Breast Cancer Resistance Protein (BCRP/ABCG2) Inhibits Extra Villous Trophoblast Migration: The Impact of Bacterial and Viral Infection
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethical Approval
2.2. Human Placental Explant Culture
2.3. Immunohistochemistry
2.4. Cell Line and Culture
2.5. Quantitative Real Time PCR (qPCR)
2.6. Immunoblotting
2.7. Enzyme-Linked Immunosorbent Assay (ELISA)
2.8. Transient Transfection with siRNA Oligonucleotides
2.9. Cell Migration Assay
2.10. Cell Proliferation Assay
2.11. Statistical Analysis
3. Results
3.1. Expression of BCRP Is Enriched in Column Cytotrophoblasts (CCT) and Extravillous Trophoblasts (EVTs) in Placental Explants
3.2. ABCG2 Knockdown or Functional Inhibition of BCRP Stimulates EVT Cell Migration (HTR8/SVneo Cells)
3.3. Bacterial and Viral Infection Mimics Activate a Pro-Inflammatory Response in EVTs and Impair ABCG2 and BCRP Expression (HTR8/SVneo Cells)
3.4. LPS and ssRNA Exposure Increases EVT Migration (HTR8/SVneo Cells)
3.5. ABCG2 Knockdown Stimulates EVT Cell Migration in Placental Explants
4. Discussion
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Red-Horse, K.; Zhou, Y.; Genbacev, O.; Prakobphol, A.; Foulk, R.; McMaster, M.; Fisher, S.J. Trophoblast differentiation during embryo implantation and formation of the maternal-fetal interface. J. Clin. Investig. 2004, 114, 744–754. [Google Scholar] [CrossRef] [PubMed]
- Pijnenborg, R.; Dixon, G.; Robertson, W.B.; Brosens, I. Trophoblastic invasion of human decidua from 8 to 18 weeks of pregnancy. Placenta 1980, 1, 3–19. [Google Scholar] [CrossRef]
- Lash, G.E.; Otun, H.A.; Innes, B.A.; Percival, K.; Searle, R.F.; Robson, S.C.; Bulmer, J.N. Regulation of extravillous trophoblast invasion by uterine natural killer cells is dependent on gestational age. Hum. Reprod. 2010, 25, 1137–1145. [Google Scholar] [CrossRef] [PubMed]
- Brosens, I.; Robertson, W.B.; Dixon, H.G. The physiological response of the vessels of the placental bed to normal pregnancy. J. Pathol. Bacteriol. 1967, 93, 569–579. [Google Scholar] [CrossRef] [PubMed]
- Steegers, E.A.; von Dadelszen, P.; Duvekot, J.J.; Pijnenborg, R. Pre-eclampsia. Lancet 2010, 376, 631–644. [Google Scholar] [CrossRef]
- Jauniaux, E.; Collins, S.; Burton, G.J. Placenta accreta spectrum: Pathophysiology and evidence-based anatomy for prenatal ultrasound imaging. Am. J. Obstet. Gynecol. 2018, 218, 75–87. [Google Scholar] [CrossRef]
- Buca, D.; Liberati, M.; Cali, G.; Forlani, F.; Caisutti, C.; Flacco, M.E.; Manzoli, L.; Familiari, A.; Scambia, G.; D’Antonio, F. Influence of prenatal diagnosis of abnormally invasive placenta on maternal outcome: A systematic review and meta-analysis. Ultrasound Obstet. Gynecol. 2018. [Google Scholar] [CrossRef]
- Lurain, J.R. Gestational trophoblastic disease I: Epidemiology, pathology, clinical presentation and diagnosis of gestational trophoblastic disease, and management of hydatidiform mole. Am. J. Obstet. Gynecol. 2010, 203, 531–539. [Google Scholar] [CrossRef]
- Bloise, E.; Ortiga-Carvalho, T.M.; Reis, F.M.; Lye, S.J.; Gibb, W.; Matthews, S.G. ATP-binding cassette transporters in reproduction: A new frontier. Hum. Reprod. Update 2016, 22, 164–181. [Google Scholar] [CrossRef]
- Lye, P.; Bloise, E.; Dunk, C.; Javam, M.; Gibb, W.; Lye, S.J.; Matthews, S.G. Effect of oxygen on multidrug resistance in the first trimester human placenta. Placenta 2013, 34, 817–823. [Google Scholar] [CrossRef]
- Sun, M.; Kingdom, J.; Baczyk, D.; Lye, S.J.; Matthews, S.G.; Gibb, W. Expression of the multidrug resistance P-glycoprotein, (ABCB1 glycoprotein) in the human placenta decreases with advancing gestation. Placenta 2006, 27, 602–609. [Google Scholar] [CrossRef] [PubMed]
- Lye, P.; Bloise, E.; Javam, M.; Gibb, W.; Lye, S.J.; Matthews, S.G. Impact of bacterial and viral challenge on multidrug resistance in first- and third-trimester human placenta. Am. J. Pathol. 2015, 185, 1666–1675. [Google Scholar] [CrossRef] [PubMed]
- Do Imperio, G.E.; Bloise, E.; Javam, M.; Lye, P.; Constantinof, A.; Dunk, C.; Dos Reis, F.M.; Lye, S.J.; Gibb, W.; Ortiga-Carvalho, T.M.; et al. Chorioamnionitis Induces a Specific Signature of Placental ABC Transporters Associated with an Increase of miR-331-5p in the Human Preterm Placenta. Cell. Physiol. Biochem. 2018, 45, 591–604. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.; Liu, F.; Ren, Q.; Zhao, Q.; Ren, H.; Lu, S.; Zhang, L.; Han, Z. Suppression of ABCG2 inhibits cancer cell proliferation. Int. J. Cancer 2010, 126, 841–851. [Google Scholar] [CrossRef] [PubMed]
- Drebert, Z.; MacAskill, M.; Doughty-Shenton, D.; De Bosscher, K.; Bracke, M.; Hadoke, P.W.F.; Beck, I.M. Colon cancer-derived myofibroblasts increase endothelial cell migration by glucocorticoid-sensitive secretion of a pro-migratory factor. Vascul. Pharmacol. 2017, 89, 19–30. [Google Scholar] [CrossRef] [PubMed]
- Gong, W.; Wang, Z.; Wan, Y.; Shi, L.; Zhou, Y. Downregulation of ABCG2 protein inhibits migration and invasion in U251 glioma stem cells. Neuroreport 2014, 25, 625–632. [Google Scholar] [CrossRef] [PubMed]
- Shi, L.; Wang, Z.; Sun, G.; Wan, Y.; Guo, J.; Fu, X. miR-145 inhibits migration and invasion of glioma stem cells by targeting ABCG2. Neuromol. Med. 2014, 16, 517–528. [Google Scholar] [CrossRef] [PubMed]
- Yaguchi, T.; Onishi, T. Estrogen induces cell proliferation by promoting ABCG2-mediated efflux in endometrial cancer cells. Biochem. Biophys. Rep. 2018, 16, 74–78. [Google Scholar] [CrossRef] [PubMed]
- Giakoumelou, S.; Wheelhouse, N.; Cuschieri, K.; Entrican, G.; Howie, S.E.; Horne, A.W. The role of infection in miscarriage. Hum. Reprod. Update 2016, 22, 116–133. [Google Scholar] [CrossRef] [PubMed]
- Dunk, C.E.; Pappas, J.J.; Lye, P.; Kibschull, M.; Javam, M.; Bloise, E.; Lye, S.J.; Szyf, M.; Matthews, S.G. P-Glycoprotein (P-gp)/ABCB1 plays a functional role in extravillous trophoblast (EVT) invasion and is decreased in the pre-eclamptic placenta. J. Cell. Mol. Med. 2018, 22, 5378–5393. [Google Scholar] [CrossRef] [PubMed]
- Genbacev, O.; Schubach, S.A.; Miller, R.K. Villous culture of first trimester human placenta--model to study extravillous trophoblast (EVT) differentiation. Placenta 1992, 13, 439–461. [Google Scholar] [CrossRef]
- Lye, P.; Bloise, E.; Nadeem, L.; Gibb, W.; Lye, S.J.; Matthews, S.G. Glucocorticoids modulate multidrug resistance transporters in the first trimester human placenta. J. Cell. Mol. Med. 2018, 22, 3652–3660. [Google Scholar] [CrossRef] [PubMed]
- Graham, C.H.; Hawley, T.S.; Hawley, R.G.; MacDougall, J.R.; Kerbel, R.S.; Khoo, N.; Lala, P.K. Establishment and characterization of first trimester human trophoblast cells with extended lifespan. Exp. Cell Res. 1993, 206, 204–211. [Google Scholar] [CrossRef] [PubMed]
- Novembri, R.; Torricelli, M.; Bloise, E.; Conti, N.; Galeazzi, L.R.; Severi, F.M.; Petraglia, F. Effects of urocortin 2 and urocortin 3 on IL-10 and TNF-alpha expression and secretion from human trophoblast explants. Placenta 2011, 32, 969–974. [Google Scholar] [CrossRef]
- Potter, J.A.; Garg, M.; Girard, S.; Abrahams, V.M. Viral single stranded RNA induces a trophoblast pro-inflammatory and antiviral response in a TLR8-dependent and -independent manner. Biol. Reprod. 2015, 92, 17. [Google Scholar] [CrossRef] [PubMed]
- Javam, M.; Audette, M.C.; Iqbal, M.; Bloise, E.; Gibb, W.; Matthews, S.G. Effect of oxygen on multidrug resistance in term human placenta. Placenta 2014, 35, 324–330. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Drewlo, S.; Levytska, K.; Kingdom, J. Revisiting the housekeeping genes of human placental development and insufficiency syndromes. Placenta 2012, 33, 952–954. [Google Scholar] [CrossRef]
- Imperio, G.E.; Javam, M.; Lye, P.; Constantinof, A.; Dunk, C.E.; Reis, F.M.; Lye, S.J.; Gibb, W.; Matthews, S.G.; Ortiga-Carvalho, T.M.; et al. Gestational age-dependent gene expression profiling of ATP-binding cassette transporters in the healthy human placenta. J. Cell. Mol. Med. 2018. [Google Scholar] [CrossRef]
- Wang, F.; Xue, X.; Wei, J.; An, Y.; Yao, J.; Cai, H.; Wu, J.; Dai, C.; Qian, Z.; Xu, Z.; et al. hsa-miR-520h downregulates ABCG2 in pancreatic cancer cells to inhibit migration, invasion, and side populations. Br. J. Cancer 2010, 103, 567–574. [Google Scholar] [CrossRef]
- Turner, J.G.; Gump, J.L.; Zhang, C.; Cook, J.M.; Marchion, D.; Hazlehurst, L.; Munster, P.; Schell, M.J.; Dalton, W.S.; Sullivan, D.M. ABCG2 expression, function and promoter methylation in human multiple myeloma. Blood 2006. [Google Scholar] [CrossRef] [PubMed]
- Nakanishi, T.; Ross, D.D. Breast cancer resistance protein (BCRP/ABCG2): Its role in multidrug resistance and regulation of its gene expression. Chin. J. Cancer 2012, 31, 73–99. [Google Scholar] [CrossRef] [PubMed]
- Miletti-Gonzalez, K.E.; Chen, S.; Muthukumaran, N.; Saglimbeni, G.N.; Wu, X.; Yang, J.; Apolito, K.; Shih, W.J.; Hait, W.N.; Rodriguez-Rodriguez, L. The CD44 receptor interacts with P-glycoprotein to promote cell migration and invasion in cancer. Cancer Res. 2005, 65, 6660–6667. [Google Scholar] [CrossRef] [PubMed]
- Toole, B.P.; Slomiany, M.G. Hyaluronan, CD44 and Emmprin: Partners in cancer cell chemoresistance. Drug Res. Updates 2008, 11, 110–121. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.; Kumar, S. CD44-mediated adhesion to hyaluronic acid contributes to mechanosensing and invasive motility. Mol. Cancer Res. 2014, 12, 1416–1429. [Google Scholar] [CrossRef] [PubMed]
- Slomiany, M.G.; Dai, L.; Bomar, P.A.; Knackstedt, T.J.; Kranc, D.A.; Tolliver, L.; Maria, B.L.; Toole, B.P. Abrogating drug resistance in malignant peripheral nerve sheath tumors by disrupting hyaluronan-CD44 interactions with small hyaluronan oligosaccharides. Cancer Res. 2009, 69, 4992–4998. [Google Scholar] [CrossRef] [PubMed]
- Goodison, S.; Urquidi, V.; Tarin, D. CD44 cell adhesion molecules. Mol. Pathol. 1999, 52, 189–196. [Google Scholar] [CrossRef]
- Takahashi, H.; Takizawa, T.; Matsubara, S.; Ohkuchi, A.; Kuwata, T.; Usui, R.; Matsumoto, H.; Sato, Y.; Fujiwara, H.; Okamoto, A.; et al. Extravillous trophoblast cell invasion is promoted by the CD44-hyaluronic acid interaction. Placenta 2014, 35, 163–170. [Google Scholar] [CrossRef]
- Lu, Y.C.; Yeh, W.C.; Ohashi, P.S. LPS/TLR4 signal transduction pathway. Cytokine 2008, 42, 145–151. [Google Scholar] [CrossRef]
- Petrovic, V.; Wang, J.H.; Piquette-Miller, M. Effect of endotoxin on the expression of placental drug transporters and glyburide disposition in pregnant rats. Drug Metab. Dispos. 2008, 36, 1944–1950. [Google Scholar] [CrossRef]
- Bloise, E.; Bhuiyan, M.; Audette, M.C.; Petropoulos, S.; Javam, M.; Gibb, W.; Matthews, S.G. Prenatal endotoxemia and placental drug transport in the mouse: Placental size-specific effects. PLoS ONE 2013, 8, e65728. [Google Scholar] [CrossRef] [PubMed]
- Yamamoto, M.; Sato, S.; Hemmi, H.; Hoshino, K.; Kaisho, T.; Sanjo, H.; Takeuchi, O.; Sugiyama, M.; Okabe, M.; Takeda, K.; et al. Role of adaptor TRIF in the MyD88-independent toll-like receptor signaling pathway. Science 2003, 301, 640–643. [Google Scholar] [CrossRef] [PubMed]
- Bloise, E.; Petropoulos, S.; Iqbal, M.; Kostaki, A.; Ortiga-Carvalho, T.M.; Gibb, W.; Matthews, S.G. Acute Effects of Viral Exposure on P-Glycoprotein Function in the Mouse Fetal Blood-Brain Barrier. Cell. Physiol. Biochem. 2017, 41, 1044–1050. [Google Scholar] [CrossRef] [PubMed]
- Goertz, G.P.; Abbo, S.R.; Fros, J.J.; Pijlman, G.P. Functional RNA during Zika virus infection. Virus Res. 2018, 254, 41–53. [Google Scholar] [CrossRef] [PubMed]
- Davis, M.; Sagan, S.M.; Pezacki, J.P.; Evans, D.J.; Simmonds, P. Bioinformatic and physical characterizations of genome-scale ordered RNA structure in mammalian RNA viruses. J. Virol. 2008, 82, 11824–11836. [Google Scholar] [CrossRef] [PubMed]
- Petersen, L.R.; Jamieson, D.J.; Honein, M.A. Zika Virus. N. Engl. J. Med. 2016, 375, 294–295. [Google Scholar] [CrossRef] [PubMed]
- Saiz, J.C.; Martin-Acebes, M.A.; Bueno-Mari, R.; Salomon, O.D.; Villamil-Jimenez, L.C.; Heukelbach, J.; Alencar, C.H.; Armstrong, P.K.; Ortiga-Carvalho, T.M.; Mendez-Otero, R.; et al. Zika Virus: What Have We Learnt Since the Start of the Recent Epidemic? Front. Microbiol. 2017, 8, 1554. [Google Scholar] [CrossRef] [PubMed]
- Luo, H.; Winkelmann, E.R.; Fernandez-Salas, I.; Li, L.; Mayer, S.V.; Danis-Lozano, R.; Sanchez-Casas, R.M.; Vasilakis, N.; Tesh, R.; Barrett, A.D.; et al. Zika, dengue and yellow fever viruses induce differential anti-viral immune responses in human monocytic and first trimester trophoblast cells. Antivir. Res. 2018, 151, 55–62. [Google Scholar] [CrossRef]
- Noronha, L.d.; Zanluca, C.; Burger, M.; Suzukawa, A.A.; Azevedo, M.; Rebutini, P.Z.; Novadzki, I.M.; Tanabe, L.S.; Presibella, M.M.; Duarte dos Santos, C.N. Zika Virus Infection at Different Pregnancy Stages: Anatomopathological Findings, Target Cells and Viral Persistence in Placental Tissues. Front. Microbiol. 2018, 9. [Google Scholar] [CrossRef]
- Lyall, F.; Bulmer, J.N.; Duffie, E.; Cousins, F.; Theriault, A.; Robson, S.C. Human trophoblast invasion and spiral artery transformation: The role of PECAM-1 in normal pregnancy, preeclampsia, and fetal growth restriction. Am. J. Pathol. 2001, 158, 1713–1721. [Google Scholar] [CrossRef]
- Nourollahpour Shiadeh, M.; Behboodi Moghadam, Z.; Adam, I.; Saber, V.; Bagheri, M.; Rostami, A. Human infectious diseases and risk of preeclampsia: An updated review of the literature. Infection 2017, 45, 589–600. [Google Scholar] [CrossRef] [PubMed]








| Primer Name | Sequence | Reference |
|---|---|---|
| ABCG2 | Forward: 5′-TGGAATCCAGAACAGAGCTGGGGT-3′ | Lye et al., 2018 |
| Reverse: 5′-AGAGTTCCACGGCTGAAACACTGC-3′ | ||
| IL-6 | Forward: 5′-TGCAGAAAAAGGCAAAGAAT-3′ | Potter et al., 2015 |
| Reverse: 5′-CTGACCAGAAGAAGGAATGC-3′ | ||
| IL-8 | Forward: 5′-TGGGAACAAGAGGGCATCTG-3′ | Lye et al., 2015 |
| Reverse: 5′-CCACCACTGCATCAAATTCATG-3′ | ||
| CCL2 | Forward: 5′-TTCATTCCCCAAGGGCTCGCTCA-3′ | Lye et al., 2015 |
| Reverse: 5′-AGCACAGATCTCCTTGGCCACAA-3′ | ||
| TLR-4 | Forward: 5′-ATTTGTCTCCACAGCCACCA-3′ | Lye et al., 2015 |
| Reverse: 5′-ACAGGAAACCCCATCCAGAG-3′ | ||
| HPRT | Forward: 5′-TGA CAC TGG CAA AAC AATGCA-3′ | Drewlo et al., 2012 |
| Reverse: 5′-GGT CCT TTTCAC CAG CAA GCT-3′ | ||
| TBP | Forward: 5′-TGC ACA GGA GCC AAG AGT GAA-3′ | Drewlo et al., 2012 |
| Reverse: 5′-CAC ATC ACA GCT CCC CAC CA-3′ | ||
| Number | Sequence | |
|---|---|---|
| 1 | Antisense | AUAACCAGCUGAUUCAAAGUAUCCC |
| Sense | GGGAUACUUUGAAUCAGC UGGUUAU | |
| 2 | Antisense | UAAUGAUGUCCAAGAAGAAGUCUGC |
| Sense | CAGACUUCUUCUUGGACAUCAUUA | |
| 3 | Antisense | GGAGGCAAAUCUUCGUUAUTT |
| Sense | AUAACGAAGAUUUGCCUCCTT | |
| Negative Control | Antisense | GCGACGAUCUGCCUAAGAUdTdT |
| Sense | AUCUUAGGCAGAUCGUCGCdTdT |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lye, P.; Bloise, E.; Nadeem, L.; Peng, C.; Gibb, W.; Ortiga-Carvalho, T.M.; Lye, S.J.; Matthews, S.G. Breast Cancer Resistance Protein (BCRP/ABCG2) Inhibits Extra Villous Trophoblast Migration: The Impact of Bacterial and Viral Infection. Cells 2019, 8, 1150. https://doi.org/10.3390/cells8101150
Lye P, Bloise E, Nadeem L, Peng C, Gibb W, Ortiga-Carvalho TM, Lye SJ, Matthews SG. Breast Cancer Resistance Protein (BCRP/ABCG2) Inhibits Extra Villous Trophoblast Migration: The Impact of Bacterial and Viral Infection. Cells. 2019; 8(10):1150. https://doi.org/10.3390/cells8101150
Chicago/Turabian StyleLye, Phetcharawan, Enrrico Bloise, Lubna Nadeem, Chun Peng, William Gibb, Tania M. Ortiga-Carvalho, Stephen J. Lye, and Stephen G. Matthews. 2019. "Breast Cancer Resistance Protein (BCRP/ABCG2) Inhibits Extra Villous Trophoblast Migration: The Impact of Bacterial and Viral Infection" Cells 8, no. 10: 1150. https://doi.org/10.3390/cells8101150
APA StyleLye, P., Bloise, E., Nadeem, L., Peng, C., Gibb, W., Ortiga-Carvalho, T. M., Lye, S. J., & Matthews, S. G. (2019). Breast Cancer Resistance Protein (BCRP/ABCG2) Inhibits Extra Villous Trophoblast Migration: The Impact of Bacterial and Viral Infection. Cells, 8(10), 1150. https://doi.org/10.3390/cells8101150

