J.R.; Chinnaiyan, A.M. The Emergence of lncRNAs in Cancer Biology. Cancer Discov. 2011, 1, 391–407. [Google Scholar] [CrossRef] [PubMed]
- Loewen, G.; Jayawickramarajah, J.; Zhuo, Y.; Shan, B. Functions of lncRNA HOTAIR in lung cancer. J. Hematol. Oncol. 2014, 7, 90. [Google Scholar] [CrossRef] [PubMed]
- Luo, J.; Tang, L.; Zhang, J.; Ni, J.; Zhang, H.-P.; Zhang, L.; Xu, J.-F.; Zheng, D. Long non-coding RNA CARLo-5 is a negative prognostic factor and exhibits tumor pro-oncogenic activity in non-small cell lung cancer. Tumor Biol. 2014, 35, 11541–11549. [Google Scholar] [CrossRef]
- Polishchuk, E.V.; Merolla, A.; Lichtmannegger, J.; Romano, A.; Indrieri, A.; Ilyechova, E.Y.; Concilli, M.; De Cegli, R.; Crispino, R.; Mariniello, M.; et al. Activation of Autophagy, Observed in Liver Tissues From Patients With Wilson Disease and From ATP7B-Deficient Animals, Protects Hepatocytes From Copper-Induced Apoptosis. Gastroenterology 2019, 156, 1173–1189.e5. [Google Scholar] [CrossRef]
- Aubert, L.; Nandagopal, N.; Steinhart, Z.; Lavoie, G.; Nourreddine, S.; Berman, J.; Saba-El-Leil, M.K.; Papadopoli, D.; Lin, S.; Hart, T.; et al. Copper bioavailability is a KRAS-specific vulnerability in colorectal cancer. Nat. Commun. 2020, 11, 3701. [Google Scholar] [CrossRef]
- Ren, X.; Li, Y.; Zhou, Y.; Hu, W.; Yang, C.; Jing, Q.; Zhou, C.; Wang, X.; Hu, J.; Wang, L.; et al. Overcoming the compensatory elevation of NRF2 renders hepatocellular carcinoma cells more vulnerable to disulfiram/copper-induced ferroptosis. Redox Biol. 2021, 46, 102122. [Google Scholar] [CrossRef]
- Newton, J.M.; Hanoteau, A.; Liu, H.-C.; Gaspero, A.; Parikh, F.; Corrado, R.; Hart, T.D.; Laoui, D.; Van Ginderachter, J.A.; Dharmaraj, N.; et al. Immune microenvironment modulation unmasks therapeutic benefit of radiotherapy and checkpoint inhibition. J. Immunother. Cancer 2019, 7, 216. [Google Scholar] [CrossRef] [PubMed]
- Pich, O.; Muiños, F.; Lolkema, M.P.; Steeghs, N.; Gonzalez-Perez, A.; Lopez-Bigas, N. The mutational footprints of cancer therapies. Nat. Genet. 2019, 51, 1732–1740. [Google Scholar] [CrossRef] [PubMed]
- Hegde, P.S.; Karanikas, V.; Evers, S. The Where, the When, and the How of Immune Monitoring for Cancer Immunotherapies in the Era of Checkpoint Inhibition. Clin. Cancer Res. 2016, 22, 1865–1874. [Google Scholar] [CrossRef]
- Hegde, P.S.; Chen, D.S. Top 10 Challenges in Cancer Immunotherapy. Immunity 2020, 52, 17–35. [Google Scholar] [CrossRef] [PubMed]
- Sade-Feldman, M.; Jiao, Y.J.; Chen, J.H.; Rooney, M.S.; Barzily-Rokni, M.; Eliane, J.-P.; Bjorgaard, S.L.; Hammond, M.R.; Vitzthum, H.; Blackmon, S.M.; et al. Resistance to checkpoint blockade therapy through inactivation of antigen presentation. Nat. Commun. 2017, 8, 1136. [Google Scholar] [CrossRef]
- Davidson, M.R.; Gazdar, A.F.; Clarke, B.E. The pivotal role of pathology in the management of lung cancer. J. Thorac. Dis. 2013, 5 (Suppl. S5), S463–S478. [Google Scholar] [CrossRef]
- Langer, C.J.; Besse, B.; Gualberto, A.; Brambilla, E.; Soria, J.-C. The Evolving Role of Histology in the Management of Advanced Non–Small-Cell Lung Cancer. J. Clin. Oncol. 2010, 28, 5311–5320. [Google Scholar] [CrossRef]
- Ettinger, D.S.; Akerley, W.; Borghaei, H.; Chang, A.C.; Cheney, R.T.; Chirieac, L.R.; D’amico, T.A.; Demmy, T.L.; Govindan, R.; Grannis, F.W.; et al. Non–Small Cell Lung Cancer, Version 2.2013. J. Natl. Compr. Cancer Netw. 2013, 11, 645–653. [Google Scholar] [CrossRef]
- Yang, M.; Wu, X.; Hu, J.; Wang, Y.; Wang, Y.; Zhang, L.; Huang, W.; Wang, X.; Li, N.; Liao, L.; et al. COMMD10 inhibits HIF1α/CP loop to enhance ferroptosis and radiosensitivity by disrupting Cu-Fe balance in hepatocellular carcinoma. J. Hepatol. 2022, 76, 1138–1150. [Google Scholar] [CrossRef]
- Hua, Q.; Jin, M.; Mi, B.; Xu, F.; Li, T.; Zhao, L.; Liu, J.; Huang, G. LINC01123, a c-Myc-activated long non-coding RNA, promotes proliferation and aerobic glycolysis of non-small cell lung cancer through miR-199a-5p/c-Myc axis. J. Hematol. Oncol. 2019, 12, 91. [Google Scholar] [CrossRef]
- Sun, J.; Zhang, Z.; Bao, S.; Yan, C.; Hou, P.; Wu, N.; Su, J.; Xu, L.; Zhou, M. Identification of tumor immune infiltration-associated lncRNAs for improving prognosis and immunotherapy response of patients with non-small cell lung cancer. J. Immunother. Cancer 2020, 8, e000110. [Google Scholar] [CrossRef] [PubMed]
- Kopp, F.; Mendell, J.T. Functional Classification and Experimental Dissection of Long Noncoding RNAs. Cell 2018, 172, 393–407. [Google Scholar] [CrossRef] [PubMed]
- Weber, D.G.; Johnen, G.; Casjens, S.; Bryk, O.; Pesch, B.; Jöckel, K.-H.; Kollmeier, J.; Brüning, T. Evaluation of long noncoding RNA MALAT1 as a candidate blood-based biomarker for the diagnosis of non-small cell lung cancer. BMC Res. Notes 2013, 6, 518. [Google Scholar] [CrossRef]
- Tantai, J.; Hu, D.; Yang, Y.; Geng, J. Combined identification of long non-coding RNA XIST and HIF1A-AS1 in serum as an effective screening for non-small cell lung cancer. Int. J. Clin. Exp. Pathol. 2015, 8, 7887–7895. [Google Scholar]
- Tong-Xin, Y.; Wang, X.-W.; Zhou, X.-L.; Liu, Z.-H.; Yang, T.-X.; Shi, W.-H.; Xie, H.-W.; Lv, J.; Wu, Q.-Q.; Cao, X.-F. Identification of the long non-coding RNA POU3F3 in plasma as a novel biomarker for diagnosis of esophageal squamous cell carcinoma. Mol. Cancer 2015, 14, 3. [Google Scholar] [CrossRef] [PubMed]
- Chen, M.; Wu, D.; Tu, S.; Yang, C.; Chen, D.; Xu, Y. A novel biosensor for the ultrasensitive detection of the lncRNA biomarker MALAT1 in non-small cell lung cancer. Sci. Rep. 2021, 11, 3666. [Google Scholar] [CrossRef] [PubMed]
- Zhang, M.; Gao, C.; Yang, Y.; Li, G.; Dong, J.; Ai, Y.; Chen, N.; Li, W. Long Noncoding RNA CRNDE/PRC2 Participated in the Radiotherapy Resistance of Human Lung Adenocarcinoma Through Targeting p21 Expression. Oncol. Res. 2018, 26, 1245–1255. [Google Scholar] [CrossRef]
- Brownmiller, T.; Juric, J.A.; Ivey, A.D.; Harvey, B.M.; Westemeier, E.S.; Winters, M.T.; Stevens, A.M.; Stanley, A.N.; Hayes, K.E.; Sprowls, S.A.; et al. Y Chromosome LncRNA Are Involved in Radiation Response of Male Non–Small Cell Lung Cancer Cells. Cancer Res. 2020, 80, 4046–4057. [Google Scholar] [CrossRef]
- Zhao, X.; Jin, X.; Zhang, Q.; Liu, R.; Luo, H.; Yang, Z.; Geng, Y.; Feng, S.; Li, C.; Wang, L.; et al. Silencing of the lncRNA H19 enhances sensitivity to X-ray and carbon-ions through the miR-130a-3p/WNK3 signaling axis in NSCLC cells. Cancer Cell Int. 2021, 21, 644. [Google Scholar] [CrossRef]
- Sun, Y.; Jin, S.-D.; Zhu, Q.; Han, L.; Feng, J.; Lu, X.-Y.; Wang, W.; Wang, F.; Guo, R.-H. Long non-coding RNA LUCAT1 is associated with poor prognosis in human non-small cell lung cancer and regulates cell proliferation via epigenetically repressing p21 and p57 expression. Oncotarget 2017, 8, 28297–28311. [Google Scholar] [CrossRef]
- Shen, Q.; Xu, Z.; Xu, S. Long non-coding RNA LUCAT1 contributes to cisplatin resistance by regulating the miR-514a-3p/ULK1 axis in human non-small cell lung cancer. Int. J. Oncol. 2020, 57, 967–979. [Google Scholar] [CrossRef] [PubMed]
- Liu, B.; Zhao, Y.; Yang, S. An Autophagy-Related Long Non-Coding RNA Prognostic Signature for Patients with Lung Squamous Carcinoma Based on Bioinformatics Analysis. Int. J. Gen. Med. 2021, 14, 6621–6637. [Google Scholar] [CrossRef] [PubMed]
- Xu, S.; Liu, D.; Chang, T.; Wen, X.; Ma, S.; Sun, G.; Wang, L.; Chen, S.; Xu, Y.; Zhang, H. Cuproptosis-Associated lncRNA Establishes New Prognostic Profile and Predicts Immunotherapy Response in Clear Cell Renal Cell Carcinoma. Front. Genet. 2022, 13, 938259. [Google Scholar] [CrossRef]
- Zhou, S.; Cai, Y.; Xu, Z.; Peng, B.; Liang, Q.; Peng, J.; Yan, Y. Identification of a pyroptosis-related lncRNA signature in the regulation of prognosis, metabolism signals and immune infiltration in lung adenocarcinoma. Front. Endocrinol. 2022, 13, 964362. [Google Scholar] [CrossRef]
- Tang, D.; Chen, X.; Kroemer, G. Cuproptosis: A copper-triggered modality of mitochondrial cell death. Cell Res. 2022, 32, 417–418. [Google Scholar] [CrossRef] [PubMed]
- Harding, S.M.; Benci, J.L.; Irianto, J.; Discher, D.E.; Minn, A.J.; Greenberg, R.A. Mitotic progression following DNA damage enables pattern recognition within micronuclei. Nature 2017, 548, 466–470. [Google Scholar] [CrossRef]
- Vanpouille-Box, C.; Alard, A.; Aryankalayil, M.J.; Sarfraz, Y.; Diamond, J.M.; Schneider, R.J.; Inghirami, G.; Coleman, C.N.; Formenti, S.C.; DeMaria, S. DNA exonuclease Trex1 regulates radiotherapy-induced tumour immunogenicity. Nat. Commun. 2017, 8, 15618. [Google Scholar] [CrossRef]
- Bakhoum, S.F.; Kabeche, L.; Wood, M.D.; Laucius, C.D.; Qu, D.; Laughney, A.M.; Reynolds, G.E.; Louie, R.J.; Phillips, J.; Chan, D.A.; et al. Numerical chromosomal instability mediates susceptibility to radiation treatment. Nat. Commun. 2015, 6, 5990. [Google Scholar] [CrossRef]
- Zhang, Y.; He, L.; Sadagopan, A.; Ma, T.; Dotti, G.; Wang, Y.; Zheng, H.; Gao, X.; Wang, D.; DeLeo, A.B.; et al. Targeting Radiation-Resistant Prostate Cancer Stem Cells by B7-H3 CAR T Cells. Mol. Cancer Ther. 2021, 20, 577–588. [Google Scholar] [CrossRef]
- Zhang, M.C.; Liu, H.P.; Demchik, L.L.; Zhai, Y.F.; Yang, D.J. LIGHT sensitizes IFN-γ–mediated apoptosis of HT-29 human carcinoma cells through both death receptor and mitochondria pathways. Cell Res. 2004, 14, 117–124. [Google Scholar] [CrossRef]
- Kanodia, S.; Da Silva, D.M.; Karamanukyan, T.; Bogaert, L.; Fu, Y.-X.; Kast, W.M. Expression of LIGHT/TNFSF14 Combined with Vaccination against Human Papillomavirus Type 16 E7 Induces Significant Tumor Regression. Cancer Res. 2010, 70, 3955–3964. [Google Scholar] [CrossRef] [PubMed]
- Yu, P.; Lee, Y.; Wang, Y.; Liu, X.; Auh, S.; Gajewski, T.F.; Schreiber, H.; You, Z.; Kaynor, C.; Wang, X.; et al. Targeting the Primary Tumor to Generate CTL for the Effective Eradication of Spontaneous Metastases1. J. Immunol. 2007, 179, 1960–1968. [Google Scholar] [CrossRef] [PubMed]
- Johansson-Percival, A.; Li, Z.-J.; Lakhiani, D.D.; He, B.; Wang, X.; Hamzah, J.; Ganss, R. Intratumoral LIGHT Restores Pericyte Contractile Properties and Vessel Integrity. Cell Rep. 2015, 13, 2687–2698. [Google Scholar] [CrossRef] [PubMed]
- Johansson-Percival, A.; He, B.; Li, Z.-J.; Kjellén, A.; Russell, K.; Li, J.; Larma, I.; Ganss, R. De novo induction of intratumoral lymphoid structures and vessel normalization enhances immunotherapy in resistant tumors. Nat. Immunol. 2017, 18, 1207–1217. [Google Scholar] [CrossRef]
- Dong, Z.-Y.; Zhong, W.-Z.; Zhang, X.-C.; Su, J.; Xie, Z.; Liu, S.-Y.; Tu, H.-Y.; Chen, H.-J.; Sun, Y.-L.; Zhou, Q.; et al. Potential Predictive Value of TP53 and KRAS Mutation Status for Response to PD-1 Blockade Immunotherapy in Lung Adenocarcinoma. Clin. Cancer Res. 2017, 23, 3012–3024. [Google Scholar] [CrossRef]
- Campbell, B.B.; Light, N.; Fabrizio, D.; Zatzman, M.; Fuligni, F.; De Borja, R.; Davidson, S.; Edwards, M.; Elvin, J.A.; Hodel, K.P.; et al. Comprehensive Analysis of Hypermutation in Human Cancer. Cell 2017, 171, 1042–1056.e10. [Google Scholar] [CrossRef]
- Jeong, Y.; Hoang, N.T.; Lovejoy, A.; Stehr, H.; Newman, A.M.; Gentles, A.J.; Kong, W.; Truong, D.; Martin, S.; Chaudhuri, A.; et al. Role of KEAP1/NRF2 and TP53 Mutations in Lung Squamous Cell Carcinoma Development and Radiation Resistance. Cancer Discov. 2017, 7, 86–101. [Google Scholar] [CrossRef]









| Primer | Sequence |
|---|---|
| LINC02029-F | TAGAGATGGAGGACTGGGAGG |
| LINC02029-R | GTGCACACTTGTCCAAGCAG |
| GAPDH-F | GTCTCCTCTGACTTCAACAGCG |
| GAPDH-R | ACCACCCTGTTGCTGTAGCCAA |
| Variables | Entire TCGA Dataset n = 177 | Train n1 = 88 | Test n2 = 89 | |||
|---|---|---|---|---|---|---|
| Age (%) | ||||||
| ≤65 | 90 | 50.85% | 41 | 46.59% | 49 | 55.06% |
| >65 | 84 | 47.46% | 47 | 53.41% | 37 | 41.57% |
| Unknown | 3 | 1.69% | 3 | 3.37% | ||
| Gender (%) | ||||||
| Female | 85 | 48.02% | 47 | 53.41% | 38 | 42.70% |
| male | 92 | 51.98% | 41 | 46.59% | 51 | 57.30% |
| Stage (%) | ||||||
| I + II | 104 | 58.76% | 49 | 55.68% | 55 | 61.80% |
| III + IV | 70 | 39.55% | 38 | 43.18% | 32 | 35.96% |
| Unknow | 3 | 1.69% | 1 | 1.14% | 2 | 2.25% |
| T (%) | ||||||
| T1 + T2 | 135 | 76.27% | 66 | 75.00% | 69 | 77.53% |
| T3 + T4 | 40 | 22.60% | 21 | 23.86% | 19 | 21.35% |
| TX + Unknow | 2 | 1.13% | 1 | 1.14% | 1 | 1.12% |
| M (%) | ||||||
| M0 | 124 | 70.06% | 61 | 69.32% | 63 | 70.79% |
| M1 | 10 | 5.65% | 4 | 4.55% | 6 | 6.74% |
| Mx + Unknow | 43 | 24.29% | 23 | 26.14% | 20 | 22.47% |
| N (%) | ||||||
| N0 | 82 | 46.33% | 38 | 43.18% | 44 | 49.44% |
| N1 + N2 | 88 | 49.72% | 45 | 51.14% | 43 | 48.31% |
| N3 | 3 | 1.69% | 3 | 3.41% | ||
| NX + Unknow | 4 | 2.26% | 2 | 2.27% | 2 | 2.25% |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, Q.; Liu, T.; Wang, J. Radiosensitization-Related Cuproptosis LncRNA Signature in Non-Small Cell Lung Cancer. Genes 2022, 13, 2080. https://doi.org/10.3390/genes13112080
Xu Q, Liu T, Wang J. Radiosensitization-Related Cuproptosis LncRNA Signature in Non-Small Cell Lung Cancer. Genes. 2022; 13(11):2080. https://doi.org/10.3390/genes13112080
Chicago/Turabian StyleXu, Qiushi, Tong Liu, and Junjie Wang. 2022. "Radiosensitization-Related Cuproptosis LncRNA Signature in Non-Small Cell Lung Cancer" Genes 13, no. 11: 2080. https://doi.org/10.3390/genes13112080
APA StyleXu, Q., Liu, T., & Wang, J. (2022). Radiosensitization-Related Cuproptosis LncRNA Signature in Non-Small Cell Lung Cancer. Genes, 13(11), 2080. https://doi.org/10.3390/genes13112080

