Purity Determines the Effect of Extracellular Vesicles Derived from Mesenchymal Stromal Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Mesenchymal Stromal Cells Culture, EVs Production and Ultracentrifugation
2.2. Size Exclusion Chromatography
2.3. Total Protein Quantification
2.4. Atomic Force Microscopy (AFM)
2.5. Transmission Electron Microscopy (TEM)
2.6. Nanoparticle Tracking Analysis (NTA) and Purity Ratio
2.7. Western Blot
2.8. Chondrogenic Cell Line Culture: Functional Study
2.9. Lactate Dehydrogenase Activity
2.10. Cell Metabolic Activity
2.11. Collagen Quantification
2.12. RNA Isolation and Real-Time RT-PCR Analysis
2.13. Statistical Analysis
3. Results
3.1. Characterization of MSC-Derived EVs Isolated by Ultracentrifugation
3.2. Functional Study: UC and UCw/o
3.3. EV and Protein Fractions Characterization
3.4. Functional Study with the SEC Purified Fractions
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Vizoso, F.J.; Eiro, N.; Cid, S.; Schneider, J.; Perez-Fernandez, R. Mesenchymal Stem Cell Secretome: Toward Cell-Free Therapeutic Strategies in Regenerative Medicine. Int. J. Mol. Sci. 2017, 18, 1852. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Caplan, A.I.; Correa, D. The MSC: An Injury Drugstore. Cell Stem Cell 2011, 9, 11–15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, S.; Xie, N.; Li, W.; Yuan, B.; Shi, Y.; Wang, Y. Immunobiology of mesenchymal stem cells. Cell Death Differ. 2014, 21, 216–225. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bennet, L.; Tan, S.; Heuij, L.V.D.; Derrick, M.; Groenendaal, F.; Van Bel, F.; Juul, S.; Back, S.A.; Northington, F.; Robertson, N.J.; et al. Cell therapy for neonatal hypoxia-ischemia and cerebral palsy. Ann. Neurol. 2012, 71, 589–600. [Google Scholar] [CrossRef] [Scilit]
- Chen, J.; Li, Y.; Katakowski, M.; Chen, X.; Wang, L.; Lu, D.; Lü, M.; Gautam, S.C.; Chopp, M. Intravenous bone marrow stromal cell therapy reduces apoptosis and promotes endogenous cell proliferation after stroke in female rat. J. Neurosci. Res. 2003, 73, 778–786. [Google Scholar] [CrossRef] [Scilit]
- Chimenti, I.; Smith, R.R.; Li, T.-S.; Gerstenblith, G.; Messina, E.; Giacomello, A.; Marbán, E. Relative roles of direct regeneration versus paracrine effects of human cardiosphere-derived cells transplanted into infarcted mice. Circ. Res. 2010, 106, 971–980. [Google Scholar] [CrossRef] [Scilit]
- Katsha, A.M.; Ohkouchi, S.; Xin, H.; Kanehira, M.; Sun, R.; Nukiwa, T.; Saijo, Y. Paracrine factors of multipotent stromal cells ameliorate lung injury in an elastase-induced emphysema model. Mol. Ther. 2011, 19, 196–203. [Google Scholar] [CrossRef] [Scilit]
- Lee, J.W.; Fang, X.; Gupta, N.; Serikov, V.; Matthay, M.A. Allogeneic human mesenchymal stem cells for treatment of E. coli endotoxin-induced acute lung injury in the ex vivo perfused human lung. Proc. Natl. Acad. Sci. USA 2009, 106, 16357–16362. [Google Scholar] [CrossRef] [Scilit]
- Timmers, L.; Lim, S.K.; Arslan, F.; Armstrong, J.S.; Hoefer, I.E.; Doevendans, P.A.; Piek, J.J.; El Oakley, R.M.; Choo, A.; Lee, C.N.; et al. Reduction of myocardial infarct size by human mesenchymal stem cell conditioned medium. Stem Cell Res. 2008, 1, 129–137. [Google Scholar] [CrossRef] [Scilit]
- Gnecchi, M.; He, H.; Noiseux, N.; Liang, O.D.; Zhang, L.; Morello, F.; Mu, H.; Melo, L.G.; Pratt, R.E.; Ingwall, J.S.; et al. Evidence supporting paracrine hypothesis for Akt-modified mesenchymal stem cell-mediated cardiac protection and functional improvement. FASEB J. 2006, 20, 661–669. [Google Scholar] [CrossRef] [Scilit]
- Gnecchi, M.; He, H.; Liang, O.D.; Melo, L.G.; Morello, F.; Mu, H.; Noiseux, N.; Zhang, L.; Pratt, R.E.; Ingwall, J.S.; et al. Paracrine action accounts for marked protection of ischemic heart by Akt-modified mesenchymal stem cells. Nat. Med. 2005, 11, 367–368. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Caplan, A.I.; Dennis, J.E. Mesenchymal stem cells as trophic mediators. J. Cell. Biochem. 2006, 98, 1076–1084. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Heldring, N.; Mäger, I.; Wood, M.J.; Le Blanc, K.; Andaloussi, S.E. Therapeutic Potential of Multipotent Mesenchymal Stromal Cells and Their Extracellular Vesicles. Hum. Gene Ther. 2015, 26, 506–517. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bruno, S.; Grange, C.; Deregibus, M.C.; Calogero, R.A.; Saviozzi, S.; Collino, F.; Morando, L.; Busca, A.; Falda, M.; Bussolati, B.; et al. Mesenchymal stem cell-derived microvesicles protect against acute tubular injury. J. Am. Soc. Nephrol. 2009, 20, 1053–1067. [Google Scholar] [CrossRef] [Scilit]
- Lai, R.C.; Arslan, F.; Lee, M.M.; Sze, N.S.K.; Choo, A.; Chen, T.S.; Salto-Tellez, M.; Timmers, L.; Lee, C.N.; El Oakley, R.M.; et al. Exosome secreted by MSC reduces myocardial ischemia/reperfusion injury. Stem Cell Res. 2010, 4, 214–222. [Google Scholar] [CrossRef] [Scilit]
- Colombo, M.; Raposo, G.; Théry, C. Biogenesis, Secretion, and Intercellular Interactions of Exosomes and Other Extracellular Vesicles. Annu. Rev. Cell Dev. Boil. 2014, 30, 255–289. [Google Scholar] [CrossRef] [Scilit]
- Lai, R.C.; Yeo, R.W.Y.; Tan, K.H.; Lim, S.K. Exosomes for drug delivery—A novel application for the mesenchymal stem cell. Biotechnol. Adv. 2013, 31, 543–551. [Google Scholar] [CrossRef] [Scilit]
- Codispoti, B.; Marrelli, M.; Paduano, F.; Tatullo, M. NANOmetric BIO-Banked MSC-Derived Exosome (NANOBIOME) as a Novel Approach to Regenerative Medicine. J. Clin. Med. 2018, 7, 357. [Google Scholar] [CrossRef] [Scilit]
- Marcus, M.E.; Leonard, J.N. FedExosomes: Engineering Therapeutic Biological Nanoparticles that Truly Deliver. Pharm. 2013, 6, 659–680. [Google Scholar] [CrossRef] [Scilit]
- Lener, T.; Gimona, M.; Aigner, L.; Börger, V.; Buzas, E.; Camussi, G.; Chaput, N.; Chatterjee, D.; Court, F.A.; Del Portillo, H.A.; et al. Applying extracellular vesicles based therapeutics in clinical trials–an ISEV position paper. J. Extracell. Vesicles 2015, 4, 30087. [Google Scholar] [CrossRef] [Scilit]
- Näslund, T.I.; Gehrmann, U.; Qazi, K.R.; Karlsson, M.C.I.; Gabrielsson, S. Dendritic Cell–Derived Exosomes Need To Activate Both T and B Cells To Induce Antitumor Immunity. J. Immunol. 2013, 190, 2712–2719. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lugini, L.; Cecchetti, S.; Huber, V.; Luciani, F.; Macchia, G.; Spadaro, F.; Paris, L.; Abalsamo, L.; Colone, M.; Molinari, A.; et al. Immune Surveillance Properties of Human NK Cell-Derived Exosomes. J. Immunol. 2012, 189, 2833–2842. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Beauvillain, C.; Ruiz, S.; Guiton, R.; Bout, D.; Dimier-Poisson, I. A vaccine based on exosomes secreted by a dendritic cell line confers protection against T. gondii infection in syngeneic and allogeneic mice. Microbes Infect. 2007, 9, 1614–1622. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Beauvillain, C.; Juste, M.O.; Dion, S.; Pierre, J.; Dimier-Poisson, I. Exosomes are an effective vaccine against congenital toxoplasmosis in mice. Vaccine 2009, 27, 1750–1757. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Herrera, M.B.; Fonsato, V.; Gatti, S.; Deregibus, M.C.; Sordi, A.; Cantarella, D.; Calogero, R.; Bussolati, B.; Tetta, C.; Camussi, G. Human liver stem cell-derived microvesicles accelerate hepatic regeneration in hepatectomized rats. J. Cell Mol. Med. 2010, 14, 1605–1618. [Google Scholar] [CrossRef] [Scilit]
- Tan, C.Y.; Lai, R.C.; Wong, W.; Dan, Y.Y.; Lim, S.-K.; Ho, H.K. Mesenchymal stem cell-derived exosomes promote hepatic regeneration in drug-induced liver injury models. Stem Cell Res. Ther. 2014, 5, 76. [Google Scholar] [CrossRef] [Scilit]
- Li, T.; Yan, Y.; Wang, B.; Qian, H.; Zhang, X.; Shen, L.; Wang, M.; Zhou, Y.; Zhu, W.; Li, W.; et al. Exosomes derived from human umbilical cord mesenchymal stem cells alleviate liver fibrosis. Stem Cells Dev. 2013, 22, 845–854. [Google Scholar] [CrossRef] [Scilit]
- Xin, H.; Li, Y.; Cui, Y.; Yang, J.J.; Zhang, Z.G.; Chopp, M. Systemic Administration of Exosomes Released from Mesenchymal Stromal Cells Promote Functional Recovery and Neurovascular Plasticity After Stroke in Rats. Br. J. Pharmacol. 2013, 33, 1711–1715. [Google Scholar] [CrossRef] [Scilit]
- Van Der Valk, J.; Mellor, D.; Brands, R.; Fischer, R.; Gruber, F.; Gstraunthaler, G.; Hellebrekers, L.; Hyllner, J.; Jonker, F.H.; Prieto, P.; et al. The humane collection of fetal bovine serum and possibilities for serum-free cell and tissue culture. Toxicol. Vitr. 2004, 18, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Shelke, G.V.; Lässer, C.; Gho, Y.S.; Lötvall, J. Importance of exosome depletion protocols to eliminate functional and RNA-containing extracellular vesicles from fetal bovine serum. J. Extracell. Vesicles 2014, 3, 24783. [Google Scholar] [CrossRef] [Scilit]
- Torreggiani, E.; Perut, F.; Roncuzzi, L.; Zini, N.; Baglìo, S.R.; Baldini, N. Exosomes: Novel effectors of human platelet lysate activity. Eur. Cell Mater. 2014, 28, 137–151. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, J.; Lee, Y.; Johansson, H.J.; Mäger, I.; Vader, P.; Nordin, J.Z.; Wiklander, O.P.B.; Lehtiö, J.; Wood, M.J.A.; El Andaloussi, S. Serum-free culture alters the quantity and protein composition of neuroblastoma-derived extracellular vesicles. J. Extracell. Vesicles 2015, 4, 26883. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Théry, C.; Witwer, K.W.; Aikawa, E.; Alcaraz, M.J.; Anderson, J.D.; Andriantsitohaina, R.; Antoniou, A.; Arab, T.; Archer, F.; Atkin-Smith, G.K.; et al. Minimal information for studies of extracellular vesicles 2018 (MISEV2018): A position statement of the International Society for Extracellular Vesicles and update of the MISEV2014 guidelines. J. Extracell. Vesicles 2018, 7, 1535750. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yamashita, T.; Takahashi, Y.; Takakura, Y. Possibility of Exosome-Based Therapeutics and Challenges in Production of Exosomes Eligible for Therapeutic Application. Boil. Pharm. Bull. 2018, 41, 835–842. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Witwer, K.W.; Buzás, E.I.; Bemis, L.T.; Bora, A.; Lässer, C.; Lötvall, J.; Hoen, E.N.N.-T.; Piper, M.G.; Sivaraman, S.; Skog, J.; et al. Standardization of sample collection, isolation and analysis methods in extracellular vesicle research. J. Extracell. Vesicles 2013, 2, 18389. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kowal, J.; Arras, G.; Colombo, M.; Jouve, M.; Morath, J.P.; Primdal-Bengtson, B.; Dingli, F.; Loew, D.; Tkach, M.; Théry, C. Proteomic comparison defines novel markers to characterize heterogeneous populations of extracellular vesicle subtypes. Proc. Natl. Acad. Sci. USA 2016, 113, E968–E977. [Google Scholar] [CrossRef] [Scilit]
- Harting, M.T.; Srivastava, A.K.; Zhaorigetu, S.; Bair, H.; Prabhakara, K.S.; Toledano Furman, N.E.; Vykoukal, J.V.; Ruppert, K.A.; Cox, C.S.; Olson, S.D. Inflammation-Stimulated Mesenchymal Stromal Cell-Derived Extracellular Vesicles Attenuate Inflammation. Stem Cells 2018, 36, 79–90. [Google Scholar] [CrossRef] [Scilit]
- Momen-Heravi, F. Isolation of Extracellular Vesicles by Ultracentrifugation. Adv. Struct. Safety Stud. 2017, 1660, 25–32. [Google Scholar]
- Konoshenko, M.Y.; Lekchnov, E.A.; Vlassov, A.V.; Laktionov, P.P. Isolation of Extracellular Vesicles: General Methodologies and Latest Trends. BioMed Res. Int. 2018, 2018, 8545347. [Google Scholar] [CrossRef] [Scilit]
- Lozano-Ramos, I.; Bancu, I.; Oliveira-Tercero, A.; Armengol, M.P.; Menezes-Neto, A.; Del Portillo, H.A.; Lauzurica-Valdemoros, R.; Borràs, F.E. Size-exclusion chromatography-based enrichment of extracellular vesicles from urine samples. J. Extracell. Vesicles 2015, 4, 27369. [Google Scholar] [CrossRef] [Scilit]
- Gámez-Valero, A.; Monguió-Tortajada, M.; Carreras-Planella, L.; Franquesa, M.; Beyer, K.; Borràs, F.E. Size-Exclusion Chromatography-based isolation minimally alters Extracellular Vesicles’ characteristics compared to precipitating agents. Sci. Rep. 2016, 6, 33641. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Takov, K.; Yellon, D.M.; Davidson, S.M. Comparison of small extracellular vesicles isolated from plasma by ultracentrifugation or size-exclusion chromatography: Yield, purity and functional potential. J. Extracell. Vesicles 2019, 8, 1560809. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Freitas, D.; Balmaña, M.; Poças, J.; Campos, D.; Osório, H.; Konstantinidi, A.; Vakhrushev, S.Y.; Magalhães, A.; Reis, C.A. Different isolation approaches lead to diverse glycosylated extracellular vesicle populations. J. Extracell. Vesicles 2019, 8, 1621131. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rood, I.M.; Deegens, J.K.; Merchant, M.L.; Tamboer, W.P.; Wilkey, D.W.; Wetzels, J.F.; Klein, J.B. Comparison of three methods for isolation of urinary microvesicles to identify biomarkers of nephrotic syndrome. Kidney Int. 2010, 78, 810–816. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Karp, N.A.; Lilley, K.S. Investigating sample pooling strategies for DIGE experiments to address biological variability. Proteom. 2009, 9, 388–397. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dominici, M.; Le Blanc, K.; Mueller, I.; Slaper-Cortenbach, I.; Marini, F.; Krause, D.; Deans, R.; Keating, A.; Prockop, D.; Horwitz, E. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 2006, 8, 315–317. [Google Scholar] [CrossRef] [Scilit]
- Forteza-Genestra, M.A.; Antich-Rosselló, M.; Monjo, M.; Ramis, J.M. Use of Extracellular Vesicles for Cell-Free Regenerative Medicine in Osteochondral and Bone-Related Therapies. Biomed. J. Sci. Tech. Res. 2018, 3, 36–38. [Google Scholar] [CrossRef] [Scilit]
- Böing, A.N.; Van Der Pol, E.; Grootemaat, A.E.; Coumans, F.A.W.; Sturk, A.; Nieuwland, R. Single-step isolation of extracellular vesicles by size-exclusion chromatography. J. Extracell. Vesicles 2014, 3, 42. [Google Scholar] [CrossRef] [Scilit]
- Webber, J.; Clayton, A. How pure are your vesicles? J. Extracell. Vesicles 2013, 2, 1–6. [Google Scholar] [CrossRef] [Scilit]
- Rubert, M.; Ramis, J.M.; Vondrasek, J.; Gayá, A.; Lyngstadaas, S.P.; Monjo, M. Synthetic Peptides Analogue to Enamel Proteins Promote Osteogenic Differentiation of MC3T3-E1 and Mesenchymal Stem Cells. J. Biomater. Tissue Eng. 2011, 1, 198–209. [Google Scholar] [CrossRef] [Scilit]
- Coumans, F.A.; Brisson, A.R.; Buzas, E.I.; Dignat-George, F.; Drees, E.E.; El-Andaloussi, S.; Emanueli, C.; Gasecka, A.; Hendrix, A.; Hill, A.F.; et al. Methodological Guidelines to Study Extracellular Vesicles. Circ. Res. 2017, 120, 1632–1648. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bewicke-Copley, F.; Mulcahy, L.A.; Jacobs, L.A.; Samuel, P.; Akbar, N.; Pink, R.C.; Carter, D.R.F. Extracellular vesicles released following heat stress induce bystander effect in unstressed populations. J. Extracell. Vesicles 2017, 6, 1340746. [Google Scholar] [CrossRef] [Scilit]
- De Jong, O.G.; Verhaar, M.C.; Chen, Y.; Vader, P.; Gremmels, H.; Posthuma, G.; Schiffelers, R.M.; Gucek, M.; van Balkom, B.W.M. Cellular stress conditions are reflected in the protein and RNA content of endothelial cell-derived exosomes. J. Extracell. Vesicles 2012, 1, 1–12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Collett, G.P.; Redman, C.W.; Sargent, I.L.; Vatish, M. Endoplasmic reticulum stress stimulates the release of extracellular vesicles carrying danger-associated molecular pattern (DAMP) molecules. Oncotarget 2018, 9, 6707–6717. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bard, M.P.; Hegmans, J.P.; Hemmes, A.; Luider, T.M.; Willemsen, R.; Severijnen, L.-A.A.; Van Meerbeeck, J.P.; Burgers, S.A.; Hoogsteden, H.C.; Lambrecht, B.N. Proteomic Analysis of Exosomes Isolated from Human Malignant Pleural Effusions. Am. J. Respir. Cell Mol. Boil. 2004, 31, 114–121. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mol, E.A.; Goumans, M.-J.; Doevendans, P.A.; Sluijter, J.P.; Vader, P. Higher functionality of extracellular vesicles isolated using size-exclusion chromatography compared to ultracentrifugation. Nanomed. Nanotechnol. Boil. Med. 2017, 13, 2061–2065. [Google Scholar] [CrossRef] [Scilit] [PubMed]



| Related Function | Gene | Primer Sequence (5′→3′) | Product Size (bp) | GeneBank Accession Number |
|---|---|---|---|---|
| ECM component | Collagen type I, alpha 1 (Col1a1) | S: AGAGCATGACCGATGGATTC A: CCTTCTTGAGGTTGCCAGTC | 177 | NM_007742.4 |
| ECM component | Collagen type II, alpha 1 (Col2a1) | S: CCTGCAGGTGCTTCTGGTAA A: TAAAGCCAGCAATGCCAGGT | 184 | NM_031163.3 |
| ECM component | Decorin (Dcn) | S: TTGATGCACCCAGCCTGAAA A: TGTGAAGGTAGACGACCTGG | 195 | NM_001190451.2 |
| ECM component | Aggrecan (Acan) | S: TGACGGACACTCTCTGCAAT A: CACGGTGCCCTTTTTACACG | 163 | NM_007424.2 |
| ECM turnover | Matrix metalloproteinase-3 (Mmp3) | S: TAAAGACAGGCACTTTTGGCG A: GGAGACCCAGGGTGTGAATG | 218 | NM_010809.2 |
| ECM turnover | Matrix metalloproteinase-13 (Mmp13) | S: GCCATTACCAGTCTCCGAGG A: GAGCCCAGAATTTTCTCCCTCT | 196 | NM_008607.2 |
| ECM turnover | Metallopeptidase inhibitor 1 (Timp1) | S: GATCGGGGCTCCTAGAGACA A: AGCCCTTATGACCAGGTCCG | 168 | NM_011593.2 |
| Reference gene | 18s ribosomal RNA (Rn18s) | S: GTAACCCGTTGAACCCCATT A: CCATCCAATCGGTAGTAGCG | 151 | NR_003278.3 |
| Reference gene | Glyceraldehyde 3-phosphate dehydrogenase (Gapdh) | S: ACCCAGAAGACTGTGGATGG A: CACATTGGGGGTAGGAACAC | 171 | NM_008084.3 |
| Sample | Number Particles (Particles/mL) | NTA Size | Protein Content (µg/µL) | Purity Ratio (Particles/µg) § |
|---|---|---|---|---|
| UC | 6.30 × 1010 | 150 ± 61.2 | 21.4 | 2.94 × 109 |
| UCw/o | 2.20 × 1011 | 154 ± 59.8 * | 0.800 * | 2.75 × 1011 |
| EV | 1.20 × 1011 | 122 ± 73.5 | 0.050 | 2.40 × 1012 |
| EVw/o | 6.40 × 1010 | 147 ± 78.4 * | 0.080 | 8.00 × 1011 |
| Prot | 7.50 × 109 | 192 ± 107.1 | 3.52 | 2.13 × 109 |
| Protw/o | 5.10 × 1010 | 187 ± 119.7 | 0.270* | 1.89 × 1011 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Forteza-Genestra, M.A.; Antich-Rosselló, M.; Calvo, J.; Gayà, A.; Monjo, M.; Ramis, J.M. Purity Determines the Effect of Extracellular Vesicles Derived from Mesenchymal Stromal Cells. Cells 2020, 9, 422. https://doi.org/10.3390/cells9020422
Forteza-Genestra MA, Antich-Rosselló M, Calvo J, Gayà A, Monjo M, Ramis JM. Purity Determines the Effect of Extracellular Vesicles Derived from Mesenchymal Stromal Cells. Cells. 2020; 9(2):422. https://doi.org/10.3390/cells9020422
Chicago/Turabian StyleForteza-Genestra, Maria Antònia, Miquel Antich-Rosselló, Javier Calvo, Antoni Gayà, Marta Monjo, and Joana Maria Ramis. 2020. "Purity Determines the Effect of Extracellular Vesicles Derived from Mesenchymal Stromal Cells" Cells 9, no. 2: 422. https://doi.org/10.3390/cells9020422
APA StyleForteza-Genestra, M. A., Antich-Rosselló, M., Calvo, J., Gayà, A., Monjo, M., & Ramis, J. M. (2020). Purity Determines the Effect of Extracellular Vesicles Derived from Mesenchymal Stromal Cells. Cells, 9(2), 422. https://doi.org/10.3390/cells9020422

