The Polyubiquitin Gene MrUBI4 Is Required for Conidiation, Conidial Germination, and Stress Tolerance in the Filamentous Fungus Metarhizium robertsii
Abstract
1. Introduction
2. Materials and Methods
2.1. Strains and Culture Conditions
2.2. Sequence Resource and Phylogenetic Analysis
2.3. Gene Deletion and Complementation
2.4. Phenotype Assays
2.5. Transcriptional Profiling Analysis Using Quantitative RT-PCR
2.6. Statistical Analysis
3. Results
3.1. Identification and Characteristics of MrUBI4 from Metarhizium robertsii
3.2. Targeted Disruption of MrUBI4
3.3. Effects of MrUBI4 Deletion on Hyphal Growth
3.4. MrUBI4 is Important for Conidiation and Conidial Germination
3.5. Contribution of MrUBI4 to Environmental Stress Tolerance
3.6. MrUBI4 Has No Effect on Fungal Virulence
4. Discussion
Supplementary Materials
Author Contributions
Acknowledgments
Conflicts of Interest
References
- Finley, D. Recognition and processing of ubiquitin-protein conjugates by the proteasome. Ann. Rev. Biochem. 2009, 78, 477–513. [Google Scholar] [CrossRef] [PubMed]
- Finley, D.; Ulrich, H.D.; Sommer, T.; Kaiser, P. The ubiquitin-proteasome system of Saccharomyces cerevisiae. Genetics 2012, 192, 319–360. [Google Scholar] [CrossRef] [PubMed]
- Goldberg, A.L. Protein degradation and protection against misfolded or damaged proteins. Nature 2003, 426, 895–899. [Google Scholar] [CrossRef] [PubMed]
- Shang, F.; Taylor, A. Ubiquitin-proteasome pathway and cellular responses to oxidative stress. Free Radic. Biol. Med. 2011, 51, 5–16. [Google Scholar] [CrossRef] [PubMed]
- Kimura, Y.; Tanaka, K. Regulatory mechanisms involved in the control of ubiquitin homeostasis. J. Biochem. 2010, 147, 793–798. [Google Scholar] [CrossRef] [PubMed]
- Finley, D.; Ozkaynak, E.; Varshavsky, A. The yeast polyubiquitin gene is essential for resistance to high temperatures, starvation, and other stresses. Cell 1987, 48, 1035–1046. [Google Scholar] [CrossRef]
- Ozkaynak, E.; Finley, D.; Solomon, M.J.; Varshavsky, A. The yeast ubiquitin genes: A family of natural gene fusions. EMBO J. 1987, 6, 1429–1439. [Google Scholar] [CrossRef] [PubMed]
- Gemayel, R.; Yang, Y.; Dzialo, M.C.; Kominek, J.; Vowinckel, J.; Saels, V.; Van Huffel, L.; van der Zande, E.; Ralser, M.; Steensels, J.; et al. Variable repeats in the eukaryotic polyubiquitin gene ubi4 modulate proteostasis and stress survival. Nat. Commun. 2017, 8, 397. [Google Scholar] [CrossRef]
- Fraser, J.; Luu, H.A.; Neculcea, J.; Thomas, D.Y.; Storms, R.K. Ubiquitin gene expression: Response to environmental changes. Curr. Genet. 1991, 20, 17–23. [Google Scholar] [CrossRef]
- Reyes-Turcu, F.E.; Ventii, K.H.; Wilkinson, K.D. Regulation and cellular roles of ubiquitin-specific deubiquitinating enzymes. Ann. Rev. Biochem. 2009, 78, 363–397. [Google Scholar] [CrossRef]
- Zhao, W.; Zhou, T.; Zheng, H.Z.; Qiu, K.P.; Cui, H.J.; Yu, H.; Liu, X.G. Yeast polyubiquitin gene UBI4 deficiency leads to early induction of apoptosis and shortened replicative lifespan. Cell Stress Chaperones 2018, 23, 527–537. [Google Scholar] [CrossRef] [PubMed]
- Oh, Y.; Franck, W.L.; Han, S.O.; Shows, A.; Gokce, E.; Muddiman, D.C.; Dean, R.A. Polyubiquitin is required for growth, development and pathogenicity in the rice blast fungus Magnaporthe oryzae. PLoS ONE 2012, 7, e42868. [Google Scholar] [CrossRef] [PubMed]
- Donofrio, N.M.; Oh, Y.; Lundy, R.; Pan, H.; Brown, D.E.; Jeong, J.S.; Coughlan, S.; Mitchell, T.K.; Dean, R.A. Global gene expression during nitrogen starvation in the rice blast fungus, Magnaporthe grisea. Fungal Genet. Biol. 2006, 43, 605–617. [Google Scholar] [CrossRef] [PubMed]
- Loser, K.; Weltring, K. Induction of a polyubiquitin gene (ubi1) by potato phytoalexins and heat shock in Gibberella pulicaris. Curr. Genet. 1998, 34, 404–409. [Google Scholar] [CrossRef] [PubMed]
- Oh, Y.; Donofrio, N.; Pan, H.Q.; Coughlan, S.; Brown, D.E.; Meng, S.W.; Mitchell, T.; Dean, R.A. Transcriptome analysis reveals new insight into appressorium formation and function in the rice blast fungus Magnaporthe oryzae. Genome Biol. 2008, 9, R85. [Google Scholar] [CrossRef]
- Cheng, L.; Watt, R.; Piper, P.W. Polyubiquitin gene expression contributes to oxidative stress resistance in respiratory yeast (Saccharomyces cerevisiae). Mol. Gen. Genet. 1994, 243, 358–362. [Google Scholar] [CrossRef] [PubMed]
- Roig, P.; Gozalbo, D. Depletion of polyubiquitin encoded by the UBI4 gene confers pleiotropic phenotype to Candida albicans cells. Fungal Genet. Biol. 2003, 39, 70–81. [Google Scholar] [CrossRef]
- Chen, Q.; Li, Y.B.; Wang, J.Z.; Li, R.; Chen, B.S. cpubi4 is essential for development and virulence in chestnut blight fungus. Front. Microbiol. 2018, 9, 1286. [Google Scholar] [CrossRef]
- Wang, C.S.; Wang, S.B. Insect pathogenic fungi: Genomics, molecular interactions, and genetic improvements. Ann. Rev. Entomol. 2017, 62, 73–90. [Google Scholar] [CrossRef]
- Fang, W.G.; Azimzadeh, P.; St Leger, R.J. Strain improvement of fungal insecticides for controlling insect pests and vector-borne diseases. Curr. Opin. Microbiol. 2012, 15, 232–238. [Google Scholar] [CrossRef]
- Lovett, B.; St Leger, R.J. Stress is the rule rather than the exception for Metarhizium. Curr. Genet. 2015, 61, 253–261. [Google Scholar] [CrossRef] [PubMed]
- Rangel, D.E.N.; Braga, G.U.L.; Fernandes, E.K.K.; Keyser, C.A.; Hallsworth, J.E.; Roberts, D.W. Stress tolerance and virulence of insect-pathogenic fungi are determined by environmental conditions during conidial formation. Curr. Genet. 2015, 61, 383–404. [Google Scholar] [CrossRef] [PubMed]
- Rangel, D.E.N.; Braga, G.U.L.; Flint, S.D.; Anderson, A.J.; Roberts, D.W. Variations in UV-B tolerance and germination speed of Metarhizium anisopliae conidia produced on insects and artificial substrates. J. Invertebr. Pathol. 2004, 87, 77–83. [Google Scholar] [CrossRef] [PubMed]
- Rangel, D.E.N.; Butler, M.J.; Torabinejad, J.; Anderson, A.J.; Braga, G.U.L.; Day, A.W.; Roberts, D.W. Mutants and isolates of Metarhizium anisopliae are diverse in their relationships between conidial pigmentation and stress tolerance. J. Invertebr. Pathol. 2006, 93, 170–182. [Google Scholar] [CrossRef] [PubMed]
- Liao, X.G.; Lu, H.L.; Fang, W.G.; St Leger, R.J. Overexpression of a Metarhizium robertsii HSP25 gene increases thermotolerance and survival in soil. Appl. Microbiol. Biotechnol. 2014, 98, 777–783. [Google Scholar] [CrossRef] [PubMed]
- Lovett, B.; St Leger, R.J. Genetically engineering better fungal biopesticides. Pest Manag. Sci. 2018, 74, 781–789. [Google Scholar] [CrossRef] [PubMed]
- Shang, Y.F.; Duan, Z.B.; Huang, W.; Gao, Q.; Wang, C.S. Improving UV resistance and virulence of Beauveria bassiana by genetic engineering with an exogenous tyrosinase gene. J. Invertebr. Pathol. 2012, 109, 105–109. [Google Scholar] [CrossRef]
- Wang, Z.X.; Zhou, X.Z.; Meng, H.M.; Liu, Y.J.; Zhou, Q.; Huang, B. Comparative transcriptomic analysis of the heat stress response in the filamentous fungus Metarhizium anisopliae using RNA-Seq. Appl. Microbiol. Biotechnol. 2014, 98, 5589–5597. [Google Scholar] [CrossRef]
- Fang, W.G.; Pei, Y.; Bidochka, M.J. Transformation of Metarhizium anisopliae mediated by Agrobacterium tumefaciens. Canad. J. Microbiol. 2006, 52, 623–626. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef]
- Li, L.; Wang, J.Y.; Chen, H.L.; Chai, R.Y.; Zhang, Z.; Mao, X.Q.; Qiu, H.P.; Jiang, H.; Wang, Y.L.; Sun, G.C. Pex14/17, a filamentous fungus-specific peroxin, is required for the import of peroxisomal matrix proteins and full virulence of Magnaporthe oryzae. Mol. Plant Pathol. 2017, 18, 1238–1252. [Google Scholar] [CrossRef] [PubMed]
- Meng, H.M.; Wang, Z.X.; Wang, Y.L.; Zhu, H.; Huang, B. Dicer and argonaute genes involved in RNA interference in the entomopathogenic fungus Metarhizium robertsii. Appl. Environ. Microbiol. 2017, 83, e03230-16. [Google Scholar] [CrossRef] [PubMed]
- Fang, W.G.; Bidochka, M.J. Expression of genes involved in germination, conidiogenesis and pathogenesis in Metarhizium anisopliae using quantitative real-time RT-PCR. Mycol. Res. 2006, 110, 1165–1171. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.L.; Wang, T.T.; Qiao, L.T.; Zhu, J.Y.; Fan, J.R.; Zhang, T.T.; Wang, Z.X.; Li, W.Z.; Chen, A.H.; Huang, B. DNA methyltransferases contribute to the fungal development, stress tolerance and virulence of the entomopathogenic fungus Metarhizium robertsii. Appl. Microbiol. Biotechnol. 2017, 101, 4215–4226. [Google Scholar] [CrossRef] [PubMed]
- Zhou, R.; Zhou, X.Z.; Fan, A.L.; Wang, Z.X.; Huang, B. Differential functions of two metalloproteases, Mrmep1 and Mrmep2, in growth, sporulation, cell wall integrity, and virulence in the filamentous fungus Metarhizium robertsii. Front. Microbiol. 2018, 9, 1528. [Google Scholar] [CrossRef] [PubMed]
- Oliveira, A.S.; Braga, G.U.L.; Rangel, D.E.N. Metarhizium robertsii illuminated during mycelial growth produces conidia with increased germination speed and virulence. Fungal Biol. 2018, 122, 555–562. [Google Scholar] [CrossRef]
- Zhang, X.; St Leger, R.J.; Fang, W.G. Pyruvate accumulation is the first line of cell defense against heat stress in a fungus. mBio 2017, 8, e01284-17. [Google Scholar] [CrossRef]
- Wang, Z.X.; Zhou, Q.; Li, Y.D.; Qiao, L.T.; Pang, Q.; Huang, B. iTRAQ-based quantitative proteomic analysis of conidia and mycelium in the filamentous fungus Metarhizium robertsii. Fungal Biol. 2018, 122, 651–658. [Google Scholar] [CrossRef]
- Yang, W.J.; Wu, H.; Wang, Z.X.; Sun, Q.; Qiao, L.T.; Huang, B. The APSES gene MrStuA regulates sporulation in Metarhizium robertsii. Front. Microbiol. 2018, 9, 1208. [Google Scholar] [CrossRef]
- Wang, J.J.; Cai, Q.; Qiu, L.; Ying, S.H.; Feng, M.G. The histone acetyltransferase Mst2 sustains the biological control potential of a fungal insect pathogen through transcriptional regulation. Appl. Microbiol. Biotechnol. 2018, 102, 1343–1355. [Google Scholar] [CrossRef]
- Du, Y.; Jin, K.; Xia, Y. Involvement of MaSom1, a downstream transcriptional factor of cAMP/PKA pathway, in conidial yield, stress tolerances, and virulence in Metarhizium acridum. Appl. Microbiol. Biotechnol. 2018, 102, 5611–5623. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2 −∆∆CT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Gao, Q.; Jin, K.; Ying, S.H.; Zhang, Y.J.; Xiao, G.H.; Shang, Y.F.; Duan, Z.B.; Hu, X.A.; Xie, X.Q.; Zhou, G.; et al. Genome sequencing and comparative transcriptomics of the model entomopathogenic fungi Metarhizium anisopliae and M. acridum. PLoS GENET. 2011, 7, e1001264. [Google Scholar] [CrossRef] [PubMed]
- Simon, J.R.; Treger, J.M.; McEntee, K. Multiple independent regulatory pathways control UBI4 expression after heat shock in Saccharomyces cerevisiae. Mol. Microbiol. 1999, 31, 823–832. [Google Scholar] [CrossRef] [PubMed]
- Elbein, A.D.; Pan, Y.T.; Pastuszak, I.; Carroll, D. New insights on trehalose: A multifunctional molecule. Glycobiology 2003, 13, 17R–27R. [Google Scholar] [CrossRef] [PubMed]
- Rangel, D.E.N.; Roberts, D.W. Possible source of the high UV-B and heat tolerance of Metarhizium acridum (isolate ARSEF 324). J. Invertebr. Pathol. 2018, 157, 32–35. [Google Scholar] [CrossRef] [PubMed]
- Ruijter, G.J.G.; Bax, M.; Patel, H.; Flitter, S.J.; van de Vondervoort, P.J.I.; de Vries, R.P.; vanKuyk, P.A.; Visser, J. Mannitol is required for stress tolerance in Aspergillus niger conidiospores. Eukaryotic Cell 2003, 2, 690–698. [Google Scholar] [CrossRef]
- Adams, T.H.; Wieser, J.K.; Yu, J.H. Asexual sporulation in Aspergillus nidulans. Microbiol. Mol. Biol. Rev. 1998, 62, 35–54. [Google Scholar]
- De Vries, R.P.; Riley, R.; Wiebenga, A.; Aguilar-Osorio, G.; Amillis, S.; Uchima, C.A.; Anderluh, G.; Asadollahi, M.; Askin, M.; Barry, K.; et al. Comparative genomics reveals high biological diversity and specific adaptations in the industrially and medically important fungal genus Aspergillus. Genome Biol. 2017, 18, 28. [Google Scholar] [CrossRef]
- Park, H.S.; Yu, J.H. Genetic control of asexual sporulation in filamentous fungi. Curr. Opin. Microbiol. 2012, 15, 669–677. [Google Scholar] [CrossRef]
- Shi, H.B.; Chen, G.Q.; Chen, Y.P.; Dong, B.; Lu, J.P.; Liu, X.H.; Lin, F.C. MoRad6-mediated ubiquitination pathways are essential for development and pathogenicity in Magnaporthe oryzae. Environ. Microbiol. 2016, 18, 4170–4187. [Google Scholar] [CrossRef] [PubMed]
- Barelli, L.; Moonjely, S.; Behie, S.W.; Bidochka, M.J. Fungi with multifunctional lifestyles: Endophytic insect pathogenic fungi. Plant Mol. Biol. 2016, 90, 657–664. [Google Scholar] [CrossRef] [PubMed]
- Behie, S.W.; Zelisko, P.M.; Bidochka, M.J. Endophytic insect-parasitic fungi translocate nitrogen directly from insects to plants. Science 2012, 336, 1576–1577. [Google Scholar] [CrossRef] [PubMed]
- Barelli, L.; Moreira, C.C.; Bidochka, M.J. Initial stages of endophytic colonization by Metarhizium involves rhizoplane colonization. Microbiology-Sgm 2018, 164, 1531–1540. [Google Scholar] [CrossRef]
- Sasan, R.K.; Bidochka, M.J. The insect-pathogenic fungus Metarhizium robertsii (Clavicipitaceae) is also an endophyte that stimulates plant root development. Am. J. Bot. 2012, 99, 101–107. [Google Scholar] [CrossRef] [PubMed]
Gene | Primer Name | Sequence (5’- 3’) | Notes |
---|---|---|---|
MrUBI4 | MrUBI4-5F | GGAATTCGAGCAAGACAAGCCAACG, EcoRI | For construction of gene disruption vector |
MrUBI4-5R | AACTGCAGAAGAAAGCAGGGTCAAGAT, PstI | ||
MrUBI4-3F | GCTCTAGACAGTAGTTGATTGGACGATG, XbaI | ||
MrUBI4-3R | GCTCTAGACTGGGAGTAAAGTGGAAGAT, XbaI | ||
MrUBI4-upF(P5) | GTGGCTGTCATCAGGAGTTT | PCR identification of MrUBI4 deletion transformants | |
MrUBI4-upR(P6) | GGCATTCATTGTTGACCTCC | ||
MrUBI4-dnF(P7) | GTTTCTGGCAGCTGGACTTC | ||
MrUBI4-dnR(P8) | AGCGTGGACAGACTTTGATTT | ||
MrUBI4CP-5F | GGACTAGTGGGTGGACTGGAGGTA, SpeI | For gene complementation | |
MrUBI4CP-3R | GCTCTAGATAGGAATCGAACGCAGTT, XbaI | ||
MrUBI4-F(P1) | GGAAGTCACTAACAATCCCACG | Genomic PCR and RT-PCR analysis | |
MrUBI4-R(P2) | AAGTCGCAGGACAAGGTG | ||
bar | bar-F(P3) | TCGTCAACCACTACATCGAGAC | Genomic PCR analysis |
bar-R(P4) | GAAGTCCAGCTGCCAGAAAC | ||
ben | ben-F | GGTAACTCCACCGCCATCCA | Genomic PCR analysis |
ben-R | GCAGGGTATTGCCTTTGGACTT | ||
gpd | gpd-F | GACTGCCCGCATTGAGAAG | RT-PCR analysis |
gpd-R | AGATGGAGGAGTTGGTGTTG | ||
UBI4-probe-F | TGATAAGGACGGCGGTTTG | For probe synthesis | |
UBI4-probe-R | CCGAAGTAGGCAGCACGAT |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Z.; Zhu, H.; Cheng, Y.; Jiang, Y.; Li, Y.; Huang, B. The Polyubiquitin Gene MrUBI4 Is Required for Conidiation, Conidial Germination, and Stress Tolerance in the Filamentous Fungus Metarhizium robertsii. Genes 2019, 10, 412. https://doi.org/10.3390/genes10060412
Wang Z, Zhu H, Cheng Y, Jiang Y, Li Y, Huang B. The Polyubiquitin Gene MrUBI4 Is Required for Conidiation, Conidial Germination, and Stress Tolerance in the Filamentous Fungus Metarhizium robertsii. Genes. 2019; 10(6):412. https://doi.org/10.3390/genes10060412
Chicago/Turabian StyleWang, Zhangxun, Hong Zhu, Yuran Cheng, Yuanyuan Jiang, Yuandong Li, and Bo Huang. 2019. "The Polyubiquitin Gene MrUBI4 Is Required for Conidiation, Conidial Germination, and Stress Tolerance in the Filamentous Fungus Metarhizium robertsii" Genes 10, no. 6: 412. https://doi.org/10.3390/genes10060412
APA StyleWang, Z., Zhu, H., Cheng, Y., Jiang, Y., Li, Y., & Huang, B. (2019). The Polyubiquitin Gene MrUBI4 Is Required for Conidiation, Conidial Germination, and Stress Tolerance in the Filamentous Fungus Metarhizium robertsii. Genes, 10(6), 412. https://doi.org/10.3390/genes10060412