Transcriptome Analysis Reveals That SREBP Modulates a Large Repertoire of Genes Involved in Key Cellular Functions in Penaeus vannamei, although the Majority of the Dysregulated Genes Are Unannotated
Abstract
:1. Introduction
2. Materials and Methods
2.1. Experimental Animals and RNA Interference (RNAi) Experiments
2.2. Western Blot Analysis
2.3. RNA Extraction, cDNA Synthesis, and qPCR Analysis
2.4. Library Construction and Transcriptome Sequencing
2.5. Transcriptome Data Analysis, Functional Annotation, and qPCR Validation
2.6. Protein-Protein Interaction Network Construction
2.7. Shrimp Survival
2.8. Statistical Analysis and Data Presentation
3. Results
3.1. Transcriptome Profiling, and Analysis of Differentially Expressed Genes
3.2. Functional Annotation of DEGs
3.3. Pathway Functional Analysis of DEGs
3.4. DEGs with Annotated and Unannotated Functions in Penaeid Shrimp
3.5. Protein-Protein Interaction Network between DEGs
3.6. Effect of PvSREBP Knockdown on Shrimp Survival
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- DeBose-Boyd, R.A.; Ye, J. SREBPs in Lipid Metabolism, Insulin Signaling, and Beyond. Trends Biochem. Sci. 2018, 43, 358–368. [Google Scholar] [CrossRef]
- Xu, X.; So, J.S.; Park, J.G.; Lee, A.H. Transcriptional control of hepatic lipid metabolism by SREBP and ChREBP. Semin. Liver Dis. 2013, 33, 301–311. [Google Scholar] [CrossRef] [Green Version]
- Park, H.Y.; Kang, H.S.; Im, S.S. Recent insight into the correlation of SREBP-mediated lipid metabolism and innate immune response. J. Mol. Endocrinol. 2018, 61, R123–R131. [Google Scholar] [CrossRef] [Green Version]
- Assmann, N.; O’Brien, K.L.; Donnelly, R.P.; Dyck, L.; Zaiatz-Bittencourt, V.; Loftus, R.M.; Heinrich, P.; Oefner, P.J.; Lynch, L.; Gardiner, C.M.; et al. Srebp-controlled glucose metabolism is essential for NK cell functional responses. Nat. Immunol. 2017, 18, 1197–1206. [Google Scholar] [CrossRef]
- Oishi, Y.; Spann, N.J.; Link, V.M.; Muse, E.D.; Strid, T.; Edillor, C.; Kolar, M.J.; Matsuzaka, T.; Hayakawa, S.; Tao, J.; et al. SREBP1 Contributes to Resolution of Pro-inflammatory TLR4 Signaling by Reprogramming Fatty Acid Metabolism. Cell Metab. 2017, 25, 412–427. [Google Scholar] [CrossRef] [Green Version]
- Lee, J.H.; Phelan, P.; Shin, M.; Oh, B.C.; Han, X.; Im, S.S.; Osborne, T.F. SREBP-1a-stimulated lipid synthesis is required for macrophage phagocytosis downstream of TLR4-directed mTORC1. Proc. Natl. Acad. Sci. USA 2018, 115, E12228–E12234. [Google Scholar] [CrossRef] [Green Version]
- Rome, S.; Lecomte, V.; Meugnier, E.; Rieusset, J.; Debard, C.; Euthine, V.; Vidal, H.; Lefai, E. Microarray analyses of SREBP-1a and SREBP-1c target genes identify new regulatory pathways in muscle. Physiol. Genom. 2008, 34, 327–337. [Google Scholar] [CrossRef] [Green Version]
- Engelking, L.J.; Cantoria, M.J.; Xu, Y.; Liang, G. Developmental and extrahepatic physiological functions of SREBP pathway genes in mice. Semin. Cell Dev. Biol. 2018, 81, 98–109. [Google Scholar] [CrossRef]
- Ang, M.J.; Kim, J.; Lee, S.; Kim, S.H.; Kim, J.C.; Jeon, T.I.; Im, S.S.; Moon, C. Transcriptome Profiling Reveals Novel Candidate Genes Related to Hippocampal Dysfunction in SREBP-1c Knockout Mice. Int. J. Mol. Sci. 2020, 21, 4131. [Google Scholar] [CrossRef]
- Jin, X.; Demere, Z.; Nair, K.; Ali, A.; Ferraro, G.B.; Natoli, T.; Deik, A.; Petronio, L.; Tang, A.A.; Zhu, C.; et al. A metastasis map of human cancer cell lines. Nature 2020, 588, 331–336. [Google Scholar] [CrossRef]
- Ohno, H.; Matsuzaka, T.; Tang, N.; Sharma, R.; Motomura, K.; Shimura, T.; Satoh, A.; Han, S.I.; Takeuchi, Y.; Aita, Y.; et al. Transgenic Mice Overexpressing SREBP-1a in Male ob/ob Mice Exhibit Lipodystrophy and Exacerbate Insulin Resistance. Endocrinology 2018, 159, 2308–2323. [Google Scholar] [CrossRef]
- Goldstein, J.L.; DeBose-Boyd, R.A.; Brown, M.S. Protein sensors for membrane sterols. Cell 2006, 124, 35–46. [Google Scholar] [CrossRef] [Green Version]
- Michael, S.B.; Joseph, L.G. The SREBP Pathway: Regulation of Cholesterol Metabolism by Proteolysis of a Membrane-Bound Transcription Factor. Cell 1997, 89, 331–340. [Google Scholar]
- Xu, H.F.; Luo, J.; Zhao, W.S.; Yang, Y.C.; Tian, H.B.; Shi, H.B.; Bionaz, M. Overexpression of SREBP1 (sterol regulatory element binding protein 1) promotes de novo fatty acid synthesis and triacylglycerol accumulation in goat mammary epithelial cells. J. Dairy Sci. 2016, 99, 783–795. [Google Scholar] [CrossRef] [Green Version]
- Xue, L.; Qi, H.; Zhang, H.; Ding, L.; Huang, Q.; Zhao, D.; Wu, B.J.; Li, X. Targeting SREBP-2-Regulated Mevalonate Metabolism for Cancer Therapy. Front. Oncol. 2020, 10, 1510. [Google Scholar] [CrossRef]
- Tay, S.S.; Kuah, M.K.; Shu-Chien, A.C. Transcriptional activation of zebrafish fads2 promoter and its transient transgene expression in yolk syncytial layer of zebrafish embryos. Sci. Rep. 2018, 8, 3874. [Google Scholar] [CrossRef] [Green Version]
- Dong, X.; Tan, P.; Cai, Z.; Xu, H.; Li, J.; Ren, W.; Xu, H.; Zuo, R.; Zhou, J.; Mai, K.; et al. Regulation of FADS2 transcription by SREBP-1 and PPAR-alpha influences LC-PUFA biosynthesis in fish. Sci. Rep. 2017, 7, 40024. [Google Scholar] [CrossRef] [Green Version]
- Abdulla, A.; Zhang, Y.; Hsu, F.N.; Xiaoli, A.M.; Zhao, X.; Yang, E.S.; Ji, J.Y.; Yang, F. Regulation of lipogenic gene expression by lysine-specific histone demethylase-1 (LSD1). J. Biol. Chem. 2014, 289, 29937–29947. [Google Scholar] [CrossRef] [Green Version]
- Liu, H.L.; Zhang, H.K.; Zheng, H.P. Regulatory roles of sterol regulatory element-binding protein (SREBP) on lipid metabolism in marine invertebrate Chlamys nobilis. Aquaculture 2018, 493, 251–257. [Google Scholar] [CrossRef]
- Ran, Z.; Kong, F.; Xu, J.; Liao, K.; Yan, X. Transcriptional regulation mechanism of sterol regulatory element binding proteins on Delta6 fatty acyl desaturase in razor clam Sinonovacula constricta. Br. J. Nutr. 2020, 124, 881–889. [Google Scholar] [CrossRef]
- Hao, M.; Lin, Z.; Rong, H.; Zhu, D.; Wen, X. Sterol regulatory element binding protein-1: Molecular cloning, tissue distribution and gene expression level in response to nutritional regulation in mud crab, Scylla paramamosain. Biochem. Biophys. Res. Commun. 2018, 505, 705–711. [Google Scholar] [CrossRef]
- Zhang, X.; Yuan, J.; Sun, Y.; Li, S.; Gao, Y.; Yu, Y.; Liu, C.; Wang, Q.; Lv, X.; Zhang, X.; et al. Penaeid shrimp genome provides insights into benthic adaptation and frequent molting. Nat. Commun. 2019, 10, 356. [Google Scholar] [CrossRef] [Green Version]
- Aweya, J.J.; Zheng, X.; Zheng, Z.; Wang, W.; Fan, J.; Yao, D.; Li, S.; Zhang, Y. The sterol regulatory element binding protein homolog of Penaeus vannamei modulates fatty acid metabolism and immune response. Biochim. Biophys. Acta Mol. Cell. Biol. Lipids 2020, 1865, 158757. [Google Scholar] [CrossRef]
- Esquejo, R.M.; Roqueta-Rivera, M.; Shao, W.; Phelan, P.E.; Seneviratne, U.; Am Ende, C.W.; Hershberger, P.M.; Machamer, C.E.; Espenshade, P.J.; Osborne, T.F. Dipyridamole Inhibits Lipogenic Gene Expression by Retaining SCAP-SREBP in the Endoplasmic Reticulum. Cell Chem. Biol. 2021, 28, 169–179.e167. [Google Scholar] [CrossRef]
- Yan, R.; Cao, P.; Song, W.; Li, Y.; Wang, T.; Qian, H.; Yan, C.; Yan, N. Structural basis for sterol sensing by Scap and Insig. Cell Rep. 2021, 35, 109299. [Google Scholar] [CrossRef]
- Yin, F.; Feng, F.; Wang, L.; Wang, X.; Li, Z.; Cao, Y. SREBP-1 inhibitor Betulin enhances the antitumor effect of Sorafenib on hepatocellular carcinoma via restricting cellular glycolytic activity. Cell Death Dis. 2019, 10, 672. [Google Scholar] [CrossRef] [Green Version]
- Triki, M.; Rinaldi, G.; Planque, M.; Broekaert, D.; Winkelkotte, A.M.; Maier, C.R.; Janaki Raman, S.; Vandekeere, A.; Van Elsen, J.; Orth, M.F.; et al. mTOR Signaling and SREBP Activity Increase FADS2 Expression and Can Activate Sapienate Biosynthesis. Cell Rep. 2020, 31, 107806. [Google Scholar] [CrossRef]
- Vogt, G. Functional cytology of the hepatopancreas of decapod crustaceans. J. Morphol. 2019, 280, 1405–1444. [Google Scholar] [CrossRef]
- Vogt, G. Cytopathology and immune response in the hepatopancreas of decapod crustaceans. Dis. Aquat. Organ. 2020, 138, 41–88. [Google Scholar] [CrossRef]
- Nguyen, D.V.; Christiaens, O.; Bossier, P.; Smagghe, G. RNA interference in shrimp and potential applications in aquaculture. Rev. Aquacult. 2018, 10, 573–584. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Modi, A.; Vai, S.; Caramelli, D.; Lari, M. The Illumina Sequencing Protocol and the NovaSeq 6000 System. Methods Mol. Biol. 2021, 2242, 15–42. [Google Scholar] [CrossRef]
- Jiao, L.; Dai, T.; Jin, M.; Sun, P.; Zhou, Q. Transcriptome Analysis of the Hepatopancreas in the Litopenaeus vannamei Responding to the Lead Stress. Biol. Trace Elem. Res. 2021, 199, 1100–1109. [Google Scholar] [CrossRef]
- Jager, K.J.; van Dijk, P.C.; Zoccali, C.; Dekker, F.W. The analysis of survival data: The Kaplan-Meier method. Kidney Int. 2008, 74, 560–565. [Google Scholar] [CrossRef] [Green Version]
- Graffeo, N.; Castell, F.; Belot, A.; Giorgi, R. A log-rank-type test to compare net survival distributions. Biometrics 2016, 72, 760–769. [Google Scholar] [CrossRef]
- Li, C.; Yang, W.; Zhang, J.; Zheng, X.; Yao, Y.; Tu, K.; Liu, Q. SREBP-1 has a prognostic role and contributes to invasion and metastasis in human hepatocellular carcinoma. Int. J. Mol. Sci. 2014, 15, 7124–7138. [Google Scholar] [CrossRef]
- Vergnes, L.; Chin, R.G.; de Aguiar Vallim, T.; Fong, L.G.; Osborne, T.F.; Young, S.G.; Reue, K. SREBP-2-deficient and hypomorphic mice reveal roles for SREBP-2 in embryonic development and SREBP-1c expression. J. Lipid Res. 2016, 57, 410–421. [Google Scholar] [CrossRef] [Green Version]
- Dorotea, D.; Koya, D.; Ha, H. Recent Insights into SREBP as a Direct Mediator of Kidney Fibrosis via Lipid-Independent Pathways. Front. Pharmacol. 2020, 11, 265. [Google Scholar] [CrossRef]
- Horton, J.D.; Goldstein, J.L.; Brown, M.S. SREBPs: Activators of the complete program of cholesterol and fatty acid synthesis in the liver. J. Clin. Invest. 2002, 109, 1125–1131. [Google Scholar] [CrossRef]
- Gosmain, Y.; Dif, N.; Berbe, V.; Loizon, E.; Rieusset, J.; Vidal, H.; Lefai, E. Regulation of SREBP-1 expression and transcriptional action on HKII and FAS genes during fasting and refeeding in rat tissues. J. Lipid Res. 2005, 46, 697–705. [Google Scholar] [CrossRef] [Green Version]
- Aweya, J.J.; Zheng, Z.H.; Zheng, X.Y.; Yao, D.F.; Zhang, Y.L. The expanding repertoire of immune-related molecules with antimicrobial activity in penaeid shrimps: A review. Rev. Aquacult. 2021, 13, 1907–1937. [Google Scholar] [CrossRef]
- Roberts, D.J.; Miyamoto, S. Hexokinase II integrates energy metabolism and cellular protection: Akting on mitochondria and TORCing to autophagy. Cell Death Differ. 2015, 22, 248–257. [Google Scholar] [CrossRef] [Green Version]
- Kammoun, H.L.; Chabanon, H.; Hainault, I.; Luquet, S.; Magnan, C.; Koike, T.; Ferre, P.; Foufelle, F. GRP78 expression inhibits insulin and ER stress-induced SREBP-1c activation and reduces hepatic steatosis in mice. J. Clin. Invest. 2009, 119, 1201–1215. [Google Scholar] [CrossRef] [Green Version]
- Guillet-Deniau, I.; Mieulet, V.; Le Lay, S.; Achouri, Y.; Carre, D.; Girard, J.; Foufelle, F.; Ferre, P. Sterol regulatory element binding protein-1c expression and action in rat muscles: Insulin-like effects on the control of glycolytic and lipogenic enzymes and UCP3 gene expression. Diabetes 2002, 51, 1722–1728. [Google Scholar] [CrossRef] [Green Version]
- Gosmain, Y.; Lefai, E.; Ryser, S.; Roques, M.; Vidal, H. Sterol regulatory element-binding protein-1 mediates the effect of insulin on hexokinase II gene expression in human muscle cells. Diabetes 2004, 53, 321–329. [Google Scholar] [CrossRef] [Green Version]
- Wen, Y.A.; Xiong, X.; Zaytseva, Y.Y.; Napier, D.L.; Vallee, E.; Li, A.T.; Wang, C.; Weiss, H.L.; Evers, B.M.; Gao, T. Downregulation of SREBP inhibits tumor growth and initiation by altering cellular metabolism in colon cancer. Cell Death Dis. 2018, 9, 265. [Google Scholar] [CrossRef] [Green Version]
- Meton, I.; Egea, M.; Anemaet, I.G.; Fernandez, F.; Baanante, I.V. Sterol regulatory element binding protein-1a transactivates 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase gene promoter. Endocrinology 2006, 147, 3446–3456. [Google Scholar] [CrossRef] [Green Version]
- Jiang, T.; Zhang, G.; Lou, Z. Role of the Sterol Regulatory Element Binding Protein Pathway in Tumorigenesis. Front. Oncol. 2020, 10, 1788. [Google Scholar] [CrossRef]
- Bengoechea-Alonso, M.T.; Ericsson, J. SREBP in signal transduction: Cholesterol metabolism and beyond. Curr. Opin. Cell Biol. 2007, 19, 215–222. [Google Scholar] [CrossRef]
- Merrett, J.E.; Xie, J.; Psaltis, P.J.; Proud, C.G. MAPK-interacting kinase 2 (MNK2) regulates adipocyte metabolism independently of its catalytic activity. Biochem. J. 2020, 477, 2735–2754. [Google Scholar] [CrossRef]
- Waskiewicz, A.J.; Johnson, J.C.; Penn, B.; Mahalingam, M.; Kimball, S.R.; Cooper, J.A. Phosphorylation of the cap-binding protein eukaryotic translation initiation factor 4E by protein kinase Mnk1 in vivo. Mol. Cell Biol. 1999, 19, 1871–1880. [Google Scholar] [CrossRef]
- Prabhu, S.A.; Moussa, O.; Miller, W.H., Jr.; Del Rincon, S.V. The MNK1/2-eIF4E Axis as a Potential Therapeutic Target in Melanoma. Int. J. Mol. Sci. 2020, 21, 4055. [Google Scholar] [CrossRef]
- Gupta, B.; Chandra, S.; Singh, A.; Sah, K.; Raj, V.; Gupta, V. The role of vascular endothelial growth factor in proliferation of odontogenic cysts and tumors: An immunohistochemical study. Dent. Res. J. 2016, 13, 256–263. [Google Scholar] [CrossRef]
- Hefner, Y.; Borsch-Haubold, A.G.; Murakami, M.; Wilde, J.I.; Pasquet, S.; Schieltz, D.; Ghomashchi, F.; Yates, J.R., 3rd; Armstrong, C.G.; Paterson, A.; et al. Serine 727 phosphorylation and activation of cytosolic phospholipase A2 by MNK1-related protein kinases. J. Biol. Chem. 2000, 275, 37542–37551. [Google Scholar] [CrossRef] [Green Version]
- Pinto-Diez, C.; Ferreras-Martin, R.; Carrion-Marchante, R.; Gonzalez, V.M.; Martin, M.E. Deeping in the Role of the MAP-Kinases Interacting Kinases (MNKs) in Cancer. Int. J. Mol. Sci. 2020, 21, 2967. [Google Scholar] [CrossRef] [Green Version]
- Geisler, R.; Bergmann, A.; Hiromi, Y.; Nüsslein-Volhard, C. Cactus, a gene involved in dorsoventral pattern formation of Drosophila, is related to the IκB gene family of vertebrates. Cell 1992, 71, 613–621. [Google Scholar] [CrossRef]
- Li, C.; Chen, Y.X.; Zhang, S.; Lu, L.; Chen, Y.H.; Chai, J.; Weng, S.; Chen, Y.G.; He, J.; Xu, X. Identification, characterization, and function analysis of the Cactus gene from Litopenaeus vannamei. PLoS ONE 2012, 7, e49711. [Google Scholar] [CrossRef] [Green Version]
- Koc, A.; Batar, B.; Celik, O.; Onaran, I.; Tasan, E.; Sultuybek, G.K. Polymorphism of the NFKB1 affects the serum inflammatory levels of IL-6 in Hashimoto thyroiditis in a Turkish population. Immunobiology 2014, 219, 531–536. [Google Scholar] [CrossRef]
- Lee, J.H.; Giannikopoulos, P.; Duncan, S.A.; Wang, J.; Johansen, C.T.; Brown, J.D.; Plutzky, J.; Hegele, R.A.; Glimcher, L.H.; Lee, A.H. The transcription factor cyclic AMP-responsive element-binding protein H regulates triglyceride metabolism. Nat. Med. 2011, 17, 812–815. [Google Scholar] [CrossRef] [Green Version]
- Kikuchi, T.; Orihara, K.; Oikawa, F.; Han, S.I.; Kuba, M.; Okuda, K.; Satoh, A.; Osaki, Y.; Takeuchi, Y.; Aita, Y.; et al. Intestinal CREBH overexpression prevents high-cholesterol diet-induced hypercholesterolemia by reducing Npc1l1 expression. Mol. Metab. 2016, 5, 1092–1102. [Google Scholar] [CrossRef] [Green Version]
- Nakagawa, Y.; Wang, Y.; Han, S.I.; Okuda, K.; Oishi, A.; Yagishita, Y.; Kumagai, K.; Ohno, H.; Osaki, Y.; Mizunoe, Y.; et al. Enterohepatic Transcription Factor CREB3L3 Protects Atherosclerosis via SREBP Competitive Inhibition. Cell. Mol. Gastroenterol. Hepatol. 2021, 11, 949–971. [Google Scholar] [CrossRef]
- Khan, H.A.; Margulies, C.E. The Role of Mammalian Creb3-Like Transcription Factors in Response to Nutrients. Front. Genet. 2019, 10, 591. [Google Scholar] [CrossRef]
- Pradhan-Sundd, T. Making the Best of a Competition: The CREB3L3-SREBP Axis in Arteriosclerosis. Cell. Mol. Gastroenterol. Hepatol. 2021, 11, 1199–1201. [Google Scholar] [CrossRef]
- Herzig, S.; Hedrick, S.; Morantte, I.; Koo, S.H.; Galimi, F.; Montminy, M. CREB controls hepatic lipid metabolism through nuclear hormone receptor PPAR-gamma. Nature 2003, 426, 190–193. [Google Scholar] [CrossRef]
- Min, A.K.; Jeong, J.Y.; Go, Y.; Choi, Y.K.; Kim, Y.D.; Lee, I.K.; Park, K.G. cAMP response element binding protein H mediates fenofibrate-induced suppression of hepatic lipogenesis. Diabetologia 2013, 56, 412–422. [Google Scholar] [CrossRef] [Green Version]
- Furuhashi, M.; Hotamisligil, G.S. Fatty acid-binding proteins: Role in metabolic diseases and potential as drug targets. Nat. Rev. Drug Discov. 2008, 7, 489–503. [Google Scholar] [CrossRef] [Green Version]
- Lewis, C.A.; Brault, C.; Peck, B.; Bensaad, K.; Griffiths, B.; Mitter, R.; Chakravarty, P.; East, P.; Dankworth, B.; Alibhai, D.; et al. SREBP maintains lipid biosynthesis and viability of cancer cells under lipid- and oxygen-deprived conditions and defines a gene signature associated with poor survival in glioblastoma multiforme. Oncogene 2015, 34, 5128–5140. [Google Scholar] [CrossRef]
- Kuan, Y.C.; Hashidume, T.; Shibata, T.; Uchida, K.; Shimizu, M.; Inoue, J.; Sato, R. Heat Shock Protein 90 Modulates Lipid Homeostasis by Regulating the Stability and Function of Sterol Regulatory Element-binding Protein (SREBP) and SREBP Cleavage-activating Protein. J. Biol. Chem. 2017, 292, 3016–3028. [Google Scholar] [CrossRef] [Green Version]
- Kang, X.; Zhong, C.; Du, X.; Amevor, F.K.; Shah, A.M.; Zhu, Q.; Tian, Y.; Shu, G.; Wang, Y.; Zhao, X. Study on the role of heat shock protein 90 (HSP90) gene in chicken preadipocytes proliferation and differentiation. Anim. Biotechnol. 2022, 1–10. [Google Scholar] [CrossRef]
- Chen, H.Y.; Toullec, J.Y.; Lee, C.Y. The Crustacean Hyperglycemic Hormone Superfamily: Progress Made in the Past Decade. Front. Endocrinol. 2020, 11, 578958. [Google Scholar] [CrossRef]
- Zhang, B.; Li, C.; Luan, Y.; Lu, Y.; Hu, H.; Liu, Y.; Lu, K.; Zhang, G.; Dai, F.; Tong, X. The Role of Chitooligosaccharidolytic beta-N-Acetylglucosamindase in the Molting and Wing Development of the Silkworm Bombyx mori. Int. J. Mol. Sci. 2022, 23, 3850. [Google Scholar] [CrossRef]
Primer Name | Sequence (5′-3′) | Amplicon (bp) |
---|---|---|
PCR | ||
PvSREBP-F | CCATGGCTGATATCGGATCCATGAACTGGCCTGACCTGGACT | 1296 |
PvSREBP-R | TGGTGGTGGTGGTGCTCGAGTTAGTCAGCCATGGAACGTGCC | 1296 |
Real-time RT-PCR | ||
q-PvSREBP-R | GGAGTTGTTGTTGCCGTGG | 134 |
q-PvSREBP-F | TGGCTGAGATGTTGGTAATGG | 134 |
q-MNK-R | ATGCACGACTCGGCGAACAGC | 109 |
q-MNK-F | ACCATCCCTGGGTCAAGAACG | 109 |
q-NFκBIA-R | GTGCCGTCCGACCACTCTT | 140 |
q-NFκBIA-F | TGCCGCTGACCTTACCAAC | 140 |
q-FABP-R | CTCCTCGCCGAGCTTGATGGT | 103 |
q-FABP-F | CGCTAAGCCCGTGCTGGAAGT | 103 |
q-PFKFB2-R | CAAAGACAGCCACTTCACCC | 200 |
q-PFKFB2-F | CCTCAACTGGATCGGCATAA | 200 |
q-CREB3-R | TGGACAGGAAAGCCGTAGCA | 218 |
q-CREB3-F | GAACAACACCGCACCCACCC | 218 |
q-lectin-R | TGATTCCTCGCTCGCCCTAC | 120 |
q-lectin-F | CGCTCTTGCTGTCTGCCTGAT | 120 |
q-COX2-R | GTAGGCATTGAGGGTGATGTAG | 103 |
q-COX2-F | CCACAAGCGACTGATGACTTA | 103 |
q-HK-R | AGCCCATCACCAGGTCCAAT | 205 |
q-HK-F | AGTCCAACCCAGAGGCAACC | 205 |
q-NOS1-R | TCTCTCCCAGTTTCTTGGCGT | 104 |
q-NOS1-F | GAGCAAGTTATTCGGCAAGGC | 104 |
PvEF-1α-R | CCTTTTCTGCGGCCTTGGTAG | 118 |
PvEF-1α-F | TATGCTCCTTTTGGACGTTTTGC | 118 |
siRNA | ||
siPvSREBP-R | UUACGGUGUCGCCAGAAGCTT | 21 |
siPvSREBP-F | GCUUCUGGCGACACCGUAATT | 21 |
siNon-R | ACGUGACACGUUCGGAGAATT | 21 |
siNon-F | UUCUCCGAACGUGUCACGUTT | 21 |
Samples | siNon | siPvSREBP | All | ||||
---|---|---|---|---|---|---|---|
Sample 1 | Sample 2 | Sample 3 | Sample 1 | Sample 2 | Sample 3 | ||
Total raw reads | 54,785,178 | 55,921,570 | 59,798,448 | 57,139,776 | 56,119,540 | 53,573,230 | 337,337,742 |
Total clean reads | 54,359,728 | 55,495,942 | 59,370,008 | 56,723,546 | 55,719,248 | 53,186,974 | 334,855,446 |
Q20 percentage | 98.82% | 98.89% | 98.95% | 98.84% | 98.90% | 98.92% | |
GC percentage | 49.42% | 49.40% | 49.80% | 50.13% | 48.21% | 49.60% |
Description | Number |
---|---|
Assembly statistics | |
Number of transcripts | 41,345 |
Number of unigenes | 23,442 |
Functional annotation of unigenes | |
GO | 3516 |
KEGG | 9826 |
COG | 14,459 |
NR | 15,572 |
Swiss-Prot | 12,814 |
Pfam | 13,113 |
Total annotation | 16,084 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zheng, X.; Huang, Z.; Liu, Z.; Zheng, Z.; Zhang, Y.; Aweya, J.J. Transcriptome Analysis Reveals That SREBP Modulates a Large Repertoire of Genes Involved in Key Cellular Functions in Penaeus vannamei, although the Majority of the Dysregulated Genes Are Unannotated. Genes 2022, 13, 2057. https://doi.org/10.3390/genes13112057
Zheng X, Huang Z, Liu Z, Zheng Z, Zhang Y, Aweya JJ. Transcriptome Analysis Reveals That SREBP Modulates a Large Repertoire of Genes Involved in Key Cellular Functions in Penaeus vannamei, although the Majority of the Dysregulated Genes Are Unannotated. Genes. 2022; 13(11):2057. https://doi.org/10.3390/genes13112057
Chicago/Turabian StyleZheng, Xiaoyu, Zishu Huang, Zhuoyan Liu, Zhihong Zheng, Yueling Zhang, and Jude Juventus Aweya. 2022. "Transcriptome Analysis Reveals That SREBP Modulates a Large Repertoire of Genes Involved in Key Cellular Functions in Penaeus vannamei, although the Majority of the Dysregulated Genes Are Unannotated" Genes 13, no. 11: 2057. https://doi.org/10.3390/genes13112057