Tendon Biomimetic Electrospun PLGA Fleeces Induce an Early Epithelial-Mesenchymal Transition and Tenogenic Differentiation on Amniotic Epithelial Stem Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Fabrication of PLGA Fleeces
2.3. Characterization of PLGA Electrospun Fleeces
2.4. Fleece Mechanical Tests
2.5. Fleece Sterilization and Conditioning
2.6. Fourier Transform Infrared Spectroscopy (FTIR) Analysis
2.7. Ovine AEC Isolation and Culture and Fetal Tendon Isolation
2.8. Cell Survival on Fleeces
2.9. Ovine AEC Spatial Distribution, Morphology, and Proliferation Index
- Cell morphology using phalloidin staining and SEM observation;
- Cell proliferation index (PI) by evaluating Ki-67 positivity;
- Cytokeratin 8 and a-SMA expression to evaluate the EMT;
- COL1 expression to evaluate tenogenic differentiation.
2.10. DNA Extraction and Quantification
2.11. Gene Expression Profile by RT-qPCR
2.12. Co-Culture Systems with Fetal Tendon Explants/PLGA Fleeces Engineered with oAECs
2.13. Statistical Analysis
3. Results
3.1. PLGA Fleece Characterization: Morphology, Mechanical Properties and Chemical Composition
3.2. PLGA Fleece Biocompatibility for oAECs
3.3. ha-PLGA Fleeces Induce oAEC Epithelial-Mesenchymal Transition
3.4. ha-PLGA Fleece Possesses Teno-Inductive Properties on oAECs
3.5. ha-PLGA-oAEC Bio-Hybrid Fleece Co-Culture with Fetal Tendons Accelerates Tenogenic Differentiation
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Abbah, S.A.; Spanoudes, K.; O’Brien, T.; Pandit, A.; Zeugolis, D.I. Assessment of stem cell carriers for tendon tissue engineering in pre-clinical models. Stem Cell Res. Ther. 2014, 5, 38. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lomas, A.J.J.; Ryan, C.N.M.N.M.; Sorushanova, A.; Shologu, N.; Sideri, A.I.I.; Tsioli, V.; Fthenakis, G.C.C.; Tzora, A.; Skoufos, I.; Quinlan, L.R.R.; et al. The past, present and future in scaffold-based tendon treatments. Adv. Drug Deliv. Rev. 2015, 84, 257–277. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Longo, U.G.; Lamberti, A.; Maffulli, N.; Denaro, V. Tendon augmentation grafts: A systematic review. Br. Med. Bull. 2010, 94, 165–188. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zeugolis, D.I.; Chan, J.C.Y.; Pandit, A. Tendons: Engineering of Functional Tissues. In Tissue Engineering; Springer: Berlin/Heidelberg, Germany, 2011; pp. 537–572. [Google Scholar]
- Williams, R.B.; Harkins, L.S.; Hammond, C.J.; Wood, J.L. Racehorse injuries, clinical problems and fatalities recorded on British racecourses from flat racing and National Hunt racing during 1996, 1997 and 1998. Equine Vet. J. 2001, 33, 478–486. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alves, A.G.; Stewart, A.A.; Dudhia, J.; Kasashima, Y.; Goodship, A.E.; Smith, R.K. Cell-based Therapies for Tendon and Ligament Injuries. Vet. Clin. N. Am. Equine Pract. 2011, 27, 315–333. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wong, R.; Alam, N.; McGrouther, A.D.; Wong, J.K. Tendon grafts: Their natural history, biology and future development. J. Hand Surg. Eur. Vol. 2015, 40, 669–681. [Google Scholar] [CrossRef] [Scilit]
- Walden, G.; Liao, X.; Donell, S.; Raxworthy, M.J.; Riley, G.P.; Saeed, A. A Clinical, Biological, and Biomaterials Perspective into Tendon Injuries and Regeneration. Tissue Eng. Part B Rev. 2017, 23, 44–58. [Google Scholar] [CrossRef] [Scilit]
- Ratcliffe, A.; Butler, D.L.; Dyment, N.A.; Cagle, P.J.; Proctor, C.S.; Ratcliffe, S.S.; Flatow, E.L. Scaffolds for Tendon and Ligament Repair and Regeneration. Ann. Biomed. Eng. 2015, 43, 819–831. [Google Scholar] [CrossRef] [Scilit]
- Bas, O.; De-Juan-Pardo, E.M.; Meinert, C.; D’Angella, D.; Baldwin, J.G.; Bray, L.J.; Wellard, R.M.; Kollmannsberger, S.; Rank, E.; Werner, C.; et al. Biofabricated soft network composites for cartilage tissue engineering. Biofabrication 2017, 9, 025014. [Google Scholar] [CrossRef] [Scilit]
- Kitsara, M.; Agbulut, O.; Kontziampasis, D.; Chen, Y.; Menasché, P. Fibers for hearts: A critical review on electrospinning for cardiac tissue engineering. Acta Biomater. 2017, 48, 20–40. [Google Scholar] [CrossRef] [Scilit]
- Gugerell, A.; Kober, J.; Laube, T.; Walter, T.; Nürnberger, S.; Grönniger, E.; Brönneke, S.; Wyrwa, R.; Schnabelrauch, M.; Keck, M. Electrospun Poly(ester-Urethane)-and Poly(ester-Urethane-Urea) Fleeces as Promising Tissue Engineering Scaffolds for Adipose-Derived Stem Cells. PLoS ONE 2014, 9, e90676. [Google Scholar] [CrossRef] [Scilit]
- Kluger, P.J.; Wyrwa, R.; Weisser, J.; Maierle, J.; Votteler, M.; Rode, C.; Schnabelrauch, M.; Walles, H.; Schenke-Layland, K. Electrospun poly(D/L-lactide-co-L-lactide) hybrid matrix: A novel scaffold material for soft tissue engineering. J. Mater. Sci. Mater. Med. 2010, 21, 2665–2671. [Google Scholar] [CrossRef] [Scilit]
- Orr, S.B.; Chainani, A.; Hippensteel, K.J.; Kishan, A.; Gilchrist, C.; Garrigues, N.W.; Ruch, D.S.; Guilak, F.; Little, D. Aligned multilayered electrospun scaffolds for rotator cuff tendon tissue engineering. Acta Biomater. 2015, 24, 117–126. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sahoo, S.; Ang, L.-T.; Cho-Hong Goh, J.; Toh, S.-L. Bioactive nanofibers for fibroblastic differentiation of mesenchymal precursor cells for ligament/tendon tissue engineering applications. Differentiation 2010, 79, 102–110. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moffat, K.L.; Kwei, A.S.-P.; Spalazzi, J.P.; Doty, S.B.; Levine, W.N.; Lu, H.H. Novel Nanofiber-Based Scaffold for Rotator Cuff Repair and Augmentation. Tissue Eng. Part A 2009, 15, 115–126. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cao, D.; Liu, W.; Wei, X.; Xu, F.; Cui, L.; Cao, Y. In vitro tendon engineering with avian tenocytes and polyglycolic acids: A preliminary report. Tissue Eng. 2006, 12, 1369–1377. [Google Scholar] [CrossRef] [Scilit]
- Hochleitner, G.; Chen, F.; Blum, C.; Dalton, P.D.; Amsden, B.; Groll, J. Melt electrowriting below the critical translation speed to fabricate crimped elastomer scaffolds with non-linear extension behaviour mimicking that of ligaments and tendons. Acta Biomater. 2018, 72, 110–120. [Google Scholar] [CrossRef] [Scilit]
- Rothrauff, B.B.; Lauro, B.B.; Yang, G.; Debski, R.E.; Musahl, V.; Tuan, R.S. Braided and Stacked Electrospun Nanofibrous Scaffolds for Tendon and Ligament Tissue Engineering. Tissue Eng. Part A 2017, 23, 378–389. [Google Scholar] [CrossRef] [Scilit]
- Jiang, J.; Li, Z.; Wang, H.; Wang, Y.; Carlson, M.A.; Teusink, M.J.; MacEwan, M.R.; Gu, L.; Xie, J. Expanded 3D Nanofiber Scaffolds: Cell Penetration, Neovascularization, and Host Response. Adv. Healthc. Mater. 2016, 5, 2993–3003. [Google Scholar] [CrossRef] [Scilit]
- Khorshidi, S.; Solouk, A.; Mirzadeh, H.; Mazinani, S.; Lagaron, J.M.; Sharifi, S.; Ramakrishna, S. A review of key challenges of electrospun scaffolds for tissue-engineering applications. J. Tissue Eng. Regen. Med. 2016, 10, 715–738. [Google Scholar] [CrossRef] [Scilit]
- Wu, S.; Wang, Y.; Streubel, P.N.; Duan, B. Living Nanofiber Yarn-Based Woven Biotextiles for Tendon Tissue Engineering Using Cell Tri-Culture and Mechanical Stimulation. Acta Biomater. 2017, 62, 102–115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gaspar, D.; Spanoudes, K.; Holladay, C.; Pandit, A.; Zeugolis, D. Progress in cell-based therapies for tendon repair. Adv. Drug Deliv. Rev. 2015, 84, 240–256. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- James, R.; Kumbar, S.G.; Laurencin, C.T.; Balian, G.; Chhabra, A.B. Tendon tissue engineering: Adipose-derived stem cell and GDF-5 mediated regeneration using electrospun matrix systems. Biomed. Mater. 2011, 6, 025011. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sahoo, S.; Goh Cho-Hong, J.; Siew-Lok, T. Development of hybrid polymer scaffolds for potential applications in ligament and tendon tissue engineering. Biomed. Mater 2007, 2, 169–173. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ouyang, H.W.; Cao, T.; Zou, X.H.; Heng, B.C.; Wang, L.L.; Song, X.H.; Huang, H.F. Mesenchymal Stem Cell Sheets Revitalize Nonviable Dense Grafts: Implications for Repair of Large-Bone and Tendon Defects. Transplantation 2006, 82, 170–174. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, W.; Chen, B.; Deng, D.; Xu, F.; Cui, L.; Cao, Y. Repair of Tendon Defect with Dermal Fibroblast Engineered Tendon in a Porcine Model. Tissue Eng. 2006, 12, 775–778. [Google Scholar] [CrossRef] [Scilit]
- Chong, A.K.S.; Ang, A.D.; Goh, J.C.H.; Hui, J.H.P.; Lim, A.Y.T.; Lee, E.H.; Lim, B.H. Bone Marrow-Derived Mesenchymal Stem Cells Influence Early Tendon-Healing in a Rabbit Achilles Tendon Model. J. Bone Jt. Surg. 2007, 89, 74–81. [Google Scholar] [CrossRef] [Scilit]
- Ge, Z.; Goh, J.C.H.; Lee, E.H. The Effects of Bone Marrow-Derived Mesenchymal Stem Cells and Fascia Wrap Application to Anterior Cruciate Ligament Tissue Engineering. Cell Transplant. 2005, 14, 763–773. [Google Scholar] [CrossRef] [Scilit]
- Harris, M.T.; Butler, D.L.; Boivin, G.P.; Florer, J.B.; Schantz, E.J.; Wenstrup, R.J. Mesenchymal stem cells used for rabbit tendon repair can form ectopic bone and express alkaline phosphatase activity in constructs. J. Orthop. Res. 2004, 22, 998–1003. [Google Scholar] [CrossRef] [Scilit]
- Hoffmann, A.; Pelled, G.; Turgeman, G.; Eberle, P.; Zilberman, Y.; Shinar, H.; Keinan-Adamsky, K.; Winkel, A.; Shahab, S.; Navon, G.; et al. Neotendon formation induced by manipulation of the Smad8 signalling pathway in mesenchymal stem cells. J. Clin. Investig. 2006, 116, 940–952. [Google Scholar] [CrossRef] [Scilit]
- Barboni, B.; Russo, V.; Curini, V.; Mauro, A.; Martelli, A.; Muttini, A.; Bernabò, N.; Valbonetti, L.; Marchisio, M.; Di Giacinto, O.; et al. Achilles Tendon Regeneration can be Improved by Amniotic Epithelial Cell Allotransplantation. Cell Transplant. 2012, 21, 2377–2395. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barboni, B.; Curini, V.; Russo, V.; Mauro, A.; Giacinto, O.; Marchisio, M.; Alfonsi, M.; Mattioli, M. Indirect Co-Culture with Tendons or Tenocytes Can Program Amniotic Epithelial Cells towards Stepwise Tenogenic Differentiation. PLoS ONE 2012, 7, e30974–e30987. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barboni, B.; Russo, V.; Berardinelli, P.; Mauro, A.; Valbonetti, L.; Sanyal, H.; Canciello, A.; Greco, L.; Muttini, A.; Gatta, V.; et al. Placental Stem Cells from Domestic Animals: Translational Potential and Clinical Relevance. Cell Transplant. 2018, 27, 93–116. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mauro, A.; Russo, V.; Di Marcantonio, L.; Berardinelli, P.; Martelli, A.; Muttini, A.; Mattioli, M.; Barboni, B. M1 and M2 macrophage recruitment during tendon regeneration induced by amniotic epithelial cell allotransplantation in ovine. Res. Vet. Sci. 2016, 105, 92–102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Canciello, A.; Russo, V.; Berardinelli, P.; Bernabò, N.; Muttini, A.; Mattioli, M.; Barboni, B. Progesterone prevents epithelial-mesenchymal transition of ovine amniotic epithelial cells and enhances their immunomodulatory properties. Sci. Rep. 2017, 7, 3761. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ho, J.O.; Sawadkar, P.; Mudera, V. A review on the use of cell therapy in the treatment of tendon disease and injuries. J. Tissue Eng. 2014, 5, 1–18. [Google Scholar] [CrossRef] [Scilit]
- Russo, V.; Tammaro, L.; Di Marcantonio, L.; Sorrentino, A.; Ancora, M.; Valbonetti, L.; Turriani, M.; Martelli, A.; Cammà, C.; Barboni, B. Amniotic epithelial stem cell biocompatibility for electrospun poly(lactide-co-glycolide), poly(ε-caprolactone), poly(lactic acid) scaffolds. Mater. Sci. Eng. C 2016, 69, 321–329. [Google Scholar] [CrossRef] [Scilit]
- Zhao, W.; Li, J.; Jin, K.; Liu, W.; Qiu, X.; Li, C. Fabrication of functional PLGA-based electrospun scaffolds and their applications in biomedical engineering. Mater. Sci. Eng. C 2016, 59, 1181–1194. [Google Scholar] [CrossRef] [Scilit]
- Manning, C.N.; Schwartz, A.G.; Liu, W.; Xie, J.; Havlioglu, N.; Sakiyama-Elbert, S.E.; Silva, M.J.; Xia, Y.; Gelberman, R.H.; Thomopoulos, S. Controlled delivery of mesenchymal stem cells and growth factors using a nanofiber scaffold for tendon repair. Acta Biomater. 2013, 9, 6905–6914. [Google Scholar] [CrossRef] [Scilit]
- Aviss, K.J.; Gough, J.E.; Downes, S. Aligned electrospun polymer fibres for skeletal muscle regeneration. Eur. Cell. Mater. 2010, 19, 193–204. [Google Scholar] [CrossRef] [Scilit]
- Stoll, C.; John, T.; Endres, M.; Rosen, C.; Kaps, C.; Kohl, B.; Sittinger, M.; Ertel, W.; Schulze-Tanzil, G. Extracellular matrix expression of human tenocytes in three-dimensional air-liquid and PLGA cultures compared with tendon tissue: Implications for tendon tissue engineering. J. Orthop. Res. 2010, 28, 1170–1177. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sahoo, S.; Toh, S.L.; Goh, J.C.H. A bFGF-releasing silk/PLGA-based biohybrid scaffold for ligament/tendon tissue engineering using mesenchymal progenitor cells. Biomaterials 2010, 31, 2990–2998. [Google Scholar] [CrossRef] [Scilit]
- Sahoo, S.; Ouyang, H.; Goh, J.C.-H.; Tay, T.E.; Toh, S.L. Characterization of a Novel Polymeric Scaffold for Potential Application in Tendon/Ligament Tissue Engineering. Tissue Eng. 2006, 12, 91–99. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chuen, F.S.; Chuk, C.Y.; Ping, W.Y.; Nar, W.W.; Kim, H.L.; Ming, C.K. Immunohistochemical characterization of cells in adult human patellar tendons. J. Histochem. Cytochem. 2004, 52, 1151–1157. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Martins, A.; Araújo, J.V.; Reis, R.L.; Neves, N.M. Electrospun nanostructured scaffolds for tissue engineering applications. Nanomedicine 2007, 2, 929–942. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yin, Z.; Chen, X.; Chen, J.L.; Shen, W.L.; Hieu Nguyen, T.M.; Gao, L.; Ouyang, H.W. The regulation of tendon stem cell differentiation by the alignment of nanofibers. Biomaterials 2010, 31, 2163–2175. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kishore, V.; Bullock, W.; Sun, X.; Van Dyke, W.S.; Akkus, O. Tenogenic differentiation of human MSCs induced by the topography of electrochemically aligned collagen threads. Biomaterials 2012, 33, 2137–2144. [Google Scholar] [CrossRef] [Scilit]
- Wang, Z.; Lee, W.J.; Koh, B.T.H.; Hong, M.; Wang, W.; Lim, P.N.; Feng, J.; Park, L.S.; Kim, M.; Thian, E.S. Functional regeneration of tendons using scaffolds with physical anisotropy engineered via microarchitectural manipulation. Sci. Adv. 2018, 4, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Wu, S.; Peng, H.; Li, X.; Streubel, P.N.; Liu, Y.; Duan, B. Effect of scaffold morphology and cell co-culture on tenogenic differentiation of HADMSC on centrifugal melt electrospun poly (L-lactic acid) fibrous meshes. Biofabrication 2017, 9, 044106–044118. [Google Scholar] [CrossRef] [Scilit]
- Zhang, C.; Yuan, H.; Liu, H.; Chen, X.; Lu, P.; Zhu, T.; Yang, L.; Yin, Z.; Heng, B.C.; Zhang, Y.; et al. Well-aligned chitosan-based ultrafine fibers committed teno-lineage differentiation of human induced pluripotent stem cells for Achilles tendon regeneration. Biomaterials 2015, 53, 716–730. [Google Scholar] [CrossRef] [Scilit]
- Cai, J.; Wang, J.; Ye, K.; Li, D.; Ai, C.; Sheng, D.; Jin, W.; Liu, X.; Zhi, Y.; Jiang, J.; et al. Dual-layer aligned-random nanofibrous scaffolds for improving gradient microstructure of tendon-to-bone healing in a rabbit extra-articular model. Int. J. Nanomed. 2018, 13, 3481–3492. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sheng, D.; Li, J.; Ai, C.; Feng, S.; Ying, T.; Liu, X.; Cai, J.; Ding, X.; Jin, W.; Xu, H.; et al. Electrospun PCL/Gel-aligned scaffolds enhance the biomechanical strength in tendon repair. J. Mater. Chem. B 2019, 7, 4801–4810. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, W.; He, J.; Feng, B.; Zhang, Z.; Zhang, W.; Zhou, G.; Cao, Y.; Fu, W.; Liu, W. Aligned nanofibers direct human dermal fibroblasts to tenogenic phenotype in vitro and enhance tendon regeneration in vivo. Nanomedicine 2016, 11, 1055–1072. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Subramony, S.D.; Dargis, B.R.; Castillo, M.; Azeloglu, E.U.; Tracey, M.S.; Su, A.; Lu, H.H. The Guidance of Stem Cell Differentiation by Substrate Alignment and Mechanical Stimulation. Biomaterials 2013, 34, 1942–1953. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xie, J.; Li, X.; Lipner, J.; Manning, C.N.; Schwartz, A.G.; Thomopoulos, S.; Xia, Y. “Aligned-to-random” nanofiber scaffolds for mimicking the structure of the tendon-to-bone insertion site. Nanoscale 2010, 2, 923–926. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sahoo, S.; Lok Toh, S.; Hong Goh, J.C. PLGA nanofiber-coated silk microfibrous scaffold for connective tissue engineering. J. Biomed. Mater. Res. B Appl. Biomater. 2010, 95, 19–28. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ayyoob, M.; Kim, Y.J. Effect of chemical composition variant and oxygen plasma treatments on thewettability of PLGA thin films, synthesized by direct copolycondensation. Polymers 2018, 10, 1132. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Landes, C.A.; Ballon, A.; Roth, C. In-patient versus in vitro degradation of P(L/DL)LA and PLGA. J. Biomed. Mater. Res. B Appl. Biomater. 2006, 76, 403–411. [Google Scholar] [CrossRef] [Scilit]
- Lu, L.; Peter, S.J.; Lyman, M.D.; Lai, H.L.; Leite, S.M.; Tamada, J.A.; Uyama, S.; Vacanti, J.P.; Langer, R.; Mikos, A.G. In vitro and in vivo degradation of porous poly(DL-lactic-co-glycolic acid) foams. Biomaterials 2000, 21, 1837–1845. [Google Scholar] [CrossRef] [Scilit]
- Nair, L.S.; Laurencin, C.T. Biodegradable polymers as biomaterials. Prog. Polym. Sci. 2007, 32, 762–798. [Google Scholar] [CrossRef] [Scilit]
- Russo, V.; Tammaro, L.; Di Marcantonio, L.; Sorrentino, A.; Ancora, M.; Valbonetti, L.; Mauro, A.; Martelli, A.; Cammà, C.; Barboni, B. Positive interaction between the amniotic epithelial stem cells and electrospun poly (lactide- coglycolide), poly (ε -caprolactone), poly (lactic acid). Eur. Cells Mater. 2016, 31, 354. [Google Scholar]
- Beldjilali-Labro, M.; Garcia Garcia, A.; Farhat, F.; Bedoui, F.; Grosset, J.-F.; Dufresne, M.; Legallais, C. Biomaterials in Tendon and Skeletal Muscle Tissue Engineering: Current Trends and Challenges. Materials 2018, 11, 1116. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bashur, C.A.; Shaffer, R.D.; Dahlgren, L.A.; Guelcher, S.A.; Goldstein, A.S. Effect of fiber diameter and alignment of electrospun polyurethane meshes on mesenchymal progenitor cells. Tissue Eng. Part A 2009, 15, 2435–2445. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mabe, I.; Hunter, S. Quadriceps tendon allografts as an alternative to Achilles tendon allografts: A biomechanical comparison. Cell Tissue Bank. 2014, 15, 523–529. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Couppé, C.; Suetta, C.; Kongsgaard, M.; Justesen, L.; Hvid, L.G.; Aagaard, P.; Kjær, M.; Magnusson, S.P. The effects of immobilization on the mechanical properties of the patellar tendon in younger and older men. Clin. Biomech. 2012, 27, 949–954. [Google Scholar] [CrossRef] [Scilit]
- Shang, S.; Yang, F.; Cheng, X.; Frank Walboomers, X.; Jansen, J.A. The effect of electrospun fibre alignment on the behaviour of rat periodontal ligament cells. Eur. Cells Mater. 2010, 19, 180–192. [Google Scholar] [CrossRef] [Scilit]
- Lee, N.M.; Erisken, C.; Iskratsch, T.; Sheetz, M.; Levine, W.N.; Lu, H.H. Polymer fiber-based models of connective tissue repair and healing. Biomaterials 2017, 112, 303–312. [Google Scholar] [CrossRef] [Scilit]
- Gugutkov, D.; Gustavsson, J.; Ginebra, M.P.; Altankov, G. Fibrinogen nanofibers for guiding endothelial cell behavior. Biomater. Sci. 2013, 1, 1065–1073. [Google Scholar] [CrossRef] [Scilit]
- Wanjare, M.; Hou, L.; Nakayama, K.H.; Kim, J.J.; Mezak, N.P.; Abilez, O.J.; Tzatzalos, E.; Wu, J.C.; Huang, N.F. Anisotropic microfibrous scaffolds enhance the organization and function of cardiomyocytes derived from induced pluripotent stem cells. Biomater. Sci. 2017, 5, 1567–1578. [Google Scholar] [CrossRef] [Scilit]
- Guo, F.; Parker Kerrigan, B.C.; Yang, D.; Hu, L.; Shmulevich, I.; Sood, A.K.; Xue, F.; Zhang, W. Post-transcriptional regulatory network of epithelial-to-mesenchymal and mesenchymal-to-epithelial transitions. J. Hematol. Oncol. 2014, 7, 19. [Google Scholar] [CrossRef] [Scilit]
- Barboni, B.; Russo, V.; Curini, V.; Martelli, A.; Berardinelli, P.; Mauro, A.; Mattioli, M.; Marchisio, M.; Bonassi Signoroni, P.; Parolini, O.; et al. Gestational stage affects amniotic epithelial cells phenotype, methylation status, immunomodulatory and stemness properties. Stem Cell Rev. Rep. 2014, 10, 725–741. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lange-Consiglio, A.; Accogli, G.; Cremonesi, F.; Desantis, S. Cell Surface Glycan Changes in the Spontaneous Epithelial-Mesenchymal Transition of Equine Amniotic Multipotent Progenitor Cells. Cells Tissues Organs 2014, 200, 212–226. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tan, E.-J.; Olsson, A.-K.; Moustakas, A. Reprogramming during epithelial to mesenchymal transition under the control of TGFβ. Cell Adh. Migr. 2015, 9, 233–246. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Medici, D.; Hay, E.D.; Olsen, B.R. Snail and Slug Promote Epithelial-Mesenchymal Transition through β-Catenin–T-Cell Factor-4-dependent Expression of Transforming Growth Factor-β3. Mol. Biol. Cell 2008, 19, 4875–4887. [Google Scholar] [CrossRef] [Scilit]
- Janda, E.; Lehmann, K.; Killisch, I.; Jechlinger, M.; Herzig, M.; Downward, J.; Beug, H.; Grünert, S. Ras and TGFβ cooperatively regulate epithelial cell plasticity and metastasis. J. Cell Biol. 2002, 156, 299–314. [Google Scholar] [CrossRef] [Scilit]
- Franchi, M.; Masola, V.; Bellin, G.; Onisto, M.; Karamanos, K.-A.; Piperigkou, Z. Collagen Fiber Array of Peritumoral Stroma Influences Epithelial-to-Mesenchymal Transition and Invasive Potential of Mammary Cancer Cells. J. Clin. Med. 2019, 8, 213. [Google Scholar] [CrossRef] [Scilit]
- Gumucio, J.P.; Sugg, K.B.; Mendias, C.L. TGF-β superfamily signaling in muscle and tendon adaptation to resistance exercise. Exerc. Sport Sci. Rev. 2015, 43, 93–99. [Google Scholar] [CrossRef] [Scilit]
- Sugg, K.B.; Lubardic, J.; Gumucio, J.P.; Mendias, C.L. Changes in macrophage phenotype and induction of epithelial-to-mesenchymal transition genes following acute Achilles tenotomy and repair. J. Orthop. Res. 2014, 32, 944–951. [Google Scholar] [CrossRef] [Scilit]
- Barboni, B.; Russo, V.; Gatta, V.; Bernabò, N.; Berardinelli, P.; Mauro, A.; Martelli, A.; Valbonetti, L.; Muttini, A.; Di Giacinto, O.; et al. Therapeutic potential of hAECs for early Achilles tendon defect repair through regeneration. J. Tissue Eng. Regen. Med. 2018, 12, e1594–e1608. [Google Scholar] [CrossRef] [Scilit]
- Russo, V.; Mauro, A.; Martelli, A.; Di Giacinto, O.; Di Marcantonio, L.; Nardinocchi, D.; Berardinelli, P.; Barboni, B. Cellular and molecular maturation in fetal and adult ovine calcaneal tendons. J. Anat. 2015, 226, 126–142. [Google Scholar] [CrossRef] [Scilit]
- Battiston, K.G.; Cheung, J.W.C.; Jain, D.; Santerre, J.P. Biomaterials in co-culture systems: Towards optimizing tissue integration and cell signaling within scaffolds. Biomaterials 2014, 35, 4465–4476. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Muttini, A.; Valbonetti, L.; Abate, M.; Colosimo, A.; Curini, V.; Mauro, A.; Berardinelli, P.; Russo, V.; Cocciolone, D.; Marchisio, M.; et al. Ovine amniotic epithelial cells: In vitro characterization and transplantation into equine superficial digital flexor tendon spontaneous defects. Res. Vet. Sci. 2013, 94, 158–169. [Google Scholar] [CrossRef] [Scilit] [PubMed]








| Primary Antibody | Dilution | Supplier | Secondary Antibody | Dilution | Supplier |
|---|---|---|---|---|---|
| Ki-67 | 1:50 | Dako Cytomation, Glostrup, Denmark | Anti-Mouse Alexa Fluor 488 | 1:100 | Invitrogen, Paisley, UK |
| Phalloidin–FITC | 1:40 | Sigma-Aldrich, St. Louis, MO, USA | |||
| Cytokeratin-8 | 1:200 | Abcam, Cambridge, UK | Anti-Mouse CY3 | 1:500 | Sigma-Aldrich, St. Louis, MO, USA |
| α-SMA | 1:500 | Abcam, Cambridge, UK | Anti-Mouse FITC | 1:100 | Sigma-Aldrich, St. Louis, MO, USA |
| COL1 | 1:100 | EMD Millipore Corporation, Temecula, USA | Anti-Mouse CY3 | 1:500 | Sigma-Aldrich, St. Louis, MO, USA |
| Gene | Forward Primer (5′ to 3′) | Reverse Primer (5′ to 3′) |
|---|---|---|
| Vimentin | GACCAGCTCACCAACGACA | CTCCTCCTGCAACTTCTCCC |
| Snail 1 | GTCGTGGGTGGAGAGCTTTG | TGCTGGAAAGTGAGCTCTGG |
| GAPDH | CCTGCACCACCAACTGCTTG | TTGAGCTCAGGGATGACCTTG |
| COL1 | AGAAGAAGACATCCCACCAGTCA | GGCAGGGCACGGGTTT |
| Probe | AGAACGGCCTCAGGTACCATGACCG | |
| TNMD | AGCACTTCTGGCCTGAGACAC | CAGTGCCATTTCCACTTCTGAAT |
| Probe | AGATTTACATGGAAATTGATCCCATTACCAGAACTG | |
| GAPDH | GGCGTGAACCACGAGAAGTATAA | CCCTCCACGATGCCAAAGT |
| Probe | ATACCCTCAAGATTGTCAGCAATGCCTCCT |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Russo, V.; El Khatib, M.; di Marcantonio, L.; Ancora, M.; Wyrwa, R.; Mauro, A.; Walter, T.; Weisser, J.; Citeroni, M.R.; Lazzaro, F.; et al. Tendon Biomimetic Electrospun PLGA Fleeces Induce an Early Epithelial-Mesenchymal Transition and Tenogenic Differentiation on Amniotic Epithelial Stem Cells. Cells 2020, 9, 303. https://doi.org/10.3390/cells9020303
Russo V, El Khatib M, di Marcantonio L, Ancora M, Wyrwa R, Mauro A, Walter T, Weisser J, Citeroni MR, Lazzaro F, et al. Tendon Biomimetic Electrospun PLGA Fleeces Induce an Early Epithelial-Mesenchymal Transition and Tenogenic Differentiation on Amniotic Epithelial Stem Cells. Cells. 2020; 9(2):303. https://doi.org/10.3390/cells9020303
Chicago/Turabian StyleRusso, Valentina, Mohammad El Khatib, Lisa di Marcantonio, Massimo Ancora, Ralf Wyrwa, Annunziata Mauro, Torsten Walter, Jürgen Weisser, Maria Rita Citeroni, Francesco Lazzaro, and et al. 2020. "Tendon Biomimetic Electrospun PLGA Fleeces Induce an Early Epithelial-Mesenchymal Transition and Tenogenic Differentiation on Amniotic Epithelial Stem Cells" Cells 9, no. 2: 303. https://doi.org/10.3390/cells9020303
APA StyleRusso, V., El Khatib, M., di Marcantonio, L., Ancora, M., Wyrwa, R., Mauro, A., Walter, T., Weisser, J., Citeroni, M. R., Lazzaro, F., Di Federico, M., Berardinelli, P., Cammà, C., Schnabelrauch, M., & Barboni, B. (2020). Tendon Biomimetic Electrospun PLGA Fleeces Induce an Early Epithelial-Mesenchymal Transition and Tenogenic Differentiation on Amniotic Epithelial Stem Cells. Cells, 9(2), 303. https://doi.org/10.3390/cells9020303

