Mitochondrial tRNAGln 4394C>T Mutation May Contribute to the Clinical Expression of 1555A>G-Induced Deafness
Abstract
:1. Introduction
2. Materials and Methods
2.1. Subjects and Audiological Assessments
2.2. mtDNA Analysis
2.3. Data Analyses
2.4. Screening for Nuclear Gene Mutations
2.5. Generation of Cell Lines and Culture Conditions
2.6. ATP Analysis
2.7. Analysis of Mitochondrial Membrane Potential (MMP)
2.8. Mitochondrial Reactive Oxygen Species (ROS) Analysis
2.9. mtDNA Quantification
2.10. Measurement of mt-RNA Transcription
2.11. Assays of Activities of Respiratory Chain Complexes
2.12. Qualification of 8-Hydroxy-2′-Deoxyguanosine (8-OHdG)
2.13. Assigning Pathogenicity to the mt-tRNAGln Mutation
2.14. Computer Analysis
3. Results
3.1. Clinical Features of HZD055 and HZD510 Pedigrees
3.2. Detecting the Deafness-Associated mtDNA Mutations
3.3. Construction of Cybrid Cells from Two Chinese Families with AINSHL
3.4. Decreased in ATP Production
3.5. Reductions in MMP
3.6. The Increase in ROS Production
3.7. mtDNA Copy Number Decrease
3.8. Effect of the m.4394C>T Mutation on mt-RNA Transcription
3.9. Reduced Activities of Complexes I~IV
3.10. The m.4394C>T Mutation Increases DNA Damage
3.11. Mutational Screening for Common Deafness-Associated Nuclear Genes
3.12. Possible Pathogenic Effect of m.4394C>T in AINSHL
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Korver, A.M.; Smith, R.J.; Van Camp, G.; Schleiss, M.R.; Bitner-Glindzicz, M.A.; Lustig, L.R.; Usami, S.I.; Boudewyns, A.N. Congenital hearing loss. Nat. Rev. Dis. Prim. 2017, 3, 16094. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Willems, P.J. Genetic causes of hearing loss. N. Engl. J. Med. 2000, 342, 1101–1109. [Google Scholar] [CrossRef] [PubMed]
- Bitner-Glindzicz, M. Hereditary deafness and phenotyping in humans. Br. Med. Bull. 2002, 63, 73–94. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fischel-Ghodsian, N. Mitochondrial deafness mutations reviewed. Hum. Mutat. 1999, 13, 261–270. [Google Scholar] [CrossRef]
- Ding, Y.; Leng, J.; Fan, F.; Xia, B.; Xu, P. The role of mitochondrial DNA mutations in hearing loss. Biochem. Genet. 2013, 51, 588–602. [Google Scholar] [CrossRef]
- Kullar, P.J.; Gomez-Duran, A.; Gammage, P.A.; Garone, C.; Minczuk, M.; Golder, Z.; Wilson, J.; Montoya, J.; Häkli, S.; Kärppä, M.; et al. Heterozygous SSBP1 start loss mutation co-segregates with hearing loss and the m.1555A>G mtDNA variant in a large multigenerational family. Brain 2018, 141, 55–62. [Google Scholar] [CrossRef] [Green Version]
- Rahman, S.; Ecob, R.; Costello, H.; Sweeney, M.G.; Duncan, A.J.; Pearce, K.; Strachan, D.; Forge, A.; Davis, A.; Bitner-Glindzicz, M. Hearing in 44-45 year olds with m.1555A>G, a genetic mutation predisposing to aminoglycoside-induced deafness: A population based cohort study. BMJ Open 2012, 2, e000411. [Google Scholar] [CrossRef]
- Subathra, M.; Ramesh, A.; Selvakumari, M.; Karthikeyen, N.P.; Srisailapathy, C.R. Genetic Epidemiology of mitochondrial pathogenic variants causing nonsyndromic hearing loss in a large cohort of south Indian hearing impaired individuals. Ann. Hum. Genet. 2016, 80, 257–273. [Google Scholar] [CrossRef]
- Prezant, T.R.; Agapian, J.V.; Bohlman, M.C.; Bu, X.; Oztas, S.; Qiu, W.Q.; Arnos, K.S.; Cortopassi, G.A.; Jaber, L.; Rotter, J.I.; et al. Mitochondrial ribosomal RNA mutation associated with both antibiotic-induced and non-syndromic deafness. Nat. Genet. 1993, 4, 289–294. [Google Scholar] [CrossRef]
- Tang, X.; Yang, L.; Zhu, Y.; Liao, Z.; Wang, J.; Qian, Y.; Tao, Z.; Hu, L.; Wu, G.; Lan, J.; et al. Very low penetrance of hearing loss in seven Han Chinese pedigrees carrying the deafness-associated 12S rRNA A1555G mutation. Gene 2007, 393, 11–19. [Google Scholar] [CrossRef]
- Guan, M.X.; Fischel-Ghodsian, N.; Attardi, G. Nuclear background determines biochemical phenotype in the deafness-associated mitochondrial 12S rRNA mutation. Hum. Mol. Genet. 2001, 10, 573–580. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guan, M.X.; Fischel-Ghodsian, N.; Attardi, G. A biochemical basis for the inherited susceptibility to aminoglycoside ototoxicity. Hum. Mol. Genet. 2000, 9, 1787–1793. [Google Scholar] [CrossRef] [PubMed]
- Dillard, L.K.; Martinez, R.X.; Perez, L.L.; Fullerton, A.M.; Chadha, S.; McMahon, C.M. Prevalence of aminoglycoside-induced hearing loss in drug-resistant tuberculosis patients: A systematic review. J. Infect. 2021, 83, 27–36. [Google Scholar] [CrossRef]
- Adeyemo, A.; Faridi, R.; Chattaraj, P.; Yousaf, R.; Tona, R.; Okorie, S.; Bharadwaj, T.; Nouel-Saied, L.M.; Acharya, A.; Schrauwen, I.; et al. Genomic analysis of childhood hearing loss in the Yoruba population of Nigeria. Eur. J. Hum. Genet. 2022, 30, 42–52. [Google Scholar] [CrossRef] [PubMed]
- Lu, J.; Qian, Y.; Li, Z.; Yang, A.; Zhu, Y.; Li, R.; Yang, L.; Tang, X.; Chen, B.; Ding, Y.; et al. Mitochondrial haplotypes may modulate the phenotypic manifestation of the deafness-associated 12S rRNA 1555A>G mutation. Mitochondrion 2010, 10, 69–81. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Meng, F.; He, Z.; Tang, X.; Zheng, J.; Jin, X.; Zhu, Y.; Ren, X.; Zhou, M.; Wang, M.; Gong, S.; et al. Contribution of the tRNAIle 4317A→G mutation to the phenotypic manifestation of the deafness-associated mitochondrial 12S rRNA 1555A→G mutation. J. Biol. Chem. 2018, 293, 3321–3334. [Google Scholar] [CrossRef] [Green Version]
- Ding, Y.; Li, Y.; You, J.; Yang, L.; Chen, B.; Lu, J.; Guan, M.X. Mitochondrial tRNA(Glu) A14693G variant may modulate the phenotypic manifestation of deafness-associated 12S rRNA A1555G mutation in a Han Chinese family. J. Genet. Genom. 2009, 36, 241–250. [Google Scholar] [CrossRef]
- Chen, B.; Sun, D.; Yang, L.; Zhang, C.; Yang, A.; Zhu, Y.; Zhao, J.; Chen, Y.; Guan, M.; Wang, X.; et al. Mitochondrial ND5 T12338C, tRNA(Cys) T5802C, and tRNA(Thr) G15927A variants may have a modifying role in the phenotypic manifestation of deafness-associated 12S rRNA A1555G mutation in three Han Chinese pedigrees. Am. J. Med. Genet. A 2008, 146A, 1248–1258. [Google Scholar] [CrossRef]
- Qi, L.; Ping, L.; Xue-jun, D.; Guo-can, Y.; Qing, W.; Yu, D. A Novel Method for Detection the Deafness-Associated Mitochondrial A1555G and C1494T Mutations. Clin. Lab. 2016, 62, 477–481. [Google Scholar] [CrossRef]
- Ding, Y.; Lang, J.; Zhang, J.; Xu, J.; Lin, X.; Lou, X.; Zheng, H.; Huai, L. Screening for deafness-associated mitochondrial 12S rRNA mutations by using a multiplex allele-specific PCR method. Biosci. Rep. 2020, 40, BSR20200778. [Google Scholar] [CrossRef]
- Kong, Q.P.; Bandelt, H.J.; Sun, C.; Yao, Y.G.; Salas, A.; Achilli, A.; Wang, C.Y.; Zhong, L.; Zhu, C.L.; Wu, S.F.; et al. Updating the East Asian mtDNA phylogeny: A prerequisite for the identification of pathogenic mutations. Hum. Mol. Genet. 2006, 15, 2076–2086. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yasukawa, T.; Hino, N.; Suzuki, T.; Watanabe, K.; Ueda, T.; Ohta, S. A pathogenic point mutation reduces stability of mitochondrial mutant tRNA(Ile). Nucleic Acids Res. 2000, 28, 3779–3784. [Google Scholar] [CrossRef] [PubMed]
- Degoul, F.; Brulé, H.; Cepanec, C.; Helm, M.; Marsac, C.; Leroux, J.; Giegé, R.; Florentz, C. Isoleucylation properties of native human mitochondrial tRNAIle and tRNAIle transcripts. Implications for cardiomyopathy-related point mutations (4269, 4317) in the tRNAIle gene. Hum. Mol. Genet. 1998, 7, 347–354. [Google Scholar] [CrossRef] [Green Version]
- Yu, X.; Li, S.; Ding, Y. Maternally transmitted nonsyndromic hearing impairment may be associated with mitochondrial tRNAAla 5601C>T and tRNALeu(CUN) 12311T>C mutations. J. Clin. Lab. Anal. 2022, 36, e24298. [Google Scholar] [CrossRef] [PubMed]
- Mazzoli, M.; Guy Van, C.; Newton, V.; Giarbini, N. Recommendations for the Description of Genetic and Audiological Data for Families with Nonsyndromic Hereditary Hearing Impairment. Audiol. Med. 2009, 1, 148–150. [Google Scholar] [CrossRef]
- Ding, Y.; Teng, Y.S.; Zhuo, G.C.; Xia, B.H.; Leng, J.H. The Mitochondrial tRNAHis G12192A Mutation May Modulate the Clinical Expression of Deafness-Associated tRNAThr G15927A Mutation in a Chinese Pedigree. Curr. Mol. Med. 2019, 19, 136–146. [Google Scholar] [CrossRef]
- Zhang, J.; Lu, B.; Xia, W.W.; Fang, B.; Ding, X.X.; Hu, G.W. The mitochondrial transfer RNAAsp A7551G mutation may contribute to the clinical expression of deafness associated with the A1555G mutation in a pedigree with hearing impairment. Mol. Med. Rep. 2019, 19, 1797–1802. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Andrews, R.M.; Kubacka, I.; Chinnery, P.F.; Lightowlers, R.N.; Turnbull, D.M.; Howell, N. Reanalysis and revision of the Cambridge reference sequence for human mitochondrial DNA. Nat. Genet. 1999, 23, 147. [Google Scholar] [CrossRef] [PubMed]
- Levin, L.; Zhidkov, I.; Gurman, Y.; Hawlena, H.; Mishmar, D. Functional recurrent mutations in the human mitochondrial phylogeny: Dual roles in evolution and disease. Genome Biol. Evol. 2013, 5, 876–890. [Google Scholar] [CrossRef] [PubMed]
- Van Oven, M.; Kayser, M. Updated comprehensive phylogenetic tree of global human mitochondrial DNA variation. Hum. Mutat. 2009, 30, E386–E394. [Google Scholar] [CrossRef]
- Yang, L.; Guo, Q.; Leng, J.; Wang, K.; Ding, Y. Late onset of type 2 diabetes is associated with mitochondrial tRNATrp A5514G and tRNASer(AGY) C12237T mutations. J. Clin. Lab. Anal. 2022, 36, e24102. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Li, C.; Li, M.; Zhao, Z.; Tian, S.; Xia, H.; Liu, P.; Han, Y.; Ren, R.; Chen, J.; et al. Mutation analysis of common deafness genes among 1,201 patients with non-syndromic hearing loss in Shanxi Province. Mol. Genet. Genom. Med. 2019, 7, e537. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- King, M.P.; Attadi, G. Mitochondria-mediated transformation of human rho(0) cells. Methods Enzymol. 1996, 264, 13–34. [Google Scholar] [CrossRef]
- Ding, Y.; Xia, B.H.; Zhuo, G.C.; Zhang, C.J.; Leng, J.H. Premature ovarian insufficiency may be associated with the mutations in mitochondrial tRNA genes. Endocr. J. 2019, 6, 81–88. [Google Scholar] [CrossRef] [Green Version]
- Perelman, A.; Wachtel, C.; Cohen, M.; Haupt, S.; Shapiro, H.; Tzur, A. JC-1: Alternative excitation wavelengths facilitate mitochondrial membrane potential cytometry. Cell Death Dis. 2012, 3, e430. [Google Scholar] [CrossRef] [Green Version]
- Reers, M.; Smiley, S.T.; Mottola-Hartshorn, C.; Chen, A.; Lin, M.; Chen, L.B. Mitochondrial membrane potential monitored by JC-1 dye. Methods Enzymol. 1995, 260, 406–417. [Google Scholar] [CrossRef]
- Ding, Y.; Xia, B.H.; Zhang, C.J.; Zhuo, G.C. Mitochondrial tRNALeu(UUR) C3275T, tRNAGln T4363C and tRNALys A8343G mutations may be associated with PCOS and metabolic syndrome. Gene 2018, 642, 299–306. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Chen, D.; Zhao, Q.; Xiong, J.; Lou, X.; Han, Q.; Wei, X.; Xie, J.; Li, X.; Zhou, H.; Shen, L.; et al. Systematic analysis of a mitochondrial disease-causing ND6 mutation in mitochondrial deficiency. Mol. Genet. Genom. Med. 2020, 8, e1199. [Google Scholar] [CrossRef]
- Chen, J.W.; Ma, P.W.; Yuan, H.; Wang, W.L.; Lu, P.H.; Ding, X.R.; Lun, Y.Q.; Yang, Q.; Lu, L.J. mito-TEMPO Attenuates Oxidative Stress and Mitochondrial Dysfunction in Noise-Induced Hearing Loss via Maintaining TFAM-mtDNA Interaction and Mitochondrial Biogenesis. Front. Cell. Neurosci. 2022, 16, 803718. [Google Scholar] [CrossRef]
- Yarham, J.W.; Al-Dosary, M.; Blakely, E.L.; Alston, C.L.; Taylor, R.W.; Elson, J.L.; McFarland, R. A comparative analysis approach to determining the pathogenicity of mitochondrial tRNA mutations. Hum. Mutat. 2011, 32, 1319–1325. [Google Scholar] [CrossRef] [PubMed]
- Gadaleta, G.; Pepe, G.; De Candia, G.; Quagliariello, C.; Sbisà, E.; Saccone, C. The complete nucleotide sequence of the Rattus norvegicus mitochondrial genome: Cryptic signals revealed by comparative analysis between vertebrates. J. Mol. Evol. 1989, 28, 497–516. [Google Scholar] [CrossRef] [PubMed]
- Bibb, M.J.; Van Etten, R.A.; Wright, C.T.; Walberg, M.W.; Clayton, D.A. Sequence and gene organization of mouse mitochondrial DNA. Cell 1981, 26, 167–180. [Google Scholar] [CrossRef]
- Roe, B.A.; Ma, D.P.; Wilson, R.K.; Wong, J.F. The complete nucleotide sequence of the Xenopus laevis mitochondrial genome. J. Biol. Chem. 1985, 260, 9759–9774. [Google Scholar] [CrossRef]
- Esmekaya, M.A.; Canseven, A.G.; Kayhan, H.; Tuysuz, M.Z.; Sirav, B.; Seyhan, N. Mitochondrial hyperpolarization and cytochrome-c release in microwave-exposed MCF-7 cells. Gen. Physiol. Biophys. 2017, 36, 211–218. [Google Scholar] [CrossRef]
- Sena, L.A.; Chandel, N.S. Physiological roles of mitochondrial reactive oxygen species. Mol. Cell. 2012, 48, 158–167. [Google Scholar] [CrossRef] [Green Version]
- Castellani, C.A.; Longchamps, R.J.; Sun, J.; Guallar, E.; Arking, D.E. Thinking outside the nucleus: Mitochondrial DNA copy number in health and disease. Mitochondrion 2020, 53, 214–223. [Google Scholar] [CrossRef]
- Qian, Y.; Guan, M.X. Interaction of aminoglycosides with human mitochondrial 12S rRNA carrying the deafness-associated mutation. Antimicrob. Agents Chemother. 2009, 53, 4612–4618. [Google Scholar] [CrossRef] [Green Version]
- Chen, C.; Chen, Y.; Guan, M.X. A peep into mitochondrial disorder: Multifaceted from mitochondrial DNA mutations to nuclear gene modulation. Protein Cell 2015, 6, 862–870. [Google Scholar] [CrossRef] [Green Version]
- Fischel-Ghodsian, N. Genetic factors in aminoglycoside toxicity. Pharmacogenomics 2005, 6, 27–36. [Google Scholar] [CrossRef]
- Guan, M.X.; Fischel-Ghodsian, N.; Attardi, G. Biochemical evidence for nuclear gene involvement phenotype of non-syndromic deafness associated with mitochondrial 12 S rRNA mutation. Hum. Mol. Genet. 1996, 5, 963–971. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bai, Y.; Wang, Z.; Dai, W.; Li, Q.; Chen, G.; Cong, N.; Guan, M.; Li, H. A six-generation Chinese family in haplogroup B4C1C exhibits high penetrance of 1555A > G-induced hearing Loss. BMC Med. Genet. 2010, 11, 129. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ying, Z.; Zheng, J.; Cai, Z.; Liu, L.; Dai, Y.; Yao, J.; Wang, H.; Gao, Y.; Zheng, B.; Tang, X.; et al. Mitochondrial haplogroup B increases the risk for hearing loss among the Eastern Asian pedigrees carrying 12S rRNA 1555A>G mutation. Protein Cell 2015, 6, 844–848. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, T.; Liu, Q.; Jiang, L.; Liu, C.; Ou, Q. Mitochondrial COX2 G7598A mutation may have a modifying role in the phenotypic manifestation of aminoglycoside antibiotic-induced deafness associated with 12S rRNA A1555G mutation in a Han Chinese pedigree. Genet. Test Mol. Biomark. 2013, 17, 122–130. [Google Scholar] [CrossRef]
- Merante, F.; Tein, I.; Benson, L.; Robinson, B.H. Maternally inherited hypertrophic cardiomyopathy due to a novel T-to-C transition at nucleotide 9997 in the mitochondrial tRNA(glycine) gene. Am. J. Hum. Genet. 1994, 55, 437–446. [Google Scholar]
- Kaido, M.; Fujimura, H.; Taniike, M.; Yoshikawa, H.; Toyooka, K.; Yorifuji, S.; Inui, K.; Okada, S.; Sparaco, M.; Yanagihara, T. Focal cytochrome c oxidase deficiency in the brain and dorsal root ganglia in a case with mitochondrial encephalomyopathy (tRNA(Ile) 4269 mutation): Histochemical, immunohistochemical, and ultrastructural study. J. Neurol. Sci. 1995, 131, 170–176. [Google Scholar] [CrossRef]
- Houstek, J.; Klement, P.; Floryk, D.; Antonická, H.; Hermanská, J.; Kalous, M.; Hansíková, H.; Hout’ková, H.; Chowdhury, S.K.; Rosipal, T.; et al. A novel deficiency of mitochondrial ATPase of nuclear origin. Hum. Mol. Genet. 1999, 8, 1967–1974. [Google Scholar] [CrossRef] [Green Version]
- Mohamed, M.S.; Abdelhamid, A.O.; Almutairi, F.M.; Ali, A.G.; Bishr, M.K. Induction of apoptosis by pyrazolo[3,4-d]pyridazine derivative in lung cancer cells via disruption of Bcl-2/Bax expression balance. Bioorg. Med. Chem. 2018, 26, 623–629. [Google Scholar] [CrossRef]
- Pfanner, N.; Craig, E.A.; Meijer, M. The protein import machinery of the mitochondrial inner membrane. Trends Biochem. Sci. 1994, 19, 368–372. [Google Scholar] [CrossRef]
- Yamaki, M.; Umehara, T.; Chimura, T.; Horikoshi, M. Cell death with predominant apoptotic features in Saccharomyces cerevisiae mediated by deletion of the histone chaperone ASF1/CIA1. Genes Cells 2001, 6, 1043–1054. [Google Scholar] [CrossRef]
- Clay Montier, L.L.; Deng, J.J.; Bai, Y. Number matters: Control of mammalian mitochondrial DNA copy number. J. Genet. Genom. 2009, 36, 125–131. [Google Scholar] [CrossRef]
- Fontana, G.A.; Gahlon, H.L. Mechanisms of replication and repair in mitochondrial DNA deletion formation. Nucleic Acids Res. 2020, 48, 11244–11258. [Google Scholar] [CrossRef] [PubMed]
- Mao, M.; Zhang, T.; Wang, Z.; Wang, H.; Xu, J.; Yin, F.; Wang, G.; Sun, M.; Wang, Z.; Hua, Y.; et al. Glaucocalyxin A-induced oxidative stress inhibits the activation of STAT3 signaling pathway and suppresses osteosarcoma progression in vitro and in vivo. Biochim. Biophys. Acta Mol. Basis Dis. 2019, 1865, 1214–1225. [Google Scholar] [CrossRef] [PubMed]
- D’Autréaux, B.; Toledano, M.B. ROS as signalling molecules: Mechanisms that generate specificity in ROS homeostasis. Nat. Rev. Mol. Cell Biol. 2007, 8, 813–824. [Google Scholar] [CrossRef] [PubMed]
- Brieger, K.; Schiavone, S.; Miller, F.J., Jr.; Krause, K.H. Reactive oxygen species: From health to disease. Swiss Med. Wkly. 2012, 142, w13659. [Google Scholar] [CrossRef]
- Wang, M.; Liu, H.; Zheng, J.; Chen, B.; Zhou, M.; Fan, W.; Wang, H.; Liang, X.; Zhou, X.; Eriani, G.; et al. A Deafness- and Diabetes-associated tRNA Mutation Causes Deficient Pseudouridinylation at Position 55 in tRNAGlu and Mitochondrial Dysfunction. J. Biol. Chem. 2016, 291, 21029–21041. [Google Scholar] [CrossRef]
Locus | Starting | Ending | Length (bp) | Forward (5′-3′) | Reverse (5′-3′) |
---|---|---|---|---|---|
ND1 | 3307 | 4262 | 956 | CCCATGGCCAACCTCCTACTCCTC | AGCCCGTAGGGGCCTACAACG |
ND2 | 4470 | 5511 | 1042 | AACCCTCGTTCCACAGAAGCT | GGATTATGGATGCGGTTGCT |
ND3 | 10059 | 10404 | 346 | ACGAGTGCGGCTTCGACCCT | TCACTCATAGGCCAGACTTAGGGCT |
ND4 | 10760 | 12137 | 1377 | CCCACTCCCTCTTAGCCAATATT | TAGGCCCACCGCTGCTT |
ND5 | 12337 | 14148 | 1812 | TGCTCCGGGTCCATCATC | TGAGTAGTCCTCCTATTTTTCGAATATCT |
ND6 | 14149 | 14673 | 525 | GCCCCCGCACCAATAGGATCCTCCC | CCTGAGGCATGGGGGTCAGGGGT |
CO1 | 5904 | 7445 | 1542 | GCCCCCGATATGGCGTTTCCCCGCA | GGGGTCTCCTCCTCCGGCGGGGTCG |
CO2 | 7586 | 8269 | 684 | ACCAGGCGACCTGCGACTCCT | ACCCCCGGTCGTGTAGCGGT |
CO3 | 9207 | 9990 | 784 | CCCCCAACAGGCATCACCCCGC | ATGCCAGTATCAGGCGGCGGC |
A8 | 8366 | 8572 | 207 | CCCACCATAATTACCCCCATACT | GGTAGGTGGTAGTTTGTGTTTAATATTTTTAG |
A6 | 8527 | 9207 | 681 | TTATGAGCGGGCACAGTGATT | GAAGTGGGCTAGGGCATTTTT |
CytB | 14747 | 15887 | 1141 | CCCACCCTCACACGATTCTTTA | TTGCTAGGGCTGCAATAATGAA |
Subject | Sex | Age at Test (Year) | Age at Onset (Year) | Use of AmAn | PTA (Right Ear) (dB) | PTA (Left Ear) (dB) | Level of Hearing Impairment | Audiometric Configuration | Presence of Functional mtDNA Mutations |
---|---|---|---|---|---|---|---|---|---|
HZD055: II-8 | Female | 66 | 31 | Gentamycin | 105 | 70 | Profound | Slop | m.1555A>G |
HZD055: III-4 | Female | 42 | 20 | Kanamycin | 21 | 92 | Severe | Slop | m.1555A>G |
HZD055: III-7 | Female | 38 | 19 | Gentamycin | 106 | 86 | Profound | Slop | m.1555A>G |
HZD510: II-6 | Female | 50 | 45 | No | 30 | 30 | Mild | Flat | m.1555A>G and m.4394C>T |
HZD510: II-8 | Female | 49 | 22 | Gentamycin | 54 | 57 | Moderate | Slop | m.1555A>G and m.4394C>T |
HZD510: III-7 | Female | 25 | 24 | No | 85 | 71 | Severe | Slop | m.1555A>G and m.4394C>T |
HZD055:II-6 (C1) | Female | 44 | / | No | 18 | 20 | Normal | Flat | None |
HZD055:III-1 (C2) | Male | 20 | / | No | 16 | 18 | Normal | Flat | None |
HZD055:III-3 (C3) | Male | 15 | / | No | 13 | 17 | Normal | Flat | None |
Gene | Position | Alternations (Amino Acid) | Conservation (H/B/M/X) a | rCRS b | HZD055 | HZD510 | Previously Reported c |
---|---|---|---|---|---|---|---|
D-loop | 73 | A→G | A | G | G | Yes | |
143 | G→A | G | A | Yes | |||
152 | T→C | T | C | Yes | |||
195 | T→C | T | C | Yes | |||
263 | A→G | A | G | G | Yes | ||
310 | T→CTC | T | TC | CTC | Yes | ||
489 | T→C | T | C | C | Yes | ||
16051 | A→G | A | G | Yes | |||
16129 | G→A | G | A | Yes | |||
16183 | A→C | A | C | Yes | |||
16188 | C→T | C | T | Yes | |||
16223 | C→T | C | T | T | Yes | ||
16311 | T→C | T | C | C | Yes | ||
16362 | T→C | T | C | Yes | |||
12S rRNA | 709 | G→A | G/A/A/- | G | A | Yes | |
750 | A→G | A/A/G/- | A | G | G | Yes | |
1438 | A→G | A/A/A/G | A | G | G | Yes | |
1555 | A→G | A/A/A/A | A | G | G | Yes | |
16S rRNA | 2706 | A→G | A/G/A/A | A | G | G | Yes |
3010 | G→A | G/G/A/A | G | A | Yes | ||
3107 | N del | N | N del | Yes | |||
ND1 | 3483 | G→A | G | A | Yes | ||
3970 | C→T | C | T | Yes | |||
tRNAGln | 4394 | C→T | C/C/C/C | C | T | Yes | |
ND2 | 4491 | G→A (Val→Ile) | V/I/I/V | G | A | Yes | |
4769 | A→G | A | G | G | Yes | ||
4883 | C→T | C | T | T | Yes | ||
4985 | G→A | G | A | Yes | |||
5178 | C→A (Leu→Met) | L/T/T/T | C | A | A | Yes | |
5231 | G→A | G | A | Yes | |||
5417 | G→A | G | A | Yes | |||
COI | 5978 | A→G | A | G | Yes | ||
6392 | T→C | T | C | Yes | |||
7028 | C→T | C | T | T | Yes | ||
COII | 7976 | G→A (Gly→Ser) | G/G/S/G | G | A | Yes | |
NC_7 | 8271–79 | 9-bp del | 9-bp del | Yes | |||
A8 | 8414 | C→T (Leu→Phe) | L/F/M/W | C | T | T | Yes |
8584 | G→A (Ala→Thr) | A/V/V/I | G | A | Yes | ||
A6 | 8701 | A→G (Thr→Ala) | T/S/L/Q | A | G | G | Yes |
8860 | A→G (Thr→Ala) | T/A/A/T | A | G | G | Yes | |
CO3 | 9428 | T→C | T | C | Yes | ||
9540 | T→C | T | C | C | Yes | ||
9755 | G→A | G | A | Yes | |||
9950 | T→C | T | C | Yes | |||
ND3 | 10398 | A→G (Thr→Ala) | T/T/T/A | T | G | G | Yes |
10400 | C→T | C | T | T | Yes | ||
ND4 | 10873 | T→C | T | C | C | Yes | |
11050 | T→C | T | C | Yes | |||
11059 | C→T | C | T | Yes | |||
11719 | G→A | G | A | A | Yes | ||
11968 | A→T | A | T | Yes | |||
ND5 | 12358 | A→G | A | G | Yes | ||
12705 | C→T | C | T | T | Yes | ||
12711 | G→A | G | A | Yes | |||
12825 | T→C | T | C | Yes | |||
ND6 | 14668 | C→T | C | T | Yes | ||
CytB | 14766 | C→T (Thr→Ile) | T/S/I/S | C | T | T | Yes |
14783 | T→C | T | C | C | Yes | ||
15043 | G→A | G | A | A | Yes | ||
15301 | G→A | G | A | A | Yes | ||
15326 | A→G (Thr→Ala) | T/M/I/I | A | G | G | Yes | |
15784 | T→C | T | C | Yes |
Scoring Criteria | m.4394C>T Mutation | Score/20 | Classification |
---|---|---|---|
More than one independent report | Yes | 2 | ≤6 points: neutral polymorphisms; 7~10 points: possibly pathogenic; 11–13 points (not including evidence from the single-fiber, steady-state level or from trans-mitochondrial cybrid studies): probably pathogenic ≥11 points (including evidence from the single-fiber, steady-state level or from trans-mitochondrial cybrid studies): definitely pathogenic |
Evolutionary conservation of the base pair | No changes | 2 | |
Variant heteroplasmy | No | 0 | |
Segregation of the mutation with disease | Yes | 2 | |
Histochemical evidence of mitochondrial disease | No evidence | 0 | |
Biochemical defect in complex I, III or IV | Yes | 2 | |
Evidence of mutation segregation with biochemical defect from single-fiber studies | No | 0 | |
Mutant mt-tRNA steady-state level or evidence of pathogenicity in trans-mitochondrial cybrid studies | No evidence | 0 | |
Maximum score | Possibly pathogenic | 8 |
Pedigree Name | Number of Matrilineal Relatives | Penetrance of Hearing Loss (Including AmAn) (%) | Penetrance of Hearing Loss (Excluding AmAn) (%) | Primary mtDNA Mutation | Functional mtDNA Mutations | mtDNA Haplogroup | References |
---|---|---|---|---|---|---|---|
HZD055 | 10 | 30 | 0 | 1555A>G | None | D4g2a | This study |
HZD510 | 10 | 50 | 10 | 1555A>G | tRNAGln 4394C>T | D4g2a | This study |
HZD501 | 9 | 22.2 | 11.1 | 1555A>G | tRNACys 5802T>C | D4b2b | 20 |
HZD502 | 8 | 37.5 | 12.5 | 1555A>G | tRNAThr 15930G>A | K1a | 20 |
HZD503 | 7 | 42.8 | 14.3 | 1494C>T | tRNALys 8343A>G | B4b1c | 20 |
WZD91 | 23 | 73.9 | 60.8 | 1555A>G | tRNAIle 4317A>G | B4 | 16 |
P206 | 7 | 71.4 | 28.6 | 1555A>G | CO2 7598G>A | M7b1 | 54 |
WZD11 | 19 | 53 | 42 | 1555A>G | ND4 11696G>A | D4 | 15 |
WZD12 | 12 | 58 | 25 | 1555A>G | CO1/tRNASer(UCN) 7444G>A | B4c1 | 15 |
WZD40 | 20 | 30 | 25 | 1555A>G | ND5 12338T>C | F2 | 15 |
WZD50 | 15 | 53.3 | 46.7 | 1555A>G | tRNASer(AGY) 12224C>T | D5 | 15 |
WZD32 | 12 | 66.7 | 41.7 | 1555A>G | tRNAThr 15927G>A | B5b1 | 15 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ding, Y.; Teng, Y.; Guo, Q.; Leng, J. Mitochondrial tRNAGln 4394C>T Mutation May Contribute to the Clinical Expression of 1555A>G-Induced Deafness. Genes 2022, 13, 1794. https://doi.org/10.3390/genes13101794
Ding Y, Teng Y, Guo Q, Leng J. Mitochondrial tRNAGln 4394C>T Mutation May Contribute to the Clinical Expression of 1555A>G-Induced Deafness. Genes. 2022; 13(10):1794. https://doi.org/10.3390/genes13101794
Chicago/Turabian StyleDing, Yu, Yaoshu Teng, Qinxian Guo, and Jianhang Leng. 2022. "Mitochondrial tRNAGln 4394C>T Mutation May Contribute to the Clinical Expression of 1555A>G-Induced Deafness" Genes 13, no. 10: 1794. https://doi.org/10.3390/genes13101794