Advancing Genetic Tools in Streptococcus pneumoniae
Abstract
:1. Introduction
2. Materials and Methods
2.1. Growth Conditions
2.2. Genomic DNA Extraction
2.3. PCR Amplification and Transformation
2.4. Generation of Streptomycin Resistant Strains
2.5. Replacement of Capsule Locus with Sweet Janus and NewSweet Janus Cassette
2.6. Allelic Replacement Efficacy
2.7. Allelic Replacement Efficacy of spxB
2.8. Construction of Novel Markerless Cassettes for Allelic Replacement of Capsule Locus
3. Results
3.1. Variances in Frequency of False-Positive Transformant Colonies
3.2. Potential Reversion Necessitates Initial Screening for Mass Application
3.3. Generation of Novel Markerless Cassettes
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Henriques-Normark, B.; Tuomanen, E.I. The pneumococcus: Epidemiology, microbiology, and pathogenesis. Cold Spring Harb. Perspect. Med. 2013. [Google Scholar] [CrossRef]
- Wyres, K.L.; Lambertsen, L.M.; Croucher, N.J.; McGee, L.; von Gottberg, A.; Linares, J.; Jacobs, M.R.; Kristinsson, K.G.; Beall, B.W.; Klugman, K.P.; et al. Pneumococcal capsular switching: A historical perspective. J. Infect. Dis. 2013, 207, 439–449. [Google Scholar] [CrossRef] [Green Version]
- Salvadori, G.; Junges, R.; Morrison, D.A.; Petersen, F.C. Competence in Streptococcus pneumoniae and Close Commensal Relatives: Mechanisms and Implications. Front. Cell. Infect. Microbiol. 2019, 9, 94. [Google Scholar] [CrossRef] [Green Version]
- Daniels, C.C.; Rogers, P.D.; Shelton, C.M. A Review of Pneumococcal Vaccines: Current Polysaccharide Vaccine Recommendations and Future Protein Antigens. J. Pediatr. Pharmacol. Ther. 2016, 21, 27–35. [Google Scholar] [CrossRef]
- Kim, G.L.; Seon, S.H.; Rhee, D.K. Pneumonia and Streptococcus pneumoniae vaccine. Arch. Pharm. Res. 2017, 40, 885–893. [Google Scholar] [CrossRef]
- Ramirez, M.; Morrison, D.A.; Tomasz, A. Ubiquitous distribution of the competence related genes comA and comC among isolates of Streptococcus pneumoniae. Microb. Drug Resist. 1997, 3, 39–52. [Google Scholar] [CrossRef]
- Sung, C.K.; Li, H.; Claverys, J.P.; Morrison, D.A. An rpsL cassette, janus, for gene replacement through negative selection in Streptococcus pneumoniae. Appl. Environ. Microbiol. 2001, 67, 5190–5196. [Google Scholar] [CrossRef] [Green Version]
- Trzcinski, K.; Thompson, C.M.; Lipsitch, M. Construction of otherwise isogenic serotype 6B, 7F, 14, and 19F capsular variants of Streptococcus pneumoniae strain TIGR4. Appl. Environ. Microbiol. 2003, 69, 7364–7370. [Google Scholar] [CrossRef] [Green Version]
- Bartual, S.G.; Straume, D.; Stamsas, G.A.; Munoz, I.G.; Alfonso, C.; Martinez-Ripoll, M.; Havarstein, L.S.; Hermoso, J.A. Structural basis of PcsB-mediated cell separation in Streptococcus pneumoniae. Nat. Commun. 2014, 5, 1–12. [Google Scholar] [CrossRef] [Green Version]
- Matthias, K.A.; Roche, A.M.; Standish, A.J.; Shchepetov, M.; Weiser, J.N. Neutrophil-toxin interactions promote antigen delivery and mucosal clearance of Streptococcus pneumoniae. J. Immunol. 2008, 180, 6246–6254. [Google Scholar] [CrossRef] [Green Version]
- Li, Y.; Thompson, C.M.; Lipsitch, M. A modified Janus cassette (Sweet Janus) to improve allelic replacement efficiency by high-stringency negative selection in Streptococcus pneumoniae. PLoS ONE 2014, 9, e100510. [Google Scholar] [CrossRef] [Green Version]
- Echlin, H.; Frank, M.W.; Iverson, A.; Chang, T.C.; Johnson, M.D.; Rock, C.O.; Rosch, J.W. Pyruvate Oxidase as a Critical Link between Metabolism and Capsule Biosynthesis in Streptococcus pneumoniae. PLoS Pathog. 2016, 12, e1005951. [Google Scholar] [CrossRef] [Green Version]
- Wang, C.Y.; Medlin, J.S.; Nguyen, D.R.; Disbennett, W.M.; Dawid, S. Molecular Determinants of Substrate Selectivity of a Pneumococcal Rgg-Regulated Peptidase-Containing ABC Transporter. mBio 2020, 11. [Google Scholar] [CrossRef] [Green Version]
- Tothpal, A.; Desobry, K.; Joshi, S.S.; Wyllie, A.L.; Weinberger, D.M. Variation of growth characteristics of pneumococcus with environmental conditions. BMC Microbiol. 2019, 19, 1–8. [Google Scholar] [CrossRef] [Green Version]
- Vimberg, V.; Zieglerova, L.; Buriankova, K.; Branny, P.; Balikova Novotna, G. VanZ Reduces the Binding of Lipoglycopeptide Antibiotics to Staphylococcus aureus and Streptococcus pneumoniae Cells. Front. Microbiol. 2020, 11, 566. [Google Scholar] [CrossRef]
- Lacks, S.; Hotchkiss, R.D. A study of the genetic material determining enzyme in the pneumococcus. Biochim. Biophys. Acta 1960, 39, 508–517. [Google Scholar] [CrossRef]
- Horton, R.M.; Cai, Z.L.; Ho, S.N.; Pease, L.R. Gene splicing by overlap extension: Tailor-made genes using the polymerase chain reaction. Biotechniques 1990, 8, 528–535. [Google Scholar] [CrossRef] [Green Version]
- Pozzi, G.; Masala, L.; Iannelli, F.; Manganelli, R.; Havarstein, L.S.; Piccoli, L.; Simon, D.; Morrison, D.A. Competence for genetic transformation in encapsulated strains of Streptococcus pneumoniae: Two allelic variants of the peptide pheromone. J. Bacteriol. 1996, 178, 6087–6090. [Google Scholar] [CrossRef] [Green Version]
- Martin-Galiano, A.J.; de la Campa, A.G. High-efficiency generation of antibiotic-resistant strains of Streptococcus pneumoniae by PCR and transformation. Antimicrob. Agents Chemother. 2003, 47, 1257–1261. [Google Scholar] [CrossRef] [Green Version]
- Gurung, I.; Berry, J.L.; Hall, A.M.J.; Pelicic, V. Cloning-independent markerless gene editing in Streptococcus sanguinis: Novel insights in type IV pilus biology. Nucleic Acids Res. 2017, 45, e40. [Google Scholar] [CrossRef]
- Salles, C.; Creancier, L.; Claverys, J.P.; Mejean, V. The high level streptomycin resistance gene from Streptococcus pneumoniae is a homologue of the ribosomal protein S12 gene from Escherichia coli. Nucleic Acids Res. 1992, 20, 6103. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Khetrapal, V.; Mehershahi, K.; Rafee, S.; Chen, S.; Lim, C.L.; Chen, S.L. A set of powerful negative selection systems for unmodified Enterobacteriaceae. Nucleic Acids Res. 2015, 43, e83. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xin, Y.; Guo, T.; Mu, Y.; Kong, J. Development of a counterselectable seamless mutagenesis system in lactic acid bacteria. Microb. Cell Fact. 2017, 16, 1–13. [Google Scholar] [CrossRef]
- Dalia, A.B.; McDonough, E.; Camilli, A. Multiplex genome editing by natural transformation. Proc. Natl. Acad. Sci. USA 2014, 111, 8937–8942. [Google Scholar] [CrossRef] [Green Version]
Strain | Description | Source |
---|---|---|
SPNYL001 | Capsule locus replaced with Sweet Janus | Li, et al. 11 |
TIGR4 | TIGR4 wild type, serotype 4 | |
TIGR4S | TIGR4 with K56T mutation in rpsL (Sp_0271) | This study |
TIGR4SΔcps::SweetJanus | Capsule locus replaced with Sweet Janus | This study |
TIGR4SΔcps::NewSweetJanus | Capsule locus replaced with NewSweet Janus | This study |
TIGR4SΔcps::PhunJanus | Capsule locus replaced with Phun Janus | This study |
TIGR4SΔcps::PhunSweetJanus | Capsule locus replaced with PhunSweet Janus | This study |
TIGR4Δcps::PhunSweet | Capsule locus replaced with PhunSweet | This study |
TIGR4Δcps::Phun | Capsule locus replaced with Phun | This study |
D39 | D39 wild type, serotype 2 | |
D39S | D39 with K56T mutation in rpsL (Sp_0251) | This study |
D39SΔcps::SweetJanus | Capsule locus replaced with Sweet Janus | This study |
D39SΔcps::NewSweetJanus | Capsule locus replaced with NewSweet Janus | This study |
D39SΔcps::PhunJanus | Capsule locus replaced with Phun Janus | This study |
D39SΔcps::PhunSweetJanus | Capsule locus replaced with PhunSweet Janus | This study |
D39Δcps::PhunSweet | Capsule locus replaced with PhunSweet | This study |
D39Δcps::Phun | Capsule locus replaced with Phun | This study |
ABCA38 | Serotype 22F | CDC |
CDC007 | Serotype 6B | CDC |
ABCA31 | Serotype 35B | CDC |
45 | Serotype 45 | CDC |
CDC001 | Serotype 9V | CDC |
CDC004 | Serotype 23F | CDC |
DAW4 | Serotype 11 | CDC |
ABCA61 | Serotype 3 | CDC |
CDC030 | Serotype 12F | CDC |
CDC048 | Serotype 18C | CDC |
CDC009 | Serotype 15C | CDC |
TIGR4ΔspxB::Erm | spxB (Sp_0730) replaced with Erm | Echlin, et al. 12 |
TIGR4SΔspxB::SweetJanus | spxB (Sp_0730) replaced with Sweet Janus | This study |
D39SΔspxB::SweetJanus | spxB (Spd_0636) replaced with Sweet Janus | This study |
ABCA31SΔspxB::SweetJanus | spxB replaced with Sweet Janus | This study |
CDC001SΔspxB::SweetJanus | spxB replaced with Sweet Janus | This study |
Strain | Strep | Kan | Suc | Chl-Phe |
---|---|---|---|---|
SpnYL001 | S | R | S | R |
TIGR4 | S | S | R | R |
TIGR4S | R | S | R | R |
TIGR4SΔcps::SweetJanus | S | R | S | R |
TIGR4SΔcps::NewSweetJanus | S | R | S | R |
TIGR4SΔcps::PhunJanus | S | R | R | S |
TIGR4SΔcps::PhunSweetJanus | S | R | S | S |
TIGR4Δcps::PhunSweet | S | R | S | S |
TIGR4Δcps::Phun | S | R | R | S |
D39 | S | S | R | R |
D39S | R | S | R | R |
D39SΔcps::SweetJanus | S | R | S | R |
D39SΔcps::NewSweetJanus | S | R | S | R |
D39SΔcps::PhunJanus | S | R | R | S |
D39SΔcps::PhunSweetJanus | S | R | S | S |
D39Δcps::PhunSweet | S | R | S | S |
D39Δcps::Phun | S | R | R | S |
Primer | Sequence |
---|---|
HE01 | GCCGTAGTCATCTTTCTTGGCATC |
HE02 | CTGAGTTAGGTTTTGTAGGTGTCATTGTTC |
HE03 | GAACAATGACACCTACAAAACCTAACTCAG |
HE04 | CTAATTTGAACCCGGGCTAAAGTTAG |
HE05 | CTGTCACCAAGTGTATCATCACC |
HE06 | GATTGCGGCTATTTTTGGAACCATGG |
HE07 | CATCCTTCCATTCATCCCCATAAGTGAC |
HE08 | ATGCAAGAAAAATGGTGGCACAATG |
HE09 | ATTAAAAATCAAACGGATCGATCCTTAA-TTATAGTAATTCCACACAGAAAGCATCCCATG |
HE10 | TTAAGGATCGATCCGTTTGATTTTTAATGG |
HE11 | TTATGCTTTTGGACGTTTAGTACCGTATTTAG |
HE12 | CGGTACTAAACGTCCAAAAGCATAA-GAATGATAGATACCTTGTTATGACGCGCTTAC |
HE13 | TTATTTCACATGTTTTGCGAGATCTTCTTG |
HE14 | ATGTCAACTATTGAAGAACAATTAAAAGCG |
HE15 | GTCCAAGACCAAAGCCAAAGCCAGAGTATAC |
HE16 | GTATACTCTGGCTTTGGCTTTGGTCTTGGAC |
HE17 | TTATTTAAACTGTTCTGAGAAGCGGACATC |
HE18 | GTGTGGTGGAGAAGGCTGTAATGTATG |
HE19 | CGCTTTTAATTGTTCTTCAATAGTTGACAT-TTATTATTTCCCTCCTCTTTTCTACAG |
HE20 | GATGTCCGCTTCTCAGAACAGTTTAAATAA-AAACGCAAAAGAAAATGCCGATGGCCGCCC |
HE21 | GATGTCCGCTTCTCAGAACAGTTTAAATAA-TTAAGGATCGATCCGTTTGATTTTTAATGG |
HE22 | CCATTAAAAATCAAACGGATCGATCCTTAA-TTATTTAAACTGTTCTGAGAAGCGGACATC |
HE23 | CTAAAACAATTCATCCAGTAAAAT |
HE24 | ATTTTACTGGATGAATTGTTTTAG-GCCGGCGTCAGTCAGTTTT |
HE25 | GCGAGCGAGTGAAGCTGG |
HE26 | TCAAACGGATCGATCCTTAA-AATGATAACTCTCCTTCAATTTTTTTAAACTTGGAG |
HE27 | ACTAAACGTCCAAAAGCATAA-TTCCTCTCGCCGAAAATCAAATATGAAACTTG |
HE28 | CCATAGTCACTATATACGAGAATTTCGC |
PCR | Product | F Primer | R Primer | gDNA Template | Size |
---|---|---|---|---|---|
A | RpsL_K56T Up | HE01 | HE02 | TIGR4 | 1149 |
B | RpsL_K56T Down | HE03 | HE04 | TIGR4 | 1015 |
C | DexB-SweetJanus-AliA | HE06 | HE07 | SpnYL001 | 6180 |
D | DexB (SacB) | HE08 | HE09 | TIGR4 | 1608 |
E | SacB-Kan-RpsL | HE10 | HE11 | SpnYL001 | 2807 |
F | AliA (RpsL) | HE12 | HE13 | TIGR4 | 2135 |
G | PheS A315G Up | HE14 | HE15 | TIGR4 | 958 |
H | PheS A315G Down | HE16 | HE17 | TIGR4 | 120 |
I | DexB + Prom (PheS) | HE06 | HE19 | SpnYL001 | 1622 |
J | Kan-RpsL-AliA(PheS) | HE20 | HE07 | SpnYL001 | 3135 |
K | DexB-PheS A315G | HE06 | HE17 | TIGR4SΔcps::PhunJanus | 2669 |
L | SacB-Kan-RpsL-AliA (PheS) | HE21 | HE07 | SpnYL001 | 4638 |
M | DexB-PheS A315G (SacB) | HE06 | HE22 | TIGR4SΔcps::PhunJanus | 2669 |
N | SacB-Kan | HE10 | HE23 | SpnYL001 | 2350 |
O | AliA | HE24 | HE07 | SpnYL001 | 1819 |
P | SJ Kan | HE20 | HE23 | SpnYL001 | 847 |
SOE | Product | F Primer | R Primer | PCR Parts | Size |
1 | RpsL_K56T | HE01 | HE04 | A,B | 2133 |
2 | DexB-NewSweetJanus-AliA | HE08 | HE13 | D,E,F | 6550 |
3 | PheS A315G | HE14 | HE17 | G,H | 1047 |
4 | DexB-PhunJanus-AliA | HE06 | HE07 | I,J,3 | 5804 |
5 | DexB-PhunSweetJanus-AliA | HE06 | HE07 | K,L | 7307 |
6 | DexB-PhunSweet-AliA | HE06 | HE07 | M,N,O | 6838 |
7 | DexB-Phun-AliA | HE06 | HE07 | K,O,P | 5335 |
Markerless Cassette | Counter-Selection Agents |
---|---|
Sweet Janus | 800 µg/mL Streptomycin + 10% Sucrose |
NewSweet Janus | 800 µg/mL Streptomycin + 10% Sucrose |
Phun Janus | 800 µg/mL Streptomycin + 7.5–15 mM Chlorinated-Phenylalanine |
PhunSweet Janus | 800 µg/mL Streptomycin + 10% Sucrose + 7.5–15 mM Chlorinated-Phenylalanine |
PhunSweet | 10% Sucrose + 7.5–15 mM Chlorinated-Phenylalanine |
Phun | 7.5–15 mM Chlorinated-Phenylalanine |
Strain | Cassette | Selection | Ratio |
---|---|---|---|
SPNY001 | SweetJanus | Strep, Suc | 0.311 |
TIGR4S | SweetJanus | Strep, Suc | 0.014 |
TIGR4S | NewSweetJanus | Strep, Suc | 0.009 |
TIGR4S, Clone 1 | NewSweetJanus, Clone 1 | Strep, Suc | 0.019 |
TIGR4S, Clone 1 | NewSweetJanus, Clone 2 | Strep, Suc | 0 |
TIGR4S, Clone 2 | NewSweetJanus, Clone 1 | Strep, Suc | 0 |
TIGR4S, Clone 2 | NewSweetJanus, Clone 2 | Strep, Suc | 0.13 |
TIGR4S, Clone 3 | NewSweetJanus, Clone 1 | Strep, Suc | 0.000 |
TIGR4S, Clone 3 | NewSweetJanus, Clone 2 | Strep, Suc | 0 |
TIGR4S, Clone 4 | NewSweetJanus, Clone 1 | Strep, Suc | 0.008 |
TIGR4S, Clone 4 | NewSweetJanus, Clone 2 | Strep, Suc | 0 |
TIGR4S, Clone 5 | NewSweetJanus, Clone 1 | Strep, Suc | 0 |
TIGR4S, Clone 5 | NewSweetJanus, Clone 2 | Strep, Suc | 0.13 |
TIGR4S, Clone 6 | NewSweetJanus, Clone 1 | Strep, Suc | 1.075 |
TIGR4S, Clone 6 | NewSweetJanus, Clone 2 | Strep, Suc | <0.02 |
TIGR4S, Clone 7 | NewSweetJanus, Clone 1 | Strep, Suc | 0 |
TIGR4S, Clone 7 | NewSweetJanus, Clone 2 | Strep, Suc | 0 |
TIGR4S, Clone 8 | NewSweetJanus, Clone 1 | Strep, Suc | 0 |
TIGR4S, Clone 8 | NewSweetJanus, Clone 2 | Strep, Suc | 0 |
TIGR4S | PhunJanus | Strep, Chl-Phe15mM | 0 |
TIGR4S | PhunJanus | Strep, Chl-Phe10mM | 0.002 |
TIGR4S | PhunJanus | Strep, Chl-Phe7.5mM | 0.008 |
TIGR4S | PhunSweetJanus | Strep, Suc, Chl-Phe15mM | 0 |
TIGR4S | PhunSweetJanus | Strep, Suc, Chl-Phe10mM | 0 |
TIGR4S | PhunSweetJanus | Strep, Suc, Chl-Phe7.5mM | 0.031 |
TIGR4 | PhunSweet | Suc, Chl-Phe15mM | 0.136 |
TIGR4 | PhunSweet | Suc, Chl-Phe10mM | 0.261 |
TIGR4 | PhunSweet | Suc, Chl-Phe7.5mM | 0.187 |
TIGR4 | Phun | Chl-Phe15mM | 0 |
TIGR4 | Phun | Chl-Phe10mM | 0 |
TIGR4 | Phun | Chl-Phe7.5mM | 0 |
D39S | PhunJanus | Strep, Chl-Phe15mM | 0.667 |
D39S | PhunJanus | Strep, Chl-Phe10mM | 0.583 |
D39S | PhunJanus | Strep, Chl-Phe7.5mM | 0.143 |
D39 | PhunSweetJanus | Strep, Suc, Chl-Phe15mM | 1.000 |
D39 | PhunSweetJanus | Strep, Suc, Chl-Phe10mM | 0.688 |
D39 | PhunSweetJanus | Strep, Suc, Chl-Phe7.5mM | 0.316 |
D39 | PhunSweet | Suc, Chl-Phe15mM | 0.357 |
D39 | PhunSweet | Suc, Chl-Phe10mM | 0.333 |
D39 | PhunSweet | Suc, Chl-Phe7.5mM | 0.233 |
D39 | Phun | Chl-Phe15mM | 0.047 |
D39 | Phun | Chl-Phe10mM | 0.030 |
D39 | Phun | Chl-Phe7.5mM | 0.019 |
Strain | gDNA | Selection | Ratio |
---|---|---|---|
TIGR4SΔcps::NSJ | TIGR4 (4) | Strep, Suc | 0.08 |
TIGR4SΔcps::NSJ | D39 (2) | Strep, Suc | 1.33 |
TIGR4SΔcps::NSJ | ABCA38 (22F) | Strep, Suc | 0 |
TIGR4SΔcps::NSJ | CDC007 (6B) | Strep, Suc | 0.11 |
TIGR4SΔcps::NSJ | ABCA31 (35B) | Strep, Suc | 0.07 |
TIGR4SΔcps::NSJ | 45 | Strep, Suc | 0.10 |
TIGR4SΔcps::NSJ | CDC001 (9V) | Strep, Suc | 0.04 |
TIGR4SΔcps::NSJ | CDC004 (23F) | Strep, Suc | 0.09 |
TIGR4SΔcps::NSJ | DAW4 (11) | Strep, Suc | 0.35 |
TIGR4SΔcps::NSJ | ABCA61 (3) | Strep, Suc | 0 |
TIGR4SΔcps::NSJ | CDC030 (12E) | Strep, Suc | 0 |
TIGR4SΔcps::NSJ | CDC048 (18C) | Strep, Suc | 0.19 |
TIGR4SΔcps::NSJ | CDC009 (15C) | Strep, Suc | 0.19 |
D39SΔcps::NSJ | TIGR4 (4) | Strep, Suc | 0.02 |
D39SΔcps::NSJ | D39 (2) | Strep, Suc | 1.14 |
D39SΔcps::NSJ | ABCA38 (22F) | Strep, Suc | 0.02 |
D39SΔcps::NSJ | CDC007 (6B) | Strep, Suc | 0.06 |
D39SΔcps::NSJ | ABCA31 (35B) | Strep, Suc | 0.36 |
D39SΔcps::NSJ | 45 | Strep, Suc | 0 |
D39SΔcps::NSJ | CDC001 (9V) | Strep, Suc | 0.04 |
D39SΔcps::NSJ | CDC004 (23F) | Strep, Suc | 0.07 |
D39SΔcps::NSJ | DAW4 (11) | Strep, Suc | 0.20 |
D39SΔcps::NSJ | ABCA61 (3) | Strep, Suc | 0.03 |
D39SΔcps::NSJ | CDC030 (12E) | Strep, Suc | 0 |
D39SΔcps::NSJ | CDC048 (18C) | Strep, Suc | 0.05 |
D39SΔcps::NSJ | CDC009 (15C) | Strep, Suc | 0.09 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Echlin, H.; Rosch, J.W. Advancing Genetic Tools in Streptococcus pneumoniae. Genes 2020, 11, 965. https://doi.org/10.3390/genes11090965
Echlin H, Rosch JW. Advancing Genetic Tools in Streptococcus pneumoniae. Genes. 2020; 11(9):965. https://doi.org/10.3390/genes11090965
Chicago/Turabian StyleEchlin, Haley, and Jason W. Rosch. 2020. "Advancing Genetic Tools in Streptococcus pneumoniae" Genes 11, no. 9: 965. https://doi.org/10.3390/genes11090965