ROR1 Expression and Its Functional Significance in Hepatocellular Carcinoma Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Tissue Culture
2.2. Generation of Monoclonal Antibody
2.3. Transfections and Virus Work
2.4. Generation of ROR1 Knockdown Stable Cells
2.5. In Silico Analyses
2.6. Western Blotting and RT-qPCR
2.7. Immunoprecipitation
2.8. Flow Cytometry
2.9. Functional Assays: Proliferation, Cell cycle, Apoptosis, Doxorubicin uptake, Migration, and Drug Resistance
3. Results
3.1. ROR1 Is Expressed in HCC Cell Lines Irrespective of Their EMT Phenotype
3.2. Generation and Characterization of Anti-ROR1 Monoclonal Antibodies
3.3. Monoclonal Antibodies Specifically Recognize Endogenous ROR1 in Human and Mouse HCC Cells
3.4. ROR1 Regulates EMT Phenotype in HCC Cells
3.5. ROR1-Depleted HCC Cells Display Reduced Motility and Proliferation and Increased Accumulation at G1 Phase
3.6. Decreased ROR1 Confers Resistance to Apoptosis and Anoikis on HCC Cells
3.7. ROR1 Depletion Induces Resistance to Chemotherapeutic Drugs through Upregulation of Multidrug Resistance Genes
4. Discussion
Author Contributions
Funding
Conflicts of Interest
Appendix A


References
- Bray, F.; Ferlay, J.; Soerjomataram, I.; Siegel, R.L.; Torre, L.A.; Jemal, A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. Cancer J. Clin. 2018, 6, 394–424. [Google Scholar] [CrossRef] [PubMed]
- El–Serag, H.B.; Rudolph, K.L. Hepatocellular carcinoma: Epidemiology and molecular carcinogenesis. Gastroenterology 2007, 132, 2557–2576. [Google Scholar] [CrossRef] [PubMed]
- Ozen, C.; Yildiz, G.; Dagcan, A.T.; Cevik, D.; Ors, A.; Keles, U.; Topel, H.; Ozturk, M. Genetics and epigenetics of liver cancer. New Biotechnol. 2013, 30, 381–384. [Google Scholar] [CrossRef] [PubMed]
- Gomaa, A.I.; Khan, S.A.; Toledano, M.B.; Waked, I.; Taylor-Robinson, S.D. Hepatocellular carcinoma: Epidemiology, risk factors and pathogenesis. World J. Gastroenterol. WJG 2008, 14, 4300. [Google Scholar] [CrossRef] [PubMed]
- Choo, S.P.; Tan, W.L.; Goh, B.K.; Tai, W.M.; Zhu, A.X. Comparison of hepatocellular carcinoma in Eastern versus Western populations. Cancer 2016, 122, 3430–3446. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.; Zhang, Y.; Ge, L.; Lin, Y.; Kwok, H.F. The Roles of Protein Tyrosine Phosphatases in Hepatocellular Carcinoma. Cancers 2018, 10, 82. [Google Scholar] [CrossRef] [PubMed]
- Slamon, D.J.; Leyland-Jones, B.; Shak, S.; Fuchs, H.; Paton, V.; Bajamonde, A.; Fleming, T.; Eiermann, W.; Wolter, J.; Pegram, M. Use of chemotherapy plus a monoclonal antibody against HER2 for metastatic breast cancer that overexpresses HER2. N. Engl. J. Med. 2001, 344, 783–792. [Google Scholar] [CrossRef] [PubMed]
- Bang, Y.-J.; Van Cutsem, E.; Feyereislova, A.; Chung, H.C.; Shen, L.; Sawaki, A.; Lordick, F.; Ohtsu, A.; Omuro, Y.; Satoh, T. Trastuzumab in combination with chemotherapy versus chemotherapy alone for treatment of HER2-positive advanced gastric or gastro-oesophageal junction cancer (ToGA): A phase 3, open-label, randomised controlled trial. Lancet 2010, 376, 687–697. [Google Scholar] [CrossRef]
- Hurwitz, H.; Fehrenbacher, L.; Novotny, W.; Cartwright, T.; Hainsworth, J.; Heim, W.; Berlin, J.; Baron, A.; Griffing, S.; Holmgren, E. Bevacizumab plus irinotecan, fluorouracil, and leucovorin for metastatic colorectal cancer. N. Engl. J. Med. 2004, 350, 2335–2342. [Google Scholar] [CrossRef] [PubMed]
- Saltz, L.B.; Meropol, N.J.; Loehrer Sr, P.J.; Needle, M.N.; Kopit, J.; Mayer, R.J. Phase II trial of cetuximab in patients with refractory colorectal cancer that expresses the epidermal growth factor receptor. J. Clin. Oncol. 2004, 22, 1201–1208. [Google Scholar] [CrossRef] [PubMed]
- Baselga, J.; Norton, L.; Albanell, J.; Kim, Y.-M.; Mendelsohn, J. Recombinant humanized anti-HER2 antibody (Herceptin™) enhances the antitumor activity of paclitaxel and doxorubicin against HER2/neu overexpressing human breast cancer xenografts. Cancer Res. 1998, 58, 2825–2831. [Google Scholar] [PubMed]
- Masiakowski, P.; Carroll, R.D. A novel family of cell surface receptors with tyrosine kinase-like domain. J. Biol. Chem. 1992, 267, 26181–26190. [Google Scholar] [PubMed]
- Paganoni, S.; Ferreira, A. Neurite extension in central neurons: A novel role for the receptor tyrosine kinases Ror1 and Ror2. J. Cell Sci. 2005, 118, 433–446. [Google Scholar] [CrossRef] [PubMed]
- Fukuda, T.; Lu, D.; Carson, D.A.; Kipps, T.J. Restricted Expression of the Orphan Tyrosine Kinase Receptor ROR1 in Chronic Lymphocytic Leukemia. Blood 2004, 104, 772. [Google Scholar]
- DaneshManesh, A.H.; Mikaelsson, E.; Jeddi-Tehrani, M.; Bayat, A.A.; Ghods, R.; Ostadkarampour, M.; Akhondi, M.; Lagercrantz, S.; Larsson, C.; Österborg, A. Ror1, a cell surface receptor tyrosine kinase is expressed in chronic lymphocytic leukemia and may serve as a putative target for therapy. Int. J. Cancer 2008, 123, 1190–1195. [Google Scholar] [CrossRef] [PubMed]
- Baskar, S.; Kwong, K.Y.; Hofer, T.; Levy, J.M.; Kennedy, M.G.; Lee, E.; Staudt, L.M.; Wilson, W.H.; Wiestner, A.; Rader, C. Unique cell surface expression of receptor tyrosine kinase ROR1 in human B-cell chronic lymphocytic leukemia. Clin. Cancer Res. 2008, 14, 396–404. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Chen, L.; Wang-Rodriguez, J.; Zhang, L.; Cui, B.; Frankel, W.; Wu, R.; Kipps, T.J. The onco-embryonic antigen ROR1 is expressed by a variety of human cancers. Am. J. Pathol. 2012, 181, 1903–1910. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Chen, L.; Cui, B.; Chuang, H.-Y.; Yu, J.; Wang-Rodriguez, J.; Tang, L.; Chen, G.; Basak, G.W.; Kipps, T.J. ROR1 is expressed in human breast cancer and associated with enhanced tumor-cell growth. PLoS ONE 2012, 7, e31127. [Google Scholar] [CrossRef] [PubMed]
- Hojjat-Farsangi, M.; Ghaemimanesh, F.; Daneshmanesh, A.H.; Bayat, A.-A.; Mahmoudian, J.; Jeddi-Tehrani, M.; Rabbani, H.; Mellstedt, H. Inhibition of the receptor tyrosine kinase ROR1 by anti-ROR1 monoclonal antibodies and siRNA induced apoptosis of melanoma cells. PLoS ONE 2013, 8, e61167. [Google Scholar] [CrossRef] [PubMed]
- Cui, B.; Zhang, S.; Chen, L.; Yu, J.; Widhopf, G.F.; Fecteau, J.-F.; Rassenti, L.Z.; Kipps, T.J. Targeting ROR1 inhibits epithelial–mesenchymal transition and metastasis. Cancer Res. 2013, 73, 3649–3660. [Google Scholar] [CrossRef] [PubMed]
- Gentile, A.; Lazzari, L.; Benvenuti, S.; Trusolino, L.; Comoglio, P.M. Ror1 is a pseudokinase that is crucial for Met-driven tumorigenesis. Cancer Res. 2011, 8, 3132–3141. [Google Scholar] [CrossRef] [PubMed]
- Yamaguchi, T.; Yanagisawa, K.; Sugiyama, R.; Hosono, Y.; Shimada, Y.; Arima, C.; Kato, S.; Tomida, S.; Suzuki, M.; Osada, H. NKX2-1/TITF1/TTF-1-Induced ROR1 is required to sustain EGFR survival signaling in lung adenocarcinoma. Cancer Cell 2012, 21, 348–361. [Google Scholar] [CrossRef] [PubMed]
- Matsuda, T.; Nomi, M.; Ikeya, M.; Kani, S.; Oishi, I.; Terashima, T.; Takada, S.; Minami, Y. Expression of the receptor tyrosine kinase genes, Ror1 and Ror2, during mouse development. Mech. Dev. 2001, 105, 153–156. [Google Scholar] [CrossRef]
- Balakrishnan, A.; Goodpaster, T.; Randolph-Habecker, J.; Hoffstrom, B.G.; Jalikis, F.G.; Koch, L.K.; Berger, C.; Kosasih, P.L.; Rajan, A.; Sommermeyer, D. Analysis of ROR1 protein expression in human cancer and normal tissues. Clin. Cancer Res. 2017, 23, 3061–3071. [Google Scholar] [CrossRef] [PubMed]
- Sayan, A.E.; Paradisi, A.; Vojtesek, B.; Knight, R.A.; Melino, G.; Candi, E. New antibodies recognizing p73: Comparison with commercial antibodies. Biochem. Biophys. Res. Commun. 2005, 330, 186–193. [Google Scholar] [CrossRef] [PubMed]
- Odabas, G.; Cetin, M.; Turhal, S.; Baloglu, H.; Sayan, A.E.; Yagci, T. Plexin C1 Marks Liver Cancer Cells with Epithelial Phenotype and Is Overexpressed in Hepatocellular Carcinoma. Canadian J. Gastroenterol. Hepatol. 2018, 2018, 4040787. [Google Scholar] [CrossRef] [PubMed]
- Celikkaya, H.; Ciraci, C.; Oztas, E.; Avci, M.E.; Ozturk, M.; Yagci, T. Immunization with UV-induced apoptotic cells generates monoclonal antibodies against proteins differentially expressed in hepatocellular carcinoma cell lines. Hybridoma 2007, 26, 55–61. [Google Scholar] [CrossRef] [PubMed]
- Müller, M.; Schilling, T.; Sayan, A.; Kairat, A.; Lorenz, K.; Schulze-Bergkamen, H.; Oren, M.; Koch, A.; Tannapfel, A.; Stremmel, W. TAp73/ΔNp73 influences apoptotic response, chemosensitivity and prognosis in hepatocellular carcinoma. Cell Death Differ. 2005, 12, 1564. [Google Scholar] [CrossRef] [PubMed]
- Sayan, B.S.; Sayan, A.E.; Knight, R.A.; Melino, G.; Cohen, G.M. p53 is cleaved by caspases generating fragments localizing to mitochondria. J. Biol. Chem. 2006, 281, 13566–13573. [Google Scholar] [CrossRef] [PubMed]
- Sayan, A.E.; Stanford, R.; Vickery, R.; Grigorenko, E.; Diesch, J.; Kulbicki, K.; Edwards, R.; Pal, R.; Greaves, P.; Jariel-Encontre, I. Fra-1 controls motility of bladder cancer cells via transcriptional upregulation of the receptor tyrosine kinase AXL. Oncogene 2012, 31, 1493. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Cui, B.; Lai, H.; Liu, G.; Ghia, E.M.; Widhopf, G.F.; Zhang, Z.; Wu, C.C.; Chen, L.; Wu, R. Ovarian cancer stem cells express ROR1, which can be targeted for anti–cancer-stem-cell therapy. Proc. Natl. Acad. Sci. USA 2014, 111, 17266–17271. [Google Scholar] [CrossRef] [PubMed]
- Jung, E.H.; Lee, H.N.; Han, G.Y.; Kim, M.J.; Kim, C.W. Targeting ROR1 inhibits the self-renewal and invasive ability of glioblastoma stem cells. Cell Biochem. Funct. 2016, 34, 149–157. [Google Scholar] [CrossRef] [PubMed]
- Yuzugullu, H.; Benhaj, K.; Ozturk, N.; Senturk, S.; Celik, E.; Toylu, A.; Tasdemir, N.; Yilmaz, M.; Erdal, E.; Akcali, K.C. Canonical Wnt signaling is antagonized by noncanonical Wnt5a in hepatocellular carcinoma cells. Mol. Cancer 2009, 8, 90. [Google Scholar] [CrossRef] [PubMed]
- Shim, H. One target, different effects: A comparison of distinct therapeutic antibodies against the same targets. Exp. Mol. Med. 2011, 43, 539. [Google Scholar] [CrossRef] [PubMed]
- Kaucka, M.; Krejčí, P.; Plevova, K.; Pavlová, Š.; Prochazkova, J.; Janovska, P.; Valnohová, J.; Kozubík, A.; Pospíšilová, Š.; Bryja, V. Post-translational modifications regulate signalling by Ror1. Acta Physiol. 2011, 203, 351–362. [Google Scholar] [CrossRef] [PubMed]
- Hanahan, D.; Weinberg, R.A. Hallmarks of cancer: The next generation. Cell 2011, 144, 646–674. [Google Scholar] [CrossRef] [PubMed]
- Lamouille, S.; Xu, J.; Derynck, R. Molecular mechanisms of epithelial–mesenchymal transition. Nat. Rev. Mol. Cell Biol. 2014, 15, 178. [Google Scholar] [CrossRef] [PubMed]
- Mani, S.A.; Guo, W.; Liao, M.-J.; Eaton, E.N.; Ayyanan, A.; Zhou, A.Y.; Brooks, M.; Reinhard, F.; Zhang, C.C.; Shipitsin, M. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell 2008, 133, 704–715. [Google Scholar] [CrossRef] [PubMed]
- Singh, A.; Settleman, J. EMT, cancer stem cells and drug resistance: An emerging axis of evil in the war on cancer. Oncogene 2010, 29, 4741. [Google Scholar] [CrossRef] [PubMed]
- Lammer, J.; Malagari, K.; Vogl, T.; Pilleul, F.; Denys, A.; Watkinson, A.; Pitton, M.; Sergent, G.; Pfammatter, T.; Terraz, S. Prospective randomized study of doxorubicin-eluting-bead embolization in the treatment of hepatocellular carcinoma: Results of the PRECISION V study. Cardiovasc. Int. Radiol. 2010, 33, 41–52. [Google Scholar] [CrossRef] [PubMed]
- Llovet, J.M. Updated treatment approach to hepatocellular carcinoma. J. Gastroenterol. 2005, 40, 225–235. [Google Scholar] [CrossRef] [PubMed]
- Du, B.; Shim, J. Targeting epithelial–mesenchymal transition (EMT) to overcome drug resistance in cancer. Molecules 2016, 21, 965. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.-N.; Koo, K.H.; Sung, J.Y.; Yun, U.-J.; Kim, H. Anoikis resistance: An essential prerequisite for tumor metastasis. Int. J. Cell Biol. 2012, 2012, 306879. [Google Scholar] [CrossRef] [PubMed]
- Sayan, A.E.; Griffiths, T.R.; Pal, R.; Browne, G.J.; Ruddick, A.; Yagci, T.; Edwards, R.; Mayer, N.J.; Qazi, H.; Goyal, S.; et al. SIP1 protein protects cells from DNA damage-induced apoptosis and has independent prognostic value in bladder cancer. Proc. Natl. Acad Sci. USA 2009, 106, 14884–14889. [Google Scholar] [CrossRef] [PubMed]
- Saxena, M.; Stephens, M.A.; Pathak, H.; Rangarajan, A. Transcription factors that mediate epithelial-mesenchymal transition lead to multidrug resistance by upregulating ABC transporters. Cell Death Dis. 2011, 2, e179. [Google Scholar] [CrossRef] [PubMed]
- Nieto, M.A.; Huang, R.Y.; Jackson, R.A.; Thiery, J.P. EMT: 2016. Cell 2016, 166, 21–45. [Google Scholar] [CrossRef] [PubMed]
- Wu, Q.; Yang, Z.; Xia, L.; Nie, Y.; Wu, K.; Shi, Y.; Fan, D. Methylation of miR-129-5p CpG island modulates multi-drug resistance in gastric cancer by targeting ABC transporters. Oncotarget 2014, 5, 11552. [Google Scholar] [CrossRef] [PubMed]
- Gillet, J.-P.; Efferth, T.; Steinbach, D.; Hamels, J.; de Longueville, F.; Bertholet, V.; Remacle, J. Microarray-based detection of multidrug resistance in human tumor cells by expression profiling of ATP-binding cassette transporter genes. Cancer Res. 2004, 64, 8987–8993. [Google Scholar] [CrossRef] [PubMed]
- Krech, T.; Scheuerer, E.; Geffers, R.; Kreipe, H.; Lehmann, U.; Christgen, M. ABCB1/MDR1 contributes to the anticancer drug-resistant phenotype of IPH-926 human lobular breast cancer cells. Cancer Lett. 2012, 315, 153–160. [Google Scholar] [CrossRef] [PubMed]
- Belinsky, M.G.; Chen, Z.-S.; Shchaveleva, I.; Zeng, H.; Kruh, G.D. Characterization of the drug resistance and transport properties of multidrug resistance protein 6 (MRP6, ABCC6). Cancer Res. 2002, 62, 6172–6177. [Google Scholar] [PubMed]
- Bruix, J.; Qin, S.; Merle, P.; Granito, A.; Huang, Y.-H.; Bodoky, G.; Pracht, M.; Yokosuka, O.; Rosmorduc, O.; Breder, V. Regorafenib for patients with hepatocellular carcinoma who progressed on sorafenib treatment (RESORCE): A randomised, double-blind, placebo-controlled, phase 3 trial. Lancet 2017, 389, 56–66. [Google Scholar] [CrossRef]
- El-Khoueiry, A.B.; Melero, I.; Crocenzi, T.S.; Welling, T.H.; Yau, T.C.; Yeo, W.; Chopra, A.; Grosso, J.; Lang, L.; Anderson, J. Phase I/II safety and antitumor activity of nivolumab in patients with advanced hepatocellular carcinoma (HCC): CA209-040. J. Clin. Oncol. 2015. [Google Scholar] [CrossRef]
- Ikeda, K.; Kudo, M.; Kawazoe, S.; Osaki, Y.; Ikeda, M.; Okusaka, T.; Tamai, T.; Suzuki, T.; Hisai, T.; Hayato, S. Phase 2 study of lenvatinib in patients with advanced hepatocellular carcinoma. J. Gastroenterol. 2017, 52, 512–519. [Google Scholar] [CrossRef] [PubMed]
- Cancer Research UK Home Page. Available online: https://www.cancerresearchuk.org/health-professional/cancer-statistics/statistics-by-cancer-type/liver-cancer/incidence#heading-Four (accessed on 17 January 2019).
- Ramakrishna, G.; Rastogi, A.; Trehanpati, N.; Sen, B.; Khosla, R.; Sarin, S.K. From cirrhosis to hepatocellular carcinoma: New molecular insights on inflammation and cellular senescence. Liver Cancer 2013, 2, 367–383. [Google Scholar] [CrossRef] [PubMed]
- Hudecek, M.; Schmitt, T.M.; Baskar, S.; Lupo-Stanghellini, M.T.; Nishida, T.; Yamamoto, T.N.; Bleakley, M.; Turtle, C.J.; Chang, W.-C.; Greisman, H.A. The B-cell tumor associated antigen ROR1 can be targeted with T-cells modified to express a ROR1-specific chimeric antigen receptor. Blood 2010, 116, 4532–4541. [Google Scholar] [CrossRef] [PubMed]
- Daneshmanesh, A.H.; Hojjat-Farsangi, M.; Ghaderi, A.; Moshfegh, A.; Hansson, L.; Schultz, J.; Vågberg, J.; Byström, S.; Olsson, E.; Olin, T. A receptor tyrosine kinase ROR1 inhibitor (KAN0439834) induced significant apoptosis of pancreatic cells which was enhanced by erlotinib and ibrutinib. PLoS ONE 2018, 13, e0198038. [Google Scholar] [CrossRef] [PubMed]
- Zheng, Y.-Z.; Ma, R.; Zhou, J.-K.; Guo, C.-L.; Wang, Y.-S.; Li, Z.-G.; Liu, L.-X.; Peng, Y. ROR1 is a novel prognostic biomarker in patients with lung adenocarcinoma. Sci. Rep. 2016, 6, 36447. [Google Scholar] [CrossRef] [PubMed]
- Tam, W.L.; Lu, H.; Buikhuisen, J.; Soh, B.S.; Lim, E.; Reinhardt, F.; Wu, Z.J.; Krall, J.A.; Bierie, B.; Guo, W. Protein kinase C α is a central signaling node and therapeutic target for breast cancer stem cells. Cancer Cell 2013, 24, 347–364. [Google Scholar] [CrossRef] [PubMed]
- Pattabiraman, D.R.; Weinberg, R.A. Targeting the epithelial-to-mesenchymal transition: The case for differentiation-based therapy. Cold Spring Harb. Symp. Quant. Biol. 2016, 81, 11–19. [Google Scholar] [CrossRef]
- O’Connell, M.P.; Marchbank, K.; Webster, M.R.; Valiga, A.A.; Kaur, A.; Vultur, A.; Li, L.; Herlyn, M.; Villanueva, J.; Liu, Q. Hypoxia induces phenotypic plasticity and therapy resistance in melanoma via the tyrosine kinase receptors ROR1 and ROR2. Cancer Dis. 2013, 3, 1378–1393. [Google Scholar] [CrossRef] [PubMed]







| Gene | F (5′–3′) | R (5′–3′) |
|---|---|---|
| ABCG1 | CTACCACAACCCAGCAGATT | AGGTCTCTCTTGTGGTCTGA |
| ABCC6 | CCCAGGCTGATTGGATCATAG | GGTTCTGTTTCTCCTTCTCCTC |
| ABCB1 | GGTGAGTCAGGAACCTGTATTG | AGTCATAGGCATTGGCTTCC |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cetin, M.; Odabas, G.; Douglas, L.R.; Duriez, P.J.; Balcik-Ercin, P.; Yalim-Camci, I.; Sayan, A.E.; Yagci, T. ROR1 Expression and Its Functional Significance in Hepatocellular Carcinoma Cells. Cells 2019, 8, 210. https://doi.org/10.3390/cells8030210
Cetin M, Odabas G, Douglas LR, Duriez PJ, Balcik-Ercin P, Yalim-Camci I, Sayan AE, Yagci T. ROR1 Expression and Its Functional Significance in Hepatocellular Carcinoma Cells. Cells. 2019; 8(3):210. https://doi.org/10.3390/cells8030210
Chicago/Turabian StyleCetin, Metin, Gorkem Odabas, Leon R. Douglas, Patrick J. Duriez, Pelin Balcik-Ercin, Irem Yalim-Camci, Abdulkadir Emre Sayan, and Tamer Yagci. 2019. "ROR1 Expression and Its Functional Significance in Hepatocellular Carcinoma Cells" Cells 8, no. 3: 210. https://doi.org/10.3390/cells8030210
APA StyleCetin, M., Odabas, G., Douglas, L. R., Duriez, P. J., Balcik-Ercin, P., Yalim-Camci, I., Sayan, A. E., & Yagci, T. (2019). ROR1 Expression and Its Functional Significance in Hepatocellular Carcinoma Cells. Cells, 8(3), 210. https://doi.org/10.3390/cells8030210

