VPS72/YL1-Mediated H2A.Z Deposition Is Required for Nuclear Reassembly after Mitosis
Abstract
1. Introduction
2. Materials and Methods
2.1. Recombinant Proteins and Antibodies
2.2. Chromatin Re-Isolation
2.3. Nuclear Assembly Assay and Chromatin De-Condensation Assay
2.4. Cell Culture and Transfection
2.5. Immunofluorescence
2.6. Nucleolar Function Assays
2.7. Live-Cell Imaging
2.8. Sequence Alignment, Identity, Similarity Scores and Protein Blast
3. Results
3.1. VPS72 Is Required for Timely Mitotic Exit
3.2. VPS72 Accumulates on Chromatin during Mitotic Exit
3.3. VPS72 Is Required for Nuclear Assembly and Organization
3.4. VPS72 Performs Its Function Outside of Remodeling Complexes
3.5. VPS72-Mediated H2A.Z Chromatin Loading Is Required for Nuclear Assembly
3.6. The Conserved YL-1 Domain Is Required for VPS72 Function in Nuclear Assembly
4. Discussion
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Batty, P.; Gerlich, D.W. Mitotic Chromosome Mechanics: How Cells Segregate Their Genome. Trends Cell Biol. 2019, 29, 717–726. [Google Scholar] [CrossRef]
 - Hirano, T. Chromosome Dynamics during Mitosis. Cold Spring Harb. Perspect. Biol. 2015, 7. [Google Scholar] [CrossRef] [PubMed]
 - Antonin, W.; Neumann, H. Chromosome condensation and decondensation during mitosis. Curr. Opin. Cell Biol. 2016, 40, 15–22. [Google Scholar] [CrossRef] [PubMed]
 - Schellhaus, A.K.; De Magistris, P.; Antonin, W. Nuclear Reformation at the End of Mitosis. J. Mol. Biol. 2016, 428, 1962–1985. [Google Scholar] [CrossRef] [PubMed]
 - Wurzenberger, C.; Gerlich, D.W. Phosphatases: Providing safe passage through mitotic exit. Nat. Rev. Mol. Cell Biol. 2011, 12, 469–482. [Google Scholar] [CrossRef] [PubMed]
 - Holder, J.; Poser, E.; Barr, F.A. Getting out of mitosis: Spatial and temporal control of mitotic exit and cytokinesis by PP1 and PP2A. FEBS Lett. 2019, 593, 2908–2924. [Google Scholar] [CrossRef]
 - Tseng, L.C.; Chen, R.H. Temporal control of nuclear envelope assembly by phosphorylation of lamin B receptor. Mol. Biol. Cell 2011, 22, 3306–3317. [Google Scholar] [CrossRef]
 - Thompson, L.J.; Bollen, M.; Fields, A.P. Identification of protein phosphatase 1 as a mitotic lamin phosphatase. J. Biol. Chem. 1997, 272, 29693–29697. [Google Scholar] [CrossRef]
 - Laurell, E.; Beck, K.; Krupina, K.; Theerthagiri, G.; Bodenmiller, B.; Horvath, P.; Aebersold, R.; Antonin, W.; Kutay, U. Phosphorylation of Nup98 by multiple kinases is crucial for NPC disassembly during mitotic entry. Cell 2011, 144, 539–550. [Google Scholar] [CrossRef]
 - Linder, M.I.; Kohler, M.; Boersema, P.; Weberruss, M.; Wandke, C.; Marino, J.; Ashiono, C.; Picotti, P.; Antonin, W.; Kutay, U. Mitotic Disassembly of Nuclear Pore Complexes Involves CDK1- and PLK1-Mediated Phosphorylation of Key Interconnecting Nucleoporins. Dev. Cell 2017, 43, 141–156.e7. [Google Scholar] [CrossRef]
 - Weberruss, M.; Antonin, W. Perforating the nuclear boundary—How nuclear pore complexes assemble. J. Cell Sci. 2016, 129, 4439–4447. [Google Scholar] [CrossRef] [PubMed]
 - Otsuka, S.; Ellenberg, J. Mechanisms of nuclear pore complex assembly—Two different ways of building one molecular machine. FEBS Lett. 2018, 592, 475–488. [Google Scholar] [CrossRef] [PubMed]
 - Schmitz, M.H.; Held, M.; Janssens, V.; Hutchins, J.R.; Hudecz, O.; Ivanova, E.; Goris, J.; Trinkle-Mulcahy, L.; Lamond, A.I.; Poser, I.; et al. Live-cell imaging RNAi screen identifies PP2A-B55alpha and importin-beta1 as key mitotic exit regulators in human cells. Nat. Cell Biol. 2010, 12, 886–893. [Google Scholar] [CrossRef] [PubMed]
 - Vagnarelli, P.; Ribeiro, S.; Sennels, L.; Sanchez-Pulido, L.; de Lima Alves, F.; Verheyen, T.; Kelly, D.A.; Ponting, C.P.; Rappsilber, J.; Earnshaw, W.C. Repo-Man coordinates chromosomal reorganization with nuclear envelope reassembly during mitotic exit. Dev. Cell 2011, 21, 328–342. [Google Scholar] [CrossRef] [PubMed]
 - Huguet, F.; Flynn, S.; Vagnarelli, P. The Role of Phosphatases in Nuclear Envelope Disassembly and Reassembly and Their Relevance to Pathologies. Cells 2019, 8, 687. [Google Scholar] [CrossRef] [PubMed]
 - Chan, R.C.; Forbes, D.I. In vitro study of nuclear assembly and nuclear import using Xenopus egg extracts. Methods Mol. Biol. 2006, 322, 289–300. [Google Scholar] [PubMed]
 - Blow, J.J.; Laskey, R.A. Xenopus cell-free extracts and their contribution to the study of DNA replication and other complex biological processes. Int. J. Dev. Biol. 2016, 60, 201–207. [Google Scholar] [CrossRef]
 - Lohka, M.J. Analysis of nuclear envelope assembly using extracts of Xenopus eggs. Methods Cell Biol. 1998, 53, 367–395. [Google Scholar] [CrossRef] [PubMed]
 - Zierhut, C.; Jenness, C.; Kimura, H.; Funabiki, H. Nucleosomal regulation of chromatin composition and nuclear assembly revealed by histone depletion. Nat. Struct. Mol. Biol. 2014, 21, 617–625. [Google Scholar] [CrossRef]
 - Schlaitz, A.L.; Thompson, J.; Wong, C.C.; Yates, J.R., 3rd; Heald, R. REEP3/4 ensure endoplasmic reticulum clearance from metaphase chromatin and proper nuclear envelope architecture. Dev. Cell 2013, 26, 315–323. [Google Scholar] [CrossRef]
 - Magalska, A.; Schellhaus, A.K.; Moreno-Andres, D.; Zanini, F.; Schooley, A.; Sachdev, R.; Schwarz, H.; Madlung, J.; Antonin, W. RuvB-like ATPases function in chromatin decondensation at the end of mitosis. Dev. Cell 2014, 31, 305–318. [Google Scholar] [CrossRef][Green Version]
 - Gant, T.M.; Wilson, K.L. Nuclear assembly. Annu. Rev. Cell Dev. Biol. 1997, 13, 669–695. [Google Scholar] [CrossRef]
 - Gentili, C.; Castor, D.; Kaden, S.; Lauterbach, D.; Gysi, M.; Steigemann, P.; Gerlich, D.W.; Jiricny, J.; Ferrari, S. Chromosome Missegregation Associated with RUVBL1 Deficiency. PLoS ONE 2015, 10, e0133576. [Google Scholar] [CrossRef] [PubMed]
 - Philpott, A.; Leno, G.H. Nucleoplasmin remodels sperm chromatin in Xenopus egg extracts. Cell 1992, 69, 759–767. [Google Scholar] [CrossRef]
 - Jha, S.; Dutta, A. RVB1/RVB2: Running rings around molecular biology. Mol. Cell 2009, 34, 521–533. [Google Scholar] [CrossRef] [PubMed]
 - Rosenbaum, J.; Baek, S.H.; Dutta, A.; Houry, W.A.; Huber, O.; Hupp, T.R.; Matias, P.M. The emergence of the conserved AAA+ ATPases Pontin and Reptin on the signaling landscape. Sci. Signal. 2013, 6, mr1. [Google Scholar] [CrossRef]
 - Clapier, C.R.; Cairns, B.R. The biology of chromatin remodeling complexes. Annu. Rev. Biochem. 2009, 78, 273–304. [Google Scholar] [CrossRef] [PubMed]
 - Schooley, A.; Moreno-Andres, D.; De Magistris, P.; Vollmer, B.; Antonin, W. The lysine demethylase LSD1 is required for nuclear envelope formation at the end of mitosis. J. Cell Sci. 2015, 128, 3466–3477. [Google Scholar] [CrossRef]
 - Latrick, C.M.; Marek, M.; Ouararhni, K.; Papin, C.; Stoll, I.; Ignatyeva, M.; Obri, A.; Ennifar, E.; Dimitrov, S.; Romier, C.; et al. Molecular basis and specificity of H2A.Z-H2B recognition and deposition by the histone chaperone YL1. Nat. Struct. Mol. Biol. 2016, 23, 309–316. [Google Scholar] [CrossRef] [PubMed]
 - Liang, X.; Shan, S.; Pan, L.; Zhao, J.; Ranjan, A.; Wang, F.; Zhang, Z.; Huang, Y.; Feng, H.; Wei, D.; et al. Structural basis of H2A.Z recognition by SRCAP chromatin-remodeling subunit YL1. Nat. Struct. Mol. Biol. 2016, 23, 317–323. [Google Scholar] [CrossRef]
 - Vollmer, B.; Lorenz, M.; Moreno-Andres, D.; Bodenhofer, M.; De Magistris, P.; Astrinidis, S.A.; Schooley, A.; Flotenmeyer, M.; Leptihn, S.; Antonin, W. Nup153 Recruits the Nup107-160 Complex to the Inner Nuclear Membrane for Interphasic Nuclear Pore Complex Assembly. Dev. Cell 2015, 33, 717–728. [Google Scholar] [CrossRef] [PubMed]
 - Yokoyama, H.; Moreno-Andres, D.; Astrinidis, S.A.; Hao, Y.; Weberruss, M.; Schellhaus, A.K.; Lue, H.; Haramoto, Y.; Gruss, O.J.; Antonin, W. Chromosome alignment maintenance requires the MAP RECQL4, mutated in the Rothmund-Thomson syndrome. Life Sci. Alliance 2019, 2. [Google Scholar] [CrossRef] [PubMed]
 - Eisenhardt, N.; Schooley, A.; Antonin, W. Xenopus in vitro assays to analyze the function of transmembrane nucleoporins and targeting of inner nuclear membrane proteins. Methods Cell Biol. 2014, 122, 193–218. [Google Scholar] [CrossRef]
 - Gasser, S.M.; Laemmli, U.K. Improved methods for the isolation of individual and clustered mitotic chromosomes. Exp. Cell Res. 1987, 173, 85–98. [Google Scholar] [CrossRef]
 - McQuin, C.; Goodman, A.; Chernyshev, V.; Kamentsky, L.; Cimini, B.A.; Karhohs, K.W.; Doan, M.; Ding, L.; Rafelski, S.M.; Thirstrup, D.; et al. CellProfiler 3.0: Next-generation image processing for biology. PLoS Biol. 2005, 16, e2005970. [Google Scholar] [CrossRef]
 - Berg, S.; Kutra, D.; Kroeger, T.; Straehle, C.N.; Kausler, B.X.; Haubold, C.; Schiegg, M.; Ales, J.; Beier, T.; Rudy, M.; et al. ilastik: Interactive machine learning for (bio)image analysis. Nat. Methods 2019, 16, 1226–1232. [Google Scholar] [CrossRef]
 - De Chaumont, F.; Dallongeville, S.; Chenouard, N.; Hervé, N.; Pop, S.; Provoost, T.; Meas-Yedid, V.; Pankajakshan, P.; Lecomte, T.; Le Montagner, Y.; et al. Icy: An open bioimage informatics platform for extended reproducible research. Nat. Methods 2012, 9, 690–696. [Google Scholar] [CrossRef]
 - Gouy, M.; Guindon, S.; Gascuel, O. SeaView version 4: A multiplatform graphical user interface for sequence alignment and phylogenetic tree building. Mol. Biol. Evol. 2010, 27, 221–224. [Google Scholar] [CrossRef]
 - Altschul, S.F.; Madden, T.L.; Schäffer, A.A.; Zhang, J.; Zhang, Z.; Miller, W.; Lipman, D.J. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res. 1997, 25, 3389–3402. [Google Scholar] [CrossRef]
 - Lenart, P.; Ellenberg, J. Monitoring the permeability of the nuclear envelope during the cell cycle. Methods 2006, 38, 17–24. [Google Scholar] [CrossRef]
 - Hein, M.Y.; Hubner, N.C.; Poser, I.; Cox, J.; Nagaraj, N.; Toyoda, Y.; Gak, I.A.; Weisswange, I.; Mansfeld, J.; Buchholz, F.; et al. A human interactome in three quantitative dimensions organized by stoichiometries and abundances. Cell 2015, 163, 712–723. [Google Scholar] [CrossRef] [PubMed]
 - Held, M.; Schmitz, M.H.; Fischer, B.; Walter, T.; Neumann, B.; Olma, M.H.; Peter, M.; Ellenberg, J.; Gerlich, D.W. CellCognition: Time-resolved phenotype annotation in high-throughput live cell imaging. Nat. Methods 2010, 7, 747–754. [Google Scholar] [CrossRef] [PubMed]
 - Matias, P.M.; Baek, S.H.; Bandeiras, T.M.; Dutta, A.; Houry, W.A.; Llorca, O.; Rosenbaum, J. The AAA+ proteins Pontin and Reptin enter adult age: From understanding their basic biology to the identification of selective inhibitors. Front. Mol. Biosci. 2015, 2, 17. [Google Scholar] [CrossRef] [PubMed]
 - Venteicher, A.S.; Meng, Z.; Mason, P.J.; Veenstra, T.D.; Artandi, S.E. Identification of ATPases pontin and reptin as telomerase components essential for holoenzyme assembly. Cell 2008, 132, 945–957. [Google Scholar] [CrossRef] [PubMed]
 - Ducat, D.; Kawaguchi, S.; Liu, H.; Yates, J.R., 3rd; Zheng, Y. Regulation of microtubule assembly and organization in mitosis by the AAA+ ATPase Pontin. Mol. Biol. Cell 2008, 19, 3097–3110. [Google Scholar] [CrossRef]
 - Horikawa, I.; Tanaka, H.; Yuasa, Y.; Suzuki, M.; Oshimura, M. Molecular cloning of a novel human cDNA on chromosome 1q21 and its mouse homolog encoding a nuclear protein with DNA-binding ability. Biochem. Biophys. Res. Commun. 1995, 208, 999–1007. [Google Scholar] [CrossRef]
 - Theerthagiri, G.; Eisenhardt, N.; Schwarz, H.; Antonin, W. The nucleoporin Nup188 controls passage of membrane proteins across the nuclear pore complex. J. Cell Biol. 2010, 189, 1129–1142. [Google Scholar] [CrossRef] [PubMed]
 - Kill, I.R. Localisation of the Ki-67 antigen within the nucleolus. Evidence for a fibrillarin-deficient region of the dense fibrillar component. J. Cell Sci. 1996, 109, 1253–1263. [Google Scholar]
 - Neumuller, R.A.; Gross, T.; Samsonova, A.A.; Vinayagam, A.; Buckner, M.; Founk, K.; Hu, Y.; Sharifpoor, S.; Rosebrock, A.P.; Andrews, B.; et al. Conserved regulators of nucleolar size revealed by global phenotypic analyses. Sci. Signal. 2013, 6, ra70. [Google Scholar] [CrossRef]
 - Bell, P.; Dabauvalle, M.C.; Scheer, U. In vitro assembly of prenucleolar bodies in Xenopus egg extract. J. Cell Biol. 1992, 118, 1297–1304. [Google Scholar] [CrossRef]
 - Cai, Y.; Jin, J.; Florens, L.; Swanson, S.K.; Kusch, T.; Li, B.; Workman, J.L.; Washburn, M.P.; Conaway, R.C.; Conaway, J.W. The mammalian YL1 protein is a shared subunit of the TRRAP/TIP60 histone acetyltransferase and SRCAP complexes. J. Biol. Chem. 2005, 280, 13665–13670. [Google Scholar] [CrossRef] [PubMed]
 - Horikawa, I.; Tanaka, H.; Yuasa, Y.; Suzuki, M.; Shimizu, M.; Oshimura, M. Forced expression of YL-1 protein suppresses the anchorage-independent growth of Kirsten sarcoma virus-transformed NIH3T3 cells. Exp. Cell Res. 1995, 220, 11–17. [Google Scholar] [CrossRef]
 - Krogan, N.J.; Keogh, M.C.; Datta, N.; Sawa, C.; Ryan, O.W.; Ding, H.; Haw, R.A.; Pootoolal, J.; Tong, A.; Canadien, V.; et al. A Snf2 family ATPase complex required for recruitment of the histone H2A variant Htz1. Mol. Cell 2003, 12, 1565–1576. [Google Scholar] [CrossRef]
 - Mizuguchi, G.; Shen, X.; Landry, J.; Wu, W.H.; Sen, S.; Wu, C. ATP-driven exchange of histone H2AZ variant catalyzed by SWR1 chromatin remodeling complex. Science 2004, 303, 343–348. [Google Scholar] [CrossRef] [PubMed]
 - Kobor, M.S.; Venkatasubrahmanyam, S.; Meneghini, M.D.; Gin, J.W.; Jennings, J.L.; Link, A.J.; Madhani, H.D.; Rine, J. A protein complex containing the conserved Swi2/Snf2-related ATPase Swr1p deposits histone variant H2A.Z into euchromatin. PLoS Biol. 2004, 2, E131. [Google Scholar] [CrossRef] [PubMed]
 - Kusch, T.; Florens, L.; Macdonald, W.H.; Swanson, S.K.; Glaser, R.L.; Yates, J.R., 3rd; Abmayr, S.M.; Washburn, M.P.; Workman, J.L. Acetylation by Tip60 is required for selective histone variant exchange at DNA lesions. Science 2004, 306, 2084–2087. [Google Scholar] [CrossRef]
 - Ranjan, A.; Mizuguchi, G.; FitzGerald, P.C.; Wei, D.; Wang, F.; Huang, Y.; Luk, E.; Woodcock, C.L.; Wu, C. Nucleosome-free region dominates histone acetylation in targeting SWR1 to promoters for H2A.Z replacement. Cell 2013, 154, 1232–1245. [Google Scholar] [CrossRef]
 - Wu, W.H.; Alami, S.; Luk, E.; Wu, C.H.; Sen, S.; Mizuguchi, G.; Wei, D.; Wu, C. Swc2 is a widely conserved H2AZ-binding module essential for ATP-dependent histone exchange. Nat. Struct. Mol. Biol. 2005, 12, 1064–1071. [Google Scholar] [CrossRef] [PubMed]
 - Iouzalen, N.; Moreau, J.; Mechali, M. H2A.ZI, a new variant histone expressed during Xenopus early development exhibits several distinct features from the core histone H2A. Nucleic Acids Res. 1996, 24, 3947–3952. [Google Scholar] [CrossRef]
 - Greaves, I.K.; Rangasamy, D.; Ridgway, P.; Tremethick, D.J. H2A.Z contributes to the unique 3D structure of the centromere. Proc. Natl. Acad. Sci. USA 2007, 104, 525–530. [Google Scholar] [CrossRef]
 - Rangasamy, D.; Greaves, I.; Tremethick, D.J. RNA interference demonstrates a novel role for H2A.Z in chromosome segregation. Nat. Struct. Mol. Biol. 2004, 11, 650–655. [Google Scholar] [CrossRef]
 - Rangasamy, D.; Berven, L.; Ridgway, P.; Tremethick, D.J. Pericentric heterochromatin becomes enriched with H2A.Z during early mammalian development. EMBO J. 2003, 22, 1599–1607. [Google Scholar] [CrossRef]
 - Meneghini, M.D.; Wu, M.; Madhani, H.D. Conserved histone variant H2A.Z protects euchromatin from the ectopic spread of silent heterochromatin. Cell 2003, 112, 725–736. [Google Scholar] [CrossRef]
 - Xu, Y.; Ayrapetov, M.K.; Xu, C.; Gursoy-Yuzugullu, O.; Hu, Y.; Price, B.D. Histone H2A.Z controls a critical chromatin remodeling step required for DNA double-strand break repair. Mol. Cell 2012, 48, 723–733. [Google Scholar] [CrossRef]
 - Santisteban, M.S.; Kalashnikova, T.; Smith, M.M. Histone H2A.Z regulats transcription and is partially redundant with nucleosome remodeling complexes. Cell 2000, 103, 411–422. [Google Scholar] [CrossRef]
 - Adam, M.; Robert, F.; Larochelle, M.; Gaudreau, L. H2A.Z is required for global chromatin integrity and for recruitment of RNA polymerase II under specific conditions. Mol. Cell Biol. 2001, 21, 6270–6279. [Google Scholar] [CrossRef]
 - Giaimo, B.D.; Ferrante, F.; Herchenrother, A.; Hake, S.B.; Borggrefe, T. The histone variant H2A.Z in gene regulation. Epigenetics Chromatin 2019, 12, 37. [Google Scholar] [CrossRef] [PubMed]
 - Nekrasov, M.; Amrichova, J.; Parker, B.J.; Soboleva, T.A.; Jack, C.; Williams, R.; Huttley, G.A.; Tremethick, D.J. Histone H2A.Z inheritance during the cell cycle and its impact on promoter organization and dynamics. Nat. Struct. Mol. Biol. 2012, 19, 1076–1083. [Google Scholar] [CrossRef] [PubMed]
 - Billon, P.; Cote, J. Precise deposition of histone H2A.Z in chromatin for genome expression and maintenance. Biochim. Biophys. Acta (BBA)-Gene Regul. Mech. 2013, 1819, 290–302. [Google Scholar] [CrossRef] [PubMed]
 - Dryhurst, D.; Ishibashi, T.; Rose, K.L.; Eirin-Lopez, J.M.; McDonald, D.; Silva-Moreno, B.; Veldhoen, N.; Helbing, C.C.; Hendzel, M.J.; Shabanowitz, J.; et al. Characterization of the histone H2A.Z-1 and H2A.Z-2 isoforms in vertebrates. BMC Biol. 2009, 7, 86. [Google Scholar] [CrossRef] [PubMed]
 - Eirin-Lopez, J.M.; Gonzalez-Romero, R.; Dryhurst, D.; Ishibashi, T.; Ausio, J. The evolutionary differentiation of two histone H2A.Z variants in chordates (H2A.Z-1 and H2A.Z-2) is mediated by a stepwise mutation process that affects three amino acid residues. BMC Evol. Biol. 2009, 9, 31. [Google Scholar] [CrossRef] [PubMed]
 







| Name | Oligo Ref. | Target Sequence 5′-3 (Sense) | Manufacture Ref. | Manufacturer | 
|---|---|---|---|---|
| AllStars neg. control | Cat. #1027281 | Qiagen | ||
| PPP2R1A_7 | triple | GACCAGGATGTGGACGTCAAA | SI04436495 | Qiagen | 
| PPP2CA_5 | triple | ATGGAACTTGACGATACTCTA | SI02225783 | Qiagen | 
| PPP2R2A_5 | triple | CTGCAGATGATTTGCGGATTA | SI02225825 | Qiagen | 
| NUFIP1 | CCUAUGCUCACUAAUGAGUAGCUAU | HSS120217 | Invitrogen | |
| YEATS4 | CCUGUAACCCUGUAUCAUUUGCUAA | HSS111971 | Invitrogen | |
| HDAC3 | GCAACCCAGCUGAACAACAtt | 120349 | Invitrogen | |
| ASH2L | GAUAAAUACUGGGAGUGCAUGACAA | HSS113411 | Invitrogen | |
| VPS72 | GCCGAGUAGUCACCAAGGCCUAUAA | HSS110566 | Invitrogen | |
| VPS72 | A | CAGCUGAGCAUACACGACAAACGUU | HSS186242 | Invitrogen | 
| VPS72 | B | GAAGAUGAGUUCUACCAGATT | S13908 | Invitrogen | 
| VPS72 | C | CCUUCAAGAUCAUUCGUGATT | S13909 | Invitrogen | 
| hINO80 | A | GCAAGGGAAAUAAUGUUCCUGGGAA | HSS123095 | Invitrogen | 
| hINO80 | B | CGACAAACGUCAGCUAUCUUCAAUA | HSS182590 | Invitrogen | 
| hINO80 | C | CAGAAUAUGAAAGGCGAGUUCUGAA | HSS182591 | Invitrogen | 
| SRCAP | A | GCGUGAUGUUGAACUGGGAGAUGGA | HSS116728 | Invitrogen | 
| SRCAP | B | GCGCCUCAUUCUAUCUCCCGAUAUG | HSS116729 | Invitrogen | 
| SRCAP | C | CCCUCCUUCACAGAUUCCUCCUUGU | HSS116730 | Invitrogen | 
| EP400 | A | CCAGUCUAUGGCAGAGACUUGCUAA | HSS126583 | Invitrogen | 
| EP400 | B | GGGAGAUGCAAAGACAUCCACAUAU | HSS126584 | Invitrogen | 
| EP400 | C | GGGCAAGGAGCAGAAGAAGAAUAUU | HSS126585 | Invitrogen | 
| H2A.Z | A | GCUAUUGAUUCUGAAGUAGUGGGUU | HSS142376 | Invitrogen | 
| H2A.Z | B | CCACUCUGGUGGAUAAGUUCAAUAA | HSS142377 | Invitrogen | 
| H2A.Z | C | UGGGCCGUAUUCAUCGACACCUAAA | HSS179165 | Invitrogen | 
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Moreno-Andrés, D.; Yokoyama, H.; Scheufen, A.; Holzer, G.; Lue, H.; Schellhaus, A.K.; Weberruss, M.; Takagi, M.; Antonin, W. VPS72/YL1-Mediated H2A.Z Deposition Is Required for Nuclear Reassembly after Mitosis. Cells 2020, 9, 1702. https://doi.org/10.3390/cells9071702
Moreno-Andrés D, Yokoyama H, Scheufen A, Holzer G, Lue H, Schellhaus AK, Weberruss M, Takagi M, Antonin W. VPS72/YL1-Mediated H2A.Z Deposition Is Required for Nuclear Reassembly after Mitosis. Cells. 2020; 9(7):1702. https://doi.org/10.3390/cells9071702
Chicago/Turabian StyleMoreno-Andrés, Daniel, Hideki Yokoyama, Anja Scheufen, Guillaume Holzer, Hongqi Lue, Anna Katharina Schellhaus, Marion Weberruss, Masatoshi Takagi, and Wolfram Antonin. 2020. "VPS72/YL1-Mediated H2A.Z Deposition Is Required for Nuclear Reassembly after Mitosis" Cells 9, no. 7: 1702. https://doi.org/10.3390/cells9071702
APA StyleMoreno-Andrés, D., Yokoyama, H., Scheufen, A., Holzer, G., Lue, H., Schellhaus, A. K., Weberruss, M., Takagi, M., & Antonin, W. (2020). VPS72/YL1-Mediated H2A.Z Deposition Is Required for Nuclear Reassembly after Mitosis. Cells, 9(7), 1702. https://doi.org/10.3390/cells9071702
        
