Next Article in Journal
Understanding Calcium-Dependent Conformational Changes in S100A1 Protein: A Combination of Molecular Dynamics and Gene Expression Study in Skeletal Muscle
Next Article in Special Issue
Impact of Melatonin on Skeletal Muscle and Exercise
Previous Article in Journal
Insights into Activation Mechanisms of Store-Operated TRPC1 Channels in Vascular Smooth Muscle
Previous Article in Special Issue
Molecular and Cellular Mechanisms of Melatonin in Osteosarcoma
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Study of Melatonin as Preventive Agent of Gastrointestinal Damage Induced by Sodium Diclofenac

by
Aroha B. Sánchez
1,
Beatriz Clares
2,*,
María J. Rodríguez-Lagunas
3,
María J. Fábrega
3 and
Ana C. Calpena
1
1
Department of Pharmacy and Pharmaceutical Technology, Faculty of Pharmacy and Food Sciences, University of Barcelona, 08028 Barcelona, Spain
2
Department of Pharmacy and Pharmaceutical Technology, Faculty of Pharmacy, University of Granada, 18071 Granada, Spain
3
Department of Biochemistry and Physiology, Faculty of Pharmacy and Food Sciences, University of Barcelona, 08028 Barcelona, Spain
*
Author to whom correspondence should be addressed.
Cells 2020, 9(1), 180; https://doi.org/10.3390/cells9010180
Submission received: 30 November 2019 / Revised: 4 January 2020 / Accepted: 8 January 2020 / Published: 10 January 2020
(This article belongs to the Special Issue Melatonin in Human Health and Diseases)

Abstract

Safety profile of nonsteroidal anti-inflammatory drugs (NSAIDs) has been widely studied and both therapeutic and side effects at the gastric and cardiovascular level have been generally associated with the inhibitory effect of isoform 1 (COX-1) and 2 (COX-2) cyclooxygenase enzymes. Now there are evidences of the involvement of multiple cellular pathways in the NSAIDs-mediated-gastrointestinal (GI) damage related to enterocyte redox state. In a previous review we summarized the key role of melatonin (MLT), as an antioxidant, in the inhibition of inflammation pathways mediated by oxidative stress in several diseases, which makes us wonder if MLT could minimize GI NSAIDs side effects. So, the aim of this work is to study the effect of MLT as preventive agent of GI injury caused by NSAIDs. With this objective sodium diclofenac (SD) was administered alone and together with MLT in two experimental models, ex vivo studies in pig intestine, using Franz cells, and in vivo studies in mice where stomach and intestine were studied. The histological evaluation of pig intestine samples showed that SD induced the villi alteration, which was prevented by MLT. In vivo experiments showed that SD altered the mice stomach mucosa and induced tissue damage that was prevented by MLT. The evaluation by quantitative reverse transcription PCR (RT-qPCR) of two biochemical markers, COX-2 and iNOS, showed an increase of both molecules in less injured tissues, suggesting that MLT promotes tissue healing by improving redox state and by increasing iNOS/NO that under non-oxidative condition is responsible for the maintenance of GI-epithelium integrity, increasing blood flow and promoting angiogenesis and that in presence of MLT, COX-2 may be responsible for wound healing in enterocyte. Therefore, we found that MLT may be a preventive agent of GI damages induced by NSAIDs.

Graphical Abstract

1. Introduction

Nonsteroidal anti-inflammatory drugs (NSAIDs) world sales of last year confirm that they still are one of the most consumed drugs (Figure 1). The safety profile of NSAIDs has been widely studied. Therapeutic and side effects at the gastric and cardiovascular level have been popularly associated with the inhibitory effect on endoperoxide-H synthase1 and -2 (PGHSs) also known as cyclooxygenase enzymes (COX).
Two isoforms of COX have been characterized, the constitutive COX (COX-1), which is expressed in most mammalian tissues, and the inducible COX (COX-2) [1]. Both catalyze the oxidation of arachidonic acid (AA) to prostaglandin G2 (PGG2), which leads to prostaglandin H2 (PGH2) by the action of peroxidase, then the tissue-specific prostaglandin synthases lead to all the different prostaglandins, prostaglandin D2 (PGD2), prostaglandin F2α (PGF), prostaglandin E2 (PGE2), prostaciclin (PGI2), and thromboxane A2 (TXA2) [2] (Figure 2).
Classical outcomes associated COX-2 expression, with proinflammatory and pain events [3,4], Xie et al. were the first to demonstrate that COX-2 gene expression is induced in inflammation conditions in 1991 [5], while COX-1 was described as protector of gastric mucosa since several authors had described that prostaglandins PGE2 had cytoprotective [6], antiulcer effects [7,8], and PGE2 synthesis was found to be more related to COX-1 than to COX-2 [9]. PGI2 was also described as a potent inhibitor of in vivo gastric acid secretion and enhancer of mucosal blood flow when infused intravenously [10].
It was widely accepted that the main cause of non-selective NSAIDs gastrointestinal (GI) damage, was the inhibition of COX-1 pathways, which triggered the research for selective inhibitors of COX-2 (COXIBS) [11]. Selective inhibitors of COX-2 seemed to have a safer GI profile than classical NSAIDs but over the time it was shown an increased risk of cardiovascular side effects, decreasing the benefit-risk balance of these drugs [12,13]. Among other reasons, the key-role of COX-2 in the synthesis of PGI2 is explained by the fact that it is an important vascular-protector with vasodilator, antithrombotic, antiaggregant, and anti-inflammatory properties [14]. In the mid-90s Langenbach et al. reported that inhibition of COX-1 does not cause spontaneous gastric damage [15,16], and some years later, new findings associated COX-2 gene expression to wound healing in enterocytes via p38 mitogen-activated protein kinases (p38 MAPK) [17] evidencing that the concept of assigning homeostatic and pathological functions to COX-1 and COX-2 respectively was a plain approach.
Currently, there are evidences of the involvement of multiple cellular pathways in NSAIDs-mediated-GI damage. The specific sequence is unknown but could be initiated by the alteration of the protective gastric mucus layer [18] as result of the interaction of NSAIDs with phospholipids (PL) as phosphatidylcholine (PC) [19,20] the main component of gastric mucus layer and mucosa [21]. Studies proved that NSAIDs have a strong affinity to form ionic and hydrophobic, non-covalent and reversible associations with zwitterionic PL (specifically PC) [20]. The direct interaction between NSAIDs and PL together with the decreased mucus secretion by inhibition of PGE2, also mediated by the anti-inflammatory drugs [22], may lead changes in the fluidity, permeability, and biomechanical properties of cellular membrane of the gastric epithelium. The invasion of the intestinal mucosa by the enterobacteria would be responsible for the immune response, including adherence and infiltrate of leucocyte (neutrophils), when lipopolysaccharide (LPS) and other endotoxins are recognized by Toll-like receptor 4 (TLR-4), which via myeloid differentiation primary response 88 (MyD88) protein [23] results in the activation of nuclear factor Κβ (NFΚβ) target genes that are then responsible for inducible form of nitric oxide synthetase (iNOs) and COX-2 expression [24,25]. Neutrophils trigger the emergence of superoxide radicals (O2.−) that react with nitric oxide (NO) leading in peroxynitrites (ONOO), high reactive molecules responsible for protein oxidation, lipid peroxidation and enzymes inactivation [26], main origin of apoptosis and necrosis of gastric epithelium.
A parallel mechanism, also responsible for production of reactive oxygen species (ROS) and leucocyte infiltration that feeds the cycle of ONOO exacerbating the injuries, is a consequence of the inhibition of Glucose-6-phosphate dehydrogenase (G6 PDH) by NSAIDs, this increases the entry of pyruvate into the mitochondria, which finally, owing also to the inhibition of acyl -CoA carboxylase (ACC) by NSAIDs, leads to the uncoupling of mitochondrial oxidative phosphorylation [27]. The uncoupling of oxidative phosphorylation, which finally results in depleted adenosine triphosphate (ATP) levels [28,29], depends on the Pka (the negative base −10 logarithm of the acid dissociation constant (Ka)) of the NSAID, the lower the pKa value, the minimum concentration is required to uncouple oxidative phosphorylation [30], it also explains why the stronger the acid the higher the injuries.
The role of iNOs/NO depends on the epithelium redox state, under non-oxidative condition NO is an endogenous molecule responsible for the maintenance of GI-epithelium integrity, increasing blood flow and promoting angiogenesis via vascular endothelial growth factor (VEGF) pathways [31,32,33], but in the presence of O2.−, as explained before NO contributes to ONOO production. NO has been proved as protective molecule against NSAIDs-induced gastric ulceration by a mechanism independent of gastric acid secretion [34] but it is known that it also plays a role as an inhibitor in the regulation of gastric acid secretion [35].
Different studies showed a direct relation between acid and GI injuries induced by NSAIDs, in fact the main prescribed drugs to prevent such injuries are the proton-pump inhibitors (PPI) [36,37], Fornai suggests that beneficial effects of PPIs on mucosal injury are likely to be independent from the COX-2/PGE2/VEGF pathway [38] so considering all the involved cellular pathways it can be deduced that the intact mucus layer protects epithelium from the action of acid pepsin, protons, [H+] and, in addition, when the barrier is damaged, acid aggravates gastric injuries. There are also evidences of an increased basal gastric acid concentration mediated by NSAIDs due to the basal gastric fluid volume reduction [39].
Regardless of selective COX-2 inhibitors (COXIBS) manifested less GI damage [40], it is known that COX-2 has an essential role in enterocyte wound healing, through a mechanism related with NFΚβ via and p38MAPK-dependent histone 3 phosphorylation, which is an important component of the intestinal wound-healing response [17], additionally PGE2 participates in the differentiation of human goblet intestinal epithelial cells during homeostatic conditions [41] and PGI2 in angiogenesis [10]. Bile salts seems also be related with intestinal damage cause by NSAIDs by forming super-toxic micelles [42,43], injuries that could be avoided by PC [44] evidencing the role of mucus barrier as protective factor of GI mucosa from lesions generated by NSAIDs.
Although, GI safety profile depends on the dose and kind of NSAID and a benefit-risk assessment strategy to select an anti-inflammatory drug has been described [45], GI events related to chronic NSAID consumption must be considered.
The use of PPI is highly accepted, different studies concluded that the efficacy and safety levels are acceptable [46] but a new trend, focused on the relationship between intestinal microbiota and several diseases, shows up that a pH change in the GI tract, would be related to a change in the microbiota [47], hence chronic use of proton-pump inhibitors could be related to small intestinal bacterial overgrowth (SIBO) [48], Candida albicans infections [49], and vitamin B12 deficiency in some population groups such as the elderly [50].
The above together with the new findings about involved pathways pH-independent in GI injury caused by NSAIDs, lead us to think about different strategies than PPI to prevent GI damage cause by NSAIDs.
In a previous review [51] we summarized how melatonin (MLT), as an antioxidant molecule, inhibits inflammation processes associated to different illnesses. The link between enterocyte redox state and NSAIDs GI pathology encouraged us to study if MLT administration would affect in some way. To evaluate the role of MLT in GI injury prevention induced by NSAIDs, SD was selected as GI damage model because this NSAID has a pKa of 4.15 [52] and as explained before, there is a highly significant inverse correlation between pKa and concentration required for maximum stimulation of mitochondrial oxidative stress. The higher the pKa value, the lower concentration required for maximum uncoupling of mitochondrial oxidative phosphorylation [31]. When comparing with other NSAIDs, such as acetylsalicylic acid (ASA) whose pKa is 3.5, an almost four times higher concentration of ASA is necessary to produce the same effect as SD. Furthermore, other authors studied the role of MLT to recover intestinal permeability after a SD treatment [53], so SD is a proper model of GI injury.
The main objective of this work is to study and to evaluate the effect of MLT as preventive agent of GI injury caused by SD in two different models, ex vivo and in vivo.

2. Materials and Methods

2.1. Chemical and Reagents

MLT, SD, phosphoric acid (H3PO4), disodium hydrogen phosphate (Na2HPO4), formaldehyde, and paraffin wax were purchased from Sigma-Aldrich (Madrid, Spain). Potassium dihydrogen phosphate (KH2PO4), potassium hydroxide (KOH), methanol (MeOH), and phosphoric acid (H3PO4) were purchased from Panreac Quimica (Barcelona, Spain). Hanks’ Balanced Salt solution (HBSS), hematoxylin and eosin were purchased from Merck S.L. (Barcelona, Spain). Double-distilled water was obtained from a Milli-Q® Gradient A10 system apparatus (Millipore Iberica S.A.U., Madrid, Spain). TRIZol reagent and RevertAid First Strand cDNA synthesis kit were purchased from Thermo Fisher Scientific (Barcelona, Spain).

2.2. Ex Vivo NSAID/ML Administration in Pig Intestine

As the previous stage of in vivo studies, we set and validated an ex vivo model [54], which allows the study of the local effect of SD and MLT in the small intestinal mucosa; at the same time, the model allows the evaluation of the intestinal apparent permeability coefficient (Papp) for SD. Papp of SD alone and in combination with MLT were compared to evaluate the influence of MLT in the intestinal absorption of SD.
Ex vivo experiments were performed as described a previous paper [54] in the duodenum, the most proximal portion of the small intestine, of young female pigs (Sus scrofa). Animals were sacrificed for other purposes in the Animal Facility at Bellvitge Campus (University of Barcelona, Barcelona, Spain) and intestinal samples were obtained according to the 3R (reduction, refinement and replacement) principle.
Duodenum was excised, after that cleaned and preserved in HBBS at 5 ± 3 °C for 12 h. Then 6 cm × 6 cm pieces were cut, mounted on Franz cells (Vidrafoc, Barcelona, Spain). To avoid damages in the biological intestinal membrane, 0.02 M phosphate-buffered saline (PBS) pH 7.4 was prepared as receiving media. Composition was 0.6 g of KH2PO4 and 3.17 g of Na2HPO4 per liter of double-distilled water. pH was adjusted to 7.4 with H3PO4 or NaOH. Homogeneity and simulation of intestinal conditions during experiments were ensured by a small Teflon® coated magnetic stir bar at 700 revolutions per minute of rotor (rpm) corresponding to a relative centrifugal force (rcf) or G-force of 2. The diffusion cells were previously incubated in a water bath to equalize the temperature in all cells (37 ± 1 °C).
Of SD 1 mg/mL in PBS pH 7.4, alone or in combination with 0.5 mg/mL of MLT in PBS pH 7.4, were applied into the donor chamber and sealed by parafilm immediately to prevent water evaporation. After six hours of simulated permeation duodenum samples were prepared, according Section 2.4 and Section 2.5, to perform histological analysis and COX-2/iNOS determination. Different experimental group are summarized in Table 1.

2.2.1. HPLC-UV Procedure and Instrumentation

The HPLC equipment consisted of a Waters® Alliance 2695 Separation Module (Waters Co., Milford, MA, USA) with a 2996 Photodiode Array Detector (DAD) at a wavelength range of 190–800 nm and sensitivity settings from 0.0001 to 2.0000 absorbance units. HPLC parameters are listed below.
SD analysis was conducted with a reverse-phase column ultrabase Nova-Pak C18, 60 Å, (150 mm × 3.9 mm; diameter of 4 µm (Waters, Barcelona, Spain) with a UV detector set up at 276 nm. The mobile phase, previously filtered by a 0.45 μm nylon membrane filter (Technokroma, Barcelona, Spain) and degassed by sonication, consisted of a 68:32 ratio of MeOH and H3PO4 (pH of 3.2) under isocratic elution at a flow rate of 0.8 mL/min. The injection volume was 50 μL.

2.2.2. Validation and Verification of Analytical Methods

Previously validated HPLC-UV method was selected for the analysis of SD. Considering that the samples were obtained from biological sources, the specificity was studied. Specificity, expressed by the ICH guidelines as the ability to assess an analyte in the presence of components, which may be expected to be present, was evaluated by the absence of interference of the phosphate-buffered saline (PBS; pH 7.4) and other components from biological membranes used as a blank at the retention times shown by the different standard solutions.

2.2.3. Sample Analysis

The cumulative amount of SD, alone or in combination with MLT, through the small intestine membrane from the acceptor compartment was monitored by a validated HPLC-UV methodology. Results are reported as mean ± SD of six experiments (n = 6).

2.2.4. Data Treatment and Statistical Analysis

The permeability model has the same structure as the two-compartment classic model, composed of donor (apical) and receptor (basal) chambers, both separated by the permeation membrane. So, apical-to-basal Papp was calculated based on classic parameters according to Equation (1):
Papp = (dQ/dt)/(C0 × A),
where (dQ/dt) is the transport rate or flux (J) (µg/min) across the biological membrane, C0 (µg/mL) is the initial concentration of the drug in the donor chamber, and A is the surface area (cm2) of the permeation membrane.
The cumulative amount (Q; µg) permeated through porcine duodenum was obtained by multiplying the acquired concentration (µg/mL) of SD at the receptor chamber and the volume (mL) of the receptor chamber. J (µg/min) was calculated as the slope at the steady state obtained by linear regression analysis (GraphPad Prism® software, v. 5.01, GraphPad Software Inc., San Diego, CA, USA) of Q as a function of time (min). Then, Papp (cm/min) was calculated according to Equation (1) by dividing the J (µg/min), the permeation area (A; 2.54 cm2), and the initial drug concentration (C0; µg/mL = µg/cm3) in the donor chamber. Finally, the units were expressed in centimeters per second.
Obtained experimental data were analyzed by unpaired Student’s t-test to compare Papp values for both SD Papp alone and SD Papp in presence of MLT. A p-value < 0.05 was established as an indicator of statistically significant differences.

2.3. In Vivo Studies: Oral Administration of NSAID and MLT in Mice

In vivo studies were carried out in both, female and male, Mus musculus mice weighing 25 ± 2 g. The mice were maintained in a controlled environment at (20 ± 1) °C for 7 days with a 12-h light/dark cycle and 50% ± 5% relative humidity throughout the experimental period. All mice were allowed free access to water and chow diet.
The nasogastric administration of SD therapeutic dose was carried out once per day for 7 days alone or in combination with MLT. No drug was administered to the reference or control group. Table 2 summarizes different experimental groups:
At the end of the experiment, eighth day, mice were euthanized. The studies were conducted under a protocol approved by the Animal Experimentation Ethics Committee of the University of Barcelona (Spain) and the Committee of Animal Experimentation of the regional autonomous government of Catalonia (Spain) 491/18 approved on September 2019.
Intestine and stomach samples were prepared, according Section 2.4 and Section 2.5, to perform histological analysis, COX-2 and iNOS determination.

2.4. Histological Analysis

For histological observation of stomach and intestinal architecture, hematoxylin and eosin staining were performed. For pork intestines, following the intestinal permeation study in Franz diffusion cells the samples were fixed in 4% buffered formaldehyde at room temperature. Mice stomachs and intestine were excised immediately after sacrifice and fixed in 4% buffered formaldehyde at room temperature. After fixation, all samples were paraffin embedded onto cassettes, sectioned into 5 µm slices, mounted on microscope slides and stained with hematoxylin and eosin, and finally viewed under a microscope Olympus BX41 and camera Olympus XC50 (Olympus, Barcelona, Spain).

2.5. COX-2 and iNOS Determination

COX-2 and iNOs determination was carried out by quantitative reverse transcription PCR (RT-qPCR), with this purpose RNA isolation was firstly carried out.

2.5.1. RNA Isolation

Total RNA from the intestine pig, intestine and stomach mice tissues was isolated using TRIZol® method (Thermo Fisher Scientific, Barcelona, Spain). Small tissue fragments were homogenized using 1 mL of cold TRIZol reagent and 3 min under the PolytronTM Homogenizer PT1200E (Thermo Fisher Scientific, Barcelona, Spain). Then, instructions described by the manufacturer were followed. RNA concentration and quality were tested by NanoDropTM 2000/2000c Spectrophotometer (Thermo Fisher Scientific, Barcelona, Spain).

2.5.2. RT-qPCR

One microgram of total RNA was reverse transcribed to cDNA using the RevertAid First Strand cDNA synthesis kit. Subsequently, qPCR was performed using the Step One Plus Real Time PCR (Applied Biosystem) and primers for COX-2 (Sus scrofa: Forward 5′-GGAGAGACAGCATAAACTGC-3′ and Reverse 5′-GTGTGTTAAACTCAGCAGCA-3′; Mus musculus: Forward 5′-CCACTTCAAGGGAGTCTGGA-3′ and Reverse 5’-AGTCATCTGCTACGGGAGGA-3′) and iNOS (Sus scrofa: Forward 5′-CAACAATGGCAACATCAGG-3′ and Reverse 5′-CATCAGGCATCTGGTAGC-3′; Mus musculus: Forward 5′-GTTCTCAGCCCAACAATACAAGA-3′ and Reverse 5′-GTGGACGGGTCGATGTCAC-3′). β-actin was used as housekeeping and PCR cycling conditions included: 5 min at 94 °C for denaturalization, 30 cycles of amplification at 72 °C for 2 min, 1 min at 94 °C, 1 min at 60 °C, and a last cycle at 72 °C for 10 min for final extension. Then, Ct values of each sample were recorded, and data were analyzed by normalization to the internal control values using the formula 2-AACt. Table 3 summarizes primers sequences.

2.5.3. Data Treatment and Statistical Analysis

COX-2 and iNOS results were evaluated statistically by ANOVA followed of Dunnett’s Multiple Comparison Test using GraphPad® Prism 5.01 software; all the samples were compared with control one. p value from 0.01 to 0.05, 0.01 to 0.001, and p < 0.001 were considered statistically significant, very significant and extremely significant, respectively. Asterisks indicate statistical significance. (* p < 0.05 > 0.01; ** p < 0.01 > 0.001; and *** p < 0.001).

3. Results

3.1. Obtained Kinetics Parameters, Papp Calculation, and Statistical Analysis

Figure 3 shows SD cumulative permeated amounts in micrograms as a function of time (min) in steady state, for both, SD alone and SD permeated in presence of MLT. The kinetics parameters and Papp values of SD alone and in presence of MLT and statistical correlation between both are summarized in Table 4, which shows that no statistically significant differences (p > 0.05) were observed correlating Papp values.

3.2. Histological Results: Pig Intestine and Mice Stomach and Intestine

To investigate the possible preventive effect of MLT when administered with SD the stomach and intestine architecture were studied. The pig intestine of the permeation ex vivo studies was stained and studied under microscope. As shown in Figure 4, a section of the small intestine without treatment (Figure 4A) showed intact layers consisting of the mucosa and the submucosa. Intestine treated with MLT (Figure 4B) showed a similar pattern of the control conditions with relatively intact villi with normal adjacent structures.
However, when the intestine was treated with SD (Figure 4C), damage to the tips of the intestinal villi could be observed. Abnormal epithelial cells are indicated with arrows. On the contrary, when the intestine was treated with SD together with MLT no relevant histopathologic changes were noticed suggesting an improvement of the intestinal injury due to SD thus preventing the damage.
Regarding the in vivo studies, as shown in Figure 5, section of the mice stomach without treatment (Figure 5A) showed intact layers consisting of the mucosa and the submucosa. Samples treated with MLT (Figure 5B) showed a similar pattern of the control conditions. The results show that SD altered stomach mucosa and induced tissue damage as it can be shown by the leucocyte infiltrate (Figure 5D), which was prevented when MLT was administered (Figure 5C). For the mice intestinal architecture little alterations were observed with the anti-inflammatory drug alone (Figure 5H) or in combination with MLT (Figure 5G).

3.3. COX-2 and iNOs Levels

COX-2 and iNOs obtained levels in duodenum samples of Sus scrofa are reported in Figure 6, which shows that comparison between iNOS levels in samples corresponding to MLT and control resulted in statistically very significant differences (** p < 0.01 > 0.001) and extremely significant (*** p < 0.001) in the case of SD with MLT samples. On behalf of COX-2 extremely significant differences (*** p < 0.001) were observed for SD, MLT, and SD with MLT.
COX-2 and iNOs obtained levels for Mus musculus duodenum (intestine) and stomach are summarized in Figure 7 and Figure 8 respectively. Concerning mice intestine no differences statistically significant (p > 0.05) were observed for different samples, for both COX-2 and iNOS levels.
Observed levels for COX-2 in Mus musculus stomach samples for SD, MLT, and SD with MLT were extremely significant (*** p < 0.001) different from control. With regard to iNOS only SD with MLT samples lead to extremely significant (*** p < 0.001) differences when compared to control.

4. Discussion

Differences between gastric and intestinal damages caused by SD for an in vivo study are related to the pH of the tissue and the pKa the NSAID. As previously discussed, there is a highly significant inverse correlation between pKa and concentration required for maximum stimulation of mitochondrial oxidative stress, the lower pH of the stomach together with increased acid secretion and decreased gastric fluid volume cause by SD may lead in higher damages in mice stomach than in small intestine.
As summarized in Figure 9, the observed prevention of GI damage caused by MLT may be involved in multiple pathways.
The amphiphilic nature of MLT, which has lipophilic [55] and hydrophilic groups [56], allows it to interact with PC based membranes [57] or lipidic membranes [58], in fact MLT crosses all the biological membranes including the blood brain barrier [59] and as a result of such an interaction MLT shows a role in preserving the integrity, permeability, and functionality of cell membranes [60,61], therefore at the GI level MLT may interact with enterocyte cellular membrane decreasing the NSAIDs damage. Additionally, MLT showed a stimulant effect of mucosal bicarbonate secretion [62], so MLT may also protect the HCO3 mucus layer.
The raised levels of iNOS in samples treated with MLT together with SD are indicative of higher NO expression; NO may be intermediate of mucosal repair by increasing angiogenesis and blood flow, since MLT improves enterocyte redox state at different levels working as scavenger of ROS (O2), avoiding the interaction between NO and ROS, and ONOO production ultimately. Furthermore, increased levels of COX-2 in mice samples treated with MLT together with SD are indicative of increased levels of PGI2, which inhibits the in vivo gastric acid secretion and enhances mucosal blood flow [10] that would add to the effect of NO on the inhibition of gastric acid secretion [35].
An alternative mechanism to the scavenger action of MLT protective agent is related with the heme oxygenase 1 (HO-1), this enzyme encoded by the Hmox1 gene, is 32-kDa stress protein induced in human cells by a variety of stress treatments. [63] The induction of this enzyme is part of a protective response against oxidative damage via down-regulation of reactive oxygen species generation [64]. The translocation from endoplasmic reticulum to mitochondria of HO-1 was shown as a novel cytoprotective mechanism against NSAIDs drug-induced oxidative stress, apoptosis, and gastric mucosal injury [65] and MLT was proved to be an enhancer of HO-1 activity [66] so one of the cellular pathways involved in the protective effect of MLT against GI mucosal damage may be related with the enhancement of this protective enzyme.
Increased levels of COX-2 in samples where MLT prevented SD damages, may be related with the wound healing effect of COX-2 in enterocytes [17] and with an increased mucosal blood flow [10].
Results show the role of MLT in tissue damage prevention at intestinal level in the ex vivo model and at gastric level in the in vivo experiment. Despite of higher levels of COX-2 and iNOS in the samples treated with MLT together with SD, they showed a prevention of GI damage, as discussed, this prevention is mainly due to the antioxidant effect of MLT that improves and contributes to a favorable redox status of enterocyte; although the increasing mechanism for both enzymes is unclear, because other authors relate MLT to the inhibition of COX-2 and iNOS in different cells (murine macrophage cell line, RAW 264.7) [67]. With respect to the preventive effect, all of our results of the individuals within a group were homogenous and male and female results were considered together, however some authors found that sexual hormones could influence the healing process of preexisting ulcers [68]. Other study showed that ovarian sex hormones neither worsen nor protect against aspirin-induced gastric lesions in female rats [69].
Permeation results show that MLT would slightly increase SD Papp but according to statistical correlation, the difference is not statistically significant (p > 0.05), therefore a joint administration of both drugs may not affect SD absorption.

5. Conclusions

Our investigation contributes the study of the effect of MLT as a preventive agent of GI damage caused by SD in an ex vivo model and the study of the effect of MLT as a preventive agent of GI damage when administered jointly to SD over a period of 7 days in a mice in vivo model.
MLT showed a preventive effect of GI lesions induced by SD. Numerous pathways would outline as responsible for this effect, the direct inhibition of ROS and as consequence the inhibition of all the derived molecules that cause GI damage, the enhancement of mitochondrial protection factor HO-1 and a protective role on the phospholipids as PC of the GI membrane and mucus layer.
Future research could focus on a deeply study of MLT as an alternative to classical therapies based on PPI in the prevention of GI damage caused by NSAIDs.

Author Contributions

Conceptualization, B.C., A.C.C. and A.B.S.; methodology, B.C., A.C.C., M.J.R.-L. and M.J.F. and A.B.S.; software A.B.S. and M.J.F.; formal analysis, A.B.S., M.J.R.-L. and M.J.F.; investigation, A.B.S.; data curation, A.B.S. and A.C.C.; writing—original draft preparation, A.B.S.; writing—review and editing, B.C. and A.B.S.; supervision, B.C. and A.C.C.; project administration, B.C. and A.C.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Acknowledgments

We would like to thank Álvaro Gimeno Sandig, director of Animal House Bellvitge of University of Barcelona and Lidia Gómez Segura from the Ethical Committee of Animal Experimentation at the University of Barcelona for their contribution in the Animal Experimentation protocol design.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Kargman, S.; Charleson, S.; Cartwright, M.; Frank, J.; Riendeau, D.; Mancini, J.; O’Neill, G. Characterization of prostaglandin G/H synthase 1 and 2 in rat, dog, monkey, and human gastrointestinal tracts. Gastroenterology 1996, 111, 445–454. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Fitzpatrick, F.A. Cyclooxygenase enzymes: Regulation and function. Curr. Pharm. Des. 2004, 10, 577–588. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Simmons, D.L.; Botting, R.M.; Hla, T. Cyclooxygenase Isozymes: The Biology of Prostaglandin Synthesis and Inhibition. Pharmacol. Rev. 2004, 56, 387–437. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Singer, I.I.; Kawka, D.W.; Schloemann, S.; Tessner, T.; Riehl, T.; Stenson, W.F. Cyclooxygenase 2 is induced in colonic epithelial cells in inflammatory bowel disease. Gastroenterology 1998, 115, 297–306. [Google Scholar] [CrossRef] [Scilit]
  5. Xie, W.L.; Chipman, J.G.; Robertson, D.L.; Erikson, R.L.; Simmons, D.L. Expression of a mitogen-responsive gene encoding prostaglandin synthase is regulated by mRNA splicing. PNAS 1991, 88, 2692–2696. [Google Scholar] [CrossRef] [Scilit]
  6. Robert, A.; Nezamis, J.E.; Lancaster, C.; Hanchar, A.J. Cytoprotection by prostaglandins in rats. Prevention of gastric necrosis produced by alcohol, HCl, NaOH, hypertonic NaCl, and thermal injury. Gastroenterology 1979, 77, 433–443. [Google Scholar] [CrossRef] [Scilit]
  7. Wilson, D.E.; Phillips, C.; Levine, R.A. Inhibition of gastric secretion in man by prostaglandin A1. Gastroenterology 1971, 61, 201–206. [Google Scholar] [CrossRef] [Scilit]
  8. Main, I.H.M.; Whittle, B.J.R. The effects of E and A prostaglandins on gastric mucosal blood flow and acid secretion in the rat. Br. J. Pharmacol. 1973, 49, 428–436. [Google Scholar] [CrossRef] [Scilit]
  9. Jackson, L.M.; Wu, K.; Mahida, Y.R.; Jenkins, D.; Donnelly, M.T.; Hawkey, L.C.J. Cox-1 expression in human gastric mucosa infected with helicobacter pylori: Constitutive or induced? Gut 2000, 47, 762–770. [Google Scholar] [CrossRef] [Scilit]
  10. Whittle, B.; Boughton-Smith, N.K.; Moncada, S.; Vane, J.R. Actions of prostacyclin (PGI2) and its product 6-oxo-PGF1 on the rat gastric mucosa in vivo and vitro. Prostaglandins 1978, 15, 955–967. [Google Scholar] [CrossRef] [Scilit]
  11. Masferrer, J.L.; Isakson, P.C.; Seibert, K. Cyclooxygenase-2 inhibitors: A new class of anti-inflammatory agents that spare the gastrointestinal tract. Gastroenterol. Clin. N. Am. 1996, 25, 363–372. [Google Scholar] [CrossRef] [Scilit]
  12. Kearney, P.M.; Baigent, C.; Godwin, J. Do selective cyclo-oxygenase-2 inhibitors and traditional nonsteroidal anti-inflammatory drugs increase the risk of atherothrombosis? Meta-analysis of randomised trials. BMJ 2006, 332, 1302–1308. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. McGettigan, P.; Henry, D. Cardiovascular risk and inhibition of cyclooxygenase: A systematic review of the observational studies of selective and nonselective inhibitors of cyclooxygenase 2. JAMA 2006, 296, 1633–1644. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Majed, B.H.; Khalil, R.A. Molecular Mechanisms regulating the vascular prostacyclin pathways and their adaptation during pregnancy and in the newborn. Pharmacol. Rev. 2012, 64, 540–582. [Google Scholar] [CrossRef] [Scilit]
  15. Langenbach, R.; Morham, S.G.; Tiano, H.F.; Loftin, C.D.; Ghanayem, B.I.; Chulada, P.C.; Smithies, O. Prostaglandin synthase 1 gene disruption in mice reduces arachidonic acid-induced inflammation and indomethacin-induced gastric ulceration. Cell 1995, 83, 483–492. [Google Scholar] [CrossRef] [Scilit]
  16. Langenbach, R.; Loftin, C.; Lee, C.; Tiano, H. Cyclooxygenase knockout mice. Biochem. Pharmacol. 2002, 58, 1237–1246. [Google Scholar] [CrossRef] [Scilit]
  17. Karrasch, T.; Steinbrecher, K.A.; Allard, B.; Baldwin, A.S.; Jobin, C. Wound-induced p38MAPK-dependent histone H3 phosphorylation correlates with increased COX- 2 expression in enterocytes. J. Cell Physiol. 2006, 207, 809–815. [Google Scholar] [CrossRef] [Scilit]
  18. Kato, S.; Tanaka, A.; Kunikata, T.; Umeda, M.; Takeuchi, K. Protective effect of lafutidine against indomethacin-induced intestinal ulceration in rats: Relation to capsaicin-sensitive sensory neurons. Digestion 2000, 61, 39–46. [Google Scholar] [CrossRef] [Scilit]
  19. Lichtenberger, L.M.; Wang, Z.M.; Romero, J.J.; Ulloa, C.; Perez, J.C.; Giraud, M.N.; Barreto, J.C. Nonsteroidal anti-inflammatory drugs (NSAIDs) associate with zwitterionic phospholipids: Insight into the mechanism and reversal of NSAID-induced gastrointestinal injury. Nat. Med. 1995, 1, 154–158. [Google Scholar] [CrossRef] [Scilit]
  20. Lichtenberger, L.M.; Zhou, Y.; Jayaraman, V.; Doyen, J.R.; O’Neil, R.G.; Dial, E.J.; Volk, D.E.; Gorenstein, D.G.; Boggara, M.B.; Krishnamoorti, R. Insight into NSAID-induced membrane alterations, pathogenesis and therapeutics: Characterization of interaction of NSAIDs with phosphatidylcholine. Biochim. Biophys. Acta-Mol. Cell Biol. Lipids 2012, 1821, 994–1002. [Google Scholar] [CrossRef] [Scilit]
  21. Bernhard, W.; Postle, A.D.; Linck, M.; Sewing, K.F. Composition of phospholipid classes and phosphatidylcholine molecular species of gastric mucosa and mucus. Biochim. Biophys. Acta-Mol. Cell Biol. Lipids 1995, 1255, 99–104. [Google Scholar] [CrossRef] [Scilit]
  22. Scheiman, J.M.; Hindley, C.E. Strategies to optimize treatment with NSAIDs in patients at risk for gastrointestinal and cardiovascular adverse events. Clin. Ther. 2010, 32, 667–677. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Watanabe, T.; Higuchi, K.; Kobata, A.; Nishio, H.; Tanigawa, T.; Shiba, M.; Arakawa, T. Intestinal damage is Toll-like receptor 4 dependent. Gut 2008, 57, 181–187. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Xia, Y.; Liu, L.; Zhong, C.; Geng, J. NF-KB activation for constitutive expression of VCAM-1 and ICAM-1 on B lymphocytes and plasma cells. Biochem. Biophys. Res. Commun. 2001, 289, 851–856. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Konaka, A.; Kato, S.; Tanaka, A.; Kunikata, T.; Korolkiewicz, R.; Takeuchi, K. Roles of enterobacteria, nitric oxide and neutrophil in pathogenesis of indomethacin-induced small intestinal lesions in rats. Pharmacol. Res. 1999, 40, 517–524. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Kobayashi, O.; Miwa, H.; Watanabe, S.; Tsujii, M.; Dubois, R.N.; Sato, N.; Dubois, R.N. Cyclooxygenase-2 downregulates inducible nitric oxide synthase in rat intestinal epithelial cells. Am. J. Physiol. Gastrointest. Liver Physiol. 2001, 281, 688–696. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Asensio, C.; Levoin, N.; Guillaume, C.; Guerquin, M.J.; Rouguieg, K.; Chrétien, F.; Lapicque, F. Irreversible inhibition of glucose-6-phosphate dehydrogenase by the coenzyme A conjugate of ketoprofen: A key to oxidative stress induced by non-steroidal anti-inflammatory drugs? Biochem. Pharmacol. 2007, 73, 405–416. [Google Scholar] [CrossRef] [Scilit]
  28. Macpherson, A.; Rafi, S.; Mahmod, T.; Hayllar, J.; Jacob, M.; Scott, D.; Wrigglesworth, J.M. Mitochondrial damage: A possible mechanism of the “topical” phase of NSAID induced injury to the rat intestine. Gut 2010, 41, 344–353. [Google Scholar]
  29. Basivireddy, J.; Vasudevan, A.; Jacob, M.; Balasubramanian, K.A. Indomethacin-induced mitochondrial dysfunction and oxidative stress in villus enterocytes. Biochem. Pharmacol. 2002, 64, 339–349. [Google Scholar] [CrossRef] [Scilit]
  30. Mahmud, T.; Rafi, S.S.; Scott, D.L.; Wrigglesworth, J.M.; Bjarnason, I. Nonsteroidal antiinflammatory drugs and uncoupling of mitochondrial oxidative phosphorylation. Arthritis Rheum. 1996, 39, 1998–2003. [Google Scholar] [CrossRef] [Scilit]
  31. Maharaj, A.S.; D’Amore, P.A. Roles for VEGF in the adult. Microvasc. Res. 2007, 74, 100–113. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Aktan, F. iNOS-mediated nitric oxide production and its regulation. Life Sci. 2004, 75, 639–653. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Laszlo, F.; Whittle, B.J.R. Role of nitric oxide and platelet-activating factor in the initiation of indomethacin-provoked intestinal inflammation in rats. Eur. J. Pharmacol. 1998, 344, 191–195. [Google Scholar] [CrossRef] [Scilit]
  34. Khattab, M.M. Protective role of nitric oxide in indomethacin-induced gastric ulceration by a mechanism independent of gastric acid secretion. Pharmacol. Res. 2001, 43, 463–467. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Kato, S.; Kitamura, M.; Korolkiewicz, R.P.; Takeuchi, K. Role of nitric oxide in regulation of gastric acid secretion in rats: Effects of NO donors and NO synthase inhibitor. Br. J. Pharmacol. 1998, 839–846. [Google Scholar] [CrossRef] [Scilit]
  36. Lee, M.; Kallal, S.M.; Feldman, M. Omeprazole prevents indomethacin-induced gastric ulcers in rabbits. Aliment. Pharmacol. Ther. 1996, 10, 571–576. [Google Scholar] [CrossRef] [Scilit]
  37. Fornai, M.; Natale, G.; Colucci, R.; Tuccori, M.; Carazzina, G.; Antonioli, L.; Del Tacca, M. Mechanisms of protection by pantoprazole against NSAID-induced gastric mucosal damage. Naunyn-Schmiedeberg’s Arch. Pharmacol. 2005, 372, 79–87. [Google Scholar] [CrossRef] [Scilit]
  38. Fornai, M.; Colucci, R.; Antonioli, L.; Awwad, O.; Ugolini, C.; Tuccori, M.; Blandizzi, C. Effects of esomeprazole on healing of nonsteroidal anti-inflammatory drug (NSAID)-induced gastric ulcers in the presence of a continued NSAID treatment: Characterization of molecular mechanisms. Pharmacol. Res. 2011, 63, 59–67. [Google Scholar] [CrossRef] [Scilit]
  39. Rodriguez-Stanley, S.; Redinger, N.; Miner, P.B. Effect of naproxen on gastric acid secretion and gastric pH. Aliment. Pharmacol. Ther. 2006, 23, 1719–1724. [Google Scholar] [CrossRef] [Scilit]
  40. Pearson, S.P.; Kelberman, I. Gastrointestinal effects of NSAIDs and coxibs. Postgrad. Med. 1996, 100, 131–143. [Google Scholar] [CrossRef] [Scilit]
  41. Li, Y.; Soendergaard, C.; Bergenheim, F.H.; Aronoff, D.M.; Milne, G.; Riis, L.B.; Nielsen, O.H. COX-2–PGE 2 signaling impairs intestinal epithelial regeneration and associates with TNF inhibitor responsiveness in ulcerative colitis. EBioMedicine 2018, 36, 497–507. [Google Scholar] [CrossRef] [Scilit]
  42. Petruzzelli, M.; Vacca, M.; Moschetta, A.; Cinzia Sasso, R.; Palasciano, G.; van Erpecum, K.J.; Portincasa, P. Intestinal mucosal damage caused by non-steroidal anti-inflammatory drugs: Role of bile salts. Clin. Biochem. 2007, 40, 503–510. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Poplawski, C.; Sosnowski, D.; Szaflarska-Popławska, A.; Sarosiek, J.; McCallum, R.; Bartuzi, Z. Role of bile acids, prostaglandins and COX inhibitors in chronic esophagitis in a mouse model. World J. Gastroenterol. 2006, 12, 1739–1742. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Barrios, J.M.; Lichtenberger, L.M. Role of biliary phosphatidylcholine in bile acid protection and NSAIDs injury of the lleal mucosa in rats. Gastroenterology 2000, 118, 1179–1186. [Google Scholar] [CrossRef] [Scilit]
  45. Savarino, V.; Dulbecco, P.; Savarino, E. Are proton pump inhibitors really so dangerous? Dig. Liver Dis. 2016, 48, 851–859. [Google Scholar] [CrossRef] [Scilit]
  46. Seekatz, A.M.; Schnizlein, M.K.; Koenigsknecht, M.J.; Baker, J.R.; Bleske, B.E.; Young, V.B. Spatial and temporal analysis of the stomach and small-intestinal microbiota in fasted healthy humans. mSphere 2019, 4, e00126-19. [Google Scholar] [CrossRef] [Scilit]
  47. Lo, W.K.; Chan, W.W. Proton pump inhibitor use and the risk of small intestinal bacterial overgrowth: A meta-analysis. Clin. Gastroenterol. Hepatol. 2013, 11, 483–490. [Google Scholar] [CrossRef] [Scilit]
  48. Miazga, A.; Osiński, M.; Cichy, W.; Żaba, R. Advances in medical sciences current views on the etiopathogenesis, clinical manifestation, diagnostics, treatment and correlation with other nosological entities of SIBO. Adv. Med. Sci. 2015, 60, 118–124. [Google Scholar] [CrossRef] [Scilit]
  49. Daniell, H.W. Acid suppressing therapy as a risk factor for Candida esophagitis. Dis. Esophagus 2016, 29, 479–483. [Google Scholar] [CrossRef] [Scilit]
  50. Jung, S.B.; Nagaraja, V.; Kapur, A.; Eslick, G.D. Association between vitamin B12 deficiency and long-term use of acid-lowering agents: A systematic review and meta-analysis. Intern. Med. J. 2015, 45, 409–416. [Google Scholar] [CrossRef] [Scilit]
  51. Sánchez, A.; Calpena, A.C.; Clares, B. Evaluating the Oxidative Stress in Inflammation: Role of Melatonin. Int. J. Mol. Sci. 2015, 16, 16981–17004. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  52. Adeyeye, C.M.; Li, P.K. Diclofenac sodium. In Analytical Profiles of Drug Substances; Florey, K., Ed.; Academic Press Inc.: San Diego, CA, USA, 1990; Volume 19, pp. 123–144. [Google Scholar]
  53. Mei, Q.; Diao, L.; Xu, J.; Liu, X.; Jin, J. A protective effect of melatonin on intestinal permeability is induced by diclofenac via regulation of mitochondrial function in mice. Acta Pharmacol. Sin. 2011, 32, 495–502. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Sánchez, A.B.; Calpena, A.C.; Mallandrich, M.; Clares, B. Validation of an ex vivo permeation method for the intestinal permeability of different BCS drugs and its correlation with caco-2 in vitro experiments. Pharmaceutics 2019, 11, 638. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  55. Reiter, R.J. Pineal Melatonin: Cell biology of its synthesis and of its physiological interactions. EndocR. Rev. 1991, 12, 151–180. [Google Scholar] [CrossRef] [Scilit]
  56. Shida, C.S.; Castrucci, A.M.; Lamy-Freund, M.T. High melatonin solubility in aqueous medium. J. Pineal Res. 1994, 16, 198–201. [Google Scholar] [CrossRef] [Scilit]
  57. Munford, M.L.; Pasa, A. Influence of melatonin on the order of phosphatidylcholine-based membranes. J. Pineal Res. 2010, 49, 169–175. [Google Scholar]
  58. Dies, H.; Cheung, B.; Tang, J.; Rheinstädter, M.C. The organization of melatonin in lipid membranes. Biochim. Biophys. Acta 2015, 1848, 1032–1040. [Google Scholar] [CrossRef] [Scilit]
  59. Johns, J. Estimation of melatonin blood brain barrier permeability. J. Bioanaly. Biomed. 2011, 3, 64–69. [Google Scholar] [CrossRef]
  60. Alluri, H.; Wilson, R.L.; Shaji, C.A.; Wiggins, K. Melatonin preserves blood-brain barrier integrity and permeability via matrix metalloproteinase-9 inhibition. PLoS ONE 2016, 11, e0154427. [Google Scholar] [CrossRef] [Scilit]
  61. Reiter, R.J.; Fuentes-broto, L.; Paredes, S.D.; Tan, D.; Garcia, J.J. Melatonin and the pathophysiology of cellular membranes. Marmara Pharm. J. 2010, 14, 1–9. [Google Scholar] [CrossRef] [Scilit]
  62. Res, P. Melatonin in the duodenal lumen is a potent stimulant of mucosal bicarbonate secretion. J. Pineal Res. 2003, 34, 288–293. [Google Scholar]
  63. Keyse, S.M.; Tyrrell, R.M. Heme oxygenase is the major 32-kDa stress protein induced in human skin fibroblasts by UVA radiation, hydrogen peroxide, and sodium arsenite. PNAS 2006, 86, 99–103. [Google Scholar] [CrossRef] [Scilit]
  64. Kim, H.J.; So, H.S.; Lee, J.H.; Lee, J.H.; Park, C.; Park, S.Y.; Park, R. Heme oxygenase-1 attenuates the cisplatin-induced apoptosis of auditory cells via down-regulation of reactive oxygen species generation. Free Radic. Biol. Med. 2006, 40, 1810–1819. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  65. Bindu, S.; Pal, C.; Dey, S.; Goyal, M.; Alam, A.; Iqbal, M.S.; Bandyopadhyay, U. Translocation of heme oxygenase-1 to mitochondria is a novel cytoprotective mechanism against non-steroidal anti-inflammatory drug-induced mitochondrial oxidative stress, apoptosis, and gastric mucosal injury. J. Biol. Chem. 2011, 286, 39387–39402. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  66. Wu, C.C.; Lu, K.C.; Lin, G.J.; Hsieh, H.Y.; Chu, P.; Lin, S.H.; Sytwu, H.K. Melatonin enhances endogenous heme oxygenase-1 and represses immune responses to ameliorate experimental murine membranous nephropathy. J. Pineal Res. 2012, 52, 460–469. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  67. Deng, W.; Tang, S.; Tseng, H.; Wu, K.K. Melatonin suppresses macrophage cyclooxygenase-2 and inducible nitric oxide synthase expression by inhibiting p52 acetylation and binding. Blood 2006, 108, 518–524. [Google Scholar] [CrossRef] [Scilit]
  68. Machowska, A.; Szlachcic, A.; Pawlik, M.; Brzozowski, T.; Konturek, S.J.; Pawlik, W.W. The role of female and male sex hormones in the healing process of preexisting lingual and gastric ulcerations. J. Physiol. Pharmacol. 2004, 55 (Suppl. 2), 91–104. [Google Scholar]
  69. Sangma, T.K.; Jain, S.; Mediratta, P.K. Effect of ovarian sex hormones on non-steroidal anti-inflammatory drug-induced gastric lesions in female rats. Indian J. Pharmacol. 2014, 46, 113–116. [Google Scholar]
Figure 1. IQVIA® (IQVIA Inc., Parsippany, NJ, United States) data about the main nonsteroidal anti-inflammatory drugs (NSAIDs) world sales from 2012 to 2017, including Europe (Key 5 are Germany, France, Italy, Spain, and Britain), Asia, North, South, and Central America, Africa, Middle East, and Southeast Asia.
Figure 1. IQVIA® (IQVIA Inc., Parsippany, NJ, United States) data about the main nonsteroidal anti-inflammatory drugs (NSAIDs) world sales from 2012 to 2017, including Europe (Key 5 are Germany, France, Italy, Spain, and Britain), Asia, North, South, and Central America, Africa, Middle East, and Southeast Asia.
Cells 09 00180 g001
Figure 2. Synthesis of prostaglandins scheme from membrane phospholipids, including enzymes, substrates, and receptors. PLA2 (phospholipase A2); COX1 (cyclooxygenase 1); COX2 (cyclooxygenase 2); PGH2 (prostaglandin H2); PGD2 (prostaglandin D2); DP1 and CRTH2 (DP2) (D-prostanoids receptors); PGI2 (prostaciclin); IP (prostacyclin receptor); PGE2 (prostaglandin E2); EP1 to EP4 (prostaglandin receptors); PGF (prostaglandin F2α); FPA and FPB (prostanoid receptors, isoform A and B); TxA2 (thromboxane A2); and TPα and TPβ (thromboxane prostanoid receptors). Figure edited with EdrawTMMax 9.4 (Edrawsoft, Hong Kong, China, 2019).
Figure 2. Synthesis of prostaglandins scheme from membrane phospholipids, including enzymes, substrates, and receptors. PLA2 (phospholipase A2); COX1 (cyclooxygenase 1); COX2 (cyclooxygenase 2); PGH2 (prostaglandin H2); PGD2 (prostaglandin D2); DP1 and CRTH2 (DP2) (D-prostanoids receptors); PGI2 (prostaciclin); IP (prostacyclin receptor); PGE2 (prostaglandin E2); EP1 to EP4 (prostaglandin receptors); PGF (prostaglandin F2α); FPA and FPB (prostanoid receptors, isoform A and B); TxA2 (thromboxane A2); and TPα and TPβ (thromboxane prostanoid receptors). Figure edited with EdrawTMMax 9.4 (Edrawsoft, Hong Kong, China, 2019).
Cells 09 00180 g002
Figure 3. Cumulative permeated amounts (µg) as a function of time (min) in steady state of SD alone (a) and in the presence of melatonin (MLT) and (b) results are reported as mean ± SD (n = 6).
Figure 3. Cumulative permeated amounts (µg) as a function of time (min) in steady state of SD alone (a) and in the presence of melatonin (MLT) and (b) results are reported as mean ± SD (n = 6).
Cells 09 00180 g003
Figure 4. Histological analysis of intestine structure. Photomicrographs of hematoxylin- and eosin-stained sections of pig small intestine without treatment (A) or treated with MLT; (B) with SD; (C) or with SD + MLT; and (D) the effect on the histological architecture of the products was evaluated on the freshly excised pork intestine. ×100 magnification, scale bar = 200 µm. Arrow indicates alteration of villi.
Figure 4. Histological analysis of intestine structure. Photomicrographs of hematoxylin- and eosin-stained sections of pig small intestine without treatment (A) or treated with MLT; (B) with SD; (C) or with SD + MLT; and (D) the effect on the histological architecture of the products was evaluated on the freshly excised pork intestine. ×100 magnification, scale bar = 200 µm. Arrow indicates alteration of villi.
Cells 09 00180 g004
Figure 5. Representative micrographs of hematoxylin and eosin staining of tissue sections corresponding to the different treatments and structures: Stomach samples from mice without treatment (A) MLT; (B) SD + MLT; (C) or SD; (D) small intestine from mice without treatment; (E) MLT; (F) SD + MLT; (G) or SD; and (H) the effect on the histological architecture of the products was evaluated on the stomach and intestine from p.o. administered mice. ×100 magnification, scale bar = 200 µm. * indicates leucocytes infiltration.
Figure 5. Representative micrographs of hematoxylin and eosin staining of tissue sections corresponding to the different treatments and structures: Stomach samples from mice without treatment (A) MLT; (B) SD + MLT; (C) or SD; (D) small intestine from mice without treatment; (E) MLT; (F) SD + MLT; (G) or SD; and (H) the effect on the histological architecture of the products was evaluated on the stomach and intestine from p.o. administered mice. ×100 magnification, scale bar = 200 µm. * indicates leucocytes infiltration.
Cells 09 00180 g005
Figure 6. Comparative levels of COX-2 (a) and iNOS; and (b) mRNA in duodenum of Sus scrofa. Data are expressed as mean ± SD. ** p < 0.01 > 0.001; and *** p < 0.001. SD (Sodium diclofenac); MLT (Melatonin).
Figure 6. Comparative levels of COX-2 (a) and iNOS; and (b) mRNA in duodenum of Sus scrofa. Data are expressed as mean ± SD. ** p < 0.01 > 0.001; and *** p < 0.001. SD (Sodium diclofenac); MLT (Melatonin).
Cells 09 00180 g006
Figure 7. Comparative levels of COX-2 (a) and iNOS; and (b) mRNA in duodenum of Mus musculus. Data are expressed as mean ± SD. MLT (Melatonin); SD (Sodium diclofenac).
Figure 7. Comparative levels of COX-2 (a) and iNOS; and (b) mRNA in duodenum of Mus musculus. Data are expressed as mean ± SD. MLT (Melatonin); SD (Sodium diclofenac).
Cells 09 00180 g007
Figure 8. Comparative levels of COX-2 (a) and iNOS; and (b) mRNA in the stomach of Mus musculus. Data are expressed as mean ± SD. *** p < 0.001. SD (Sodium diclofenac); MLT (Melatonin).
Figure 8. Comparative levels of COX-2 (a) and iNOS; and (b) mRNA in the stomach of Mus musculus. Data are expressed as mean ± SD. *** p < 0.001. SD (Sodium diclofenac); MLT (Melatonin).
Cells 09 00180 g008
Figure 9. Summarized MLT multipathways action mechanism to prevent GI injuries caused by NSAIDs.
Figure 9. Summarized MLT multipathways action mechanism to prevent GI injuries caused by NSAIDs.
Cells 09 00180 g009
Table 1. Ex vivo experimental groups.
Table 1. Ex vivo experimental groups.
Group NumberPermeated DrugPermeated SolutionDose
1 (n = 6)No drug (Reference group)--
2 (n = 6)SD1 mg/mL in PBS pH 7.41 mL
3 (n = 6)MLT0.5 mg/mL in PBS pH 7.41 mL
4 (n = 6)SD (a) + MLT (b)2 mg/mL (a) 1 mg/mL (b)0.5 mL + 0.5 mL
SD (Sodium Diclofenac); MLT (Melatonin).
Table 2. In vivo experimental groups.
Table 2. In vivo experimental groups.
Group numberGroupAdministered DrugsDose
1 (n = 6)REFNo drug (Reference group)-
2 (n = 6)SDSodium Diclofenac2.5 mg/kg
3 (n = 6)MLTMelatonin10 mg/kg
4 (n = 6)SD + MLTSodium Diclofenac and Melatonin2.5 mg/kg and 10 mg/kg
REF (Reference group); SD (Sodium Diclofenac); MLT (Melatonin).
Table 3. Primer sequences used for real time PCR in Sus scrofa and Mus musculus.
Table 3. Primer sequences used for real time PCR in Sus scrofa and Mus musculus.
PrimerAnimal ModelSequence (5′ to 3′)Acc. Number
COX-2Sus scrofaFW: GGAGAGACAGCATAAACTGCAF207824
RV: GTGTGTTAAACTCAGCAGCA
Mus musculusFW: CCACTTCAAGGGAGTCTGGANM_011198.4
RV: AGTCATCTGCTACGGGAGGA
iNOSSus scrofaFW: CAACAATGGCAACATCAGGU59390
RV: CATCAGGCATCTGGTAGC
Mus musculusFW: GTTCTCAGCCCAACAATACAAGANM_010927
RV: GTGGACGGGTCGATGTCAC
β-actinSus scrofaFW: GACATCCGCAAGGACCTCTADQ845171
RV: ACACGGAGTACTTGCGCTCT
Mus musculusFW: GGCCGGGACCTGACAGACTACCTCNM_007393
RV: GTCACGCACGATTTCCCTCTCAGC
Table 4. Permeation parameters for SD alone and in presence of MLT in vertical Franz cells (n = 6) and statistical correlation between different Papp obtained values. Papp values are expressed as mean ± SD.
Table 4. Permeation parameters for SD alone and in presence of MLT in vertical Franz cells (n = 6) and statistical correlation between different Papp obtained values. Papp values are expressed as mean ± SD.
Permeation ParametersSD AloneSD+MLTUnpaired t-Test (p)
Flux (µg/min)1.21 ± 0.111.39 ± 0.20-
Flux/sup (µg/(cm/min))0.48 ± 0.040.55 ± 0.10-
Co (µg/mL)10001000-
Papp (×10−6) (cm/s)7.92 ± 0.739.12 ± 0.130.078 (>0.05)
Abbreviation: Papp—apparent permeability coefficient; SD—Sodium Diclofenac; MLT: Melatonin.

Share and Cite

MDPI and ACS Style

Sánchez, A.B.; Clares, B.; Rodríguez-Lagunas, M.J.; Fábrega, M.J.; Calpena, A.C. Study of Melatonin as Preventive Agent of Gastrointestinal Damage Induced by Sodium Diclofenac. Cells 2020, 9, 180. https://doi.org/10.3390/cells9010180

AMA Style

Sánchez AB, Clares B, Rodríguez-Lagunas MJ, Fábrega MJ, Calpena AC. Study of Melatonin as Preventive Agent of Gastrointestinal Damage Induced by Sodium Diclofenac. Cells. 2020; 9(1):180. https://doi.org/10.3390/cells9010180

Chicago/Turabian Style

Sánchez, Aroha B., Beatriz Clares, María J. Rodríguez-Lagunas, María J. Fábrega, and Ana C. Calpena. 2020. "Study of Melatonin as Preventive Agent of Gastrointestinal Damage Induced by Sodium Diclofenac" Cells 9, no. 1: 180. https://doi.org/10.3390/cells9010180

APA Style

Sánchez, A. B., Clares, B., Rodríguez-Lagunas, M. J., Fábrega, M. J., & Calpena, A. C. (2020). Study of Melatonin as Preventive Agent of Gastrointestinal Damage Induced by Sodium Diclofenac. Cells, 9(1), 180. https://doi.org/10.3390/cells9010180

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop