Transplantation of Mesenchymal Stem Cell-Derived Hepatocytes Primed with Quercetin Alone or in Combination with Rutin and LiCl Enhances Liver Regeneration
Highlights
- Quercetin alone or in combination with rutin and lithium chloride (LiCl) promotes differentiation of mesenchymal stem cells (MSCs) into hepatocyte-like cells.
- Transplantation of quercetin-primed MSC-derived hepatocytes restores liver function and reduces inflammation and fibrosis in a rat bile duct ligation model.
- MSC-derived hepatocytes primed with quercetin alone or combined with rutin and LiCl exhibit enhanced liver regenerative potential.
- Ex vivo priming of MSC-derived hepatocytes with flavonoids and LiCl represents a new promising therapeutic strategy for liver regeneration.
Abstract
1. Introduction
2. Experimental Work
2.1. Chemical Compounds
2.2. Animals
2.3. Isolation and Passaging of Bone Marrow-Derived MSCs
2.4. Characterization of MSCs
2.5. Cytotoxicity Assay
2.6. Analysis of Wnt Pathway
2.7. In Vitro Induction of Hepatic Differentiation
2.8. Analysis of Hepatic Differentiation
2.9. Bile Duct Ligation (BDL) Model for Liver Fibrosis
2.10. Blood Profile and Histological Analysis
2.11. Tracking of Transplanted Cells
2.12. Statistical Analysis
3. Results
3.1. Isolation and Differentiation of MSCs
3.2. Cytotoxicity Analysis of Quercetin, Rutin and Lithium Chloride
3.3. Modulation of Wnt Pathway by Quercetin, Rutin and LiCl
3.4. Quercetin Alone and in Combination with Rutin or LiCl Differentiates MSCs into Hepatocytes
3.5. Transplantation of MSC-Derived Hepatocytes Treated with Quercetin, Rutin and LiCl Prevents Inflammation and Fibrosis In Vivo
3.6. Tracking of MSC-Derived Hepatocytes After Transplantation
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| AFP | Alpha Fetoprotein |
| BDL | Bile duct ligation |
| CK-18 | Cytokeratin 18 |
| GGT | Gamma glutamyl transferase |
| GAPDH | Glyceraldehyde-3-phosphate dehydrogenase |
| HNF | Hepatocyte nuclear factors |
| LiCl | Lithium chloride |
| LDLR | Low-density lipoprotein receptor |
| MSCs | Mesenchymal stem cells |
| PPARD | Peroxisome proliferator-activated receptor delta |
| SGPT | Serum glutamate pyruvate transaminase |
| TCF | T cell factor |
| Wnt | Wingless-related integration site |
References
- Devarbhavi, H.; Asrani, S.K.; Arab, J.P.; Nartey, Y.A.; Pose, E.; Kamath, P.S. Global burden of liver disease: 2023 update. J. Hepatol. 2023, 79, 516–537. [Google Scholar] [CrossRef] [PubMed]
- Huang, R.; Zhang, X.; Gracia-Sancho, J.; Xie, W.F. Liver regeneration: Cellular origin and molecular mechanisms. Liver Int. 2022, 42, 1486–1495. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.; Meng, Y.; Han, Z.; Ye, F.; Wei, L.; Zong, C. Mesenchymal stem cell therapy for liver disease: Full of chances and challenges. Cell Biosci. 2020, 10, 123. [Google Scholar] [CrossRef] [PubMed]
- Pan, T.; Wang, N.; Zhang, J.; Yang, F.; Chen, Y.; Zhuang, Y.; Xu, Y.; Fang, J.; You, K.; Lin, X.; et al. Efficiently generate functional hepatic cells from human pluripotent stem cells by complete small-molecule strategy. Stem Cell Res. Ther. 2022, 13, 159. [Google Scholar] [CrossRef] [PubMed]
- Kriska, J.; Janeckova, L.; Kirdajova, D.; Honsa, P.; Knotek, T.; Dzamba, D.; Kolenicova, D.; Butenko, O.; Vojtechova, M.; Capek, M.; et al. Wnt/beta-Catenin Signaling Promotes Differentiation of Ischemia-Activated Adult Neural Stem/Progenitor Cells to Neuronal Precursors. Front. Neurosci. 2021, 15, 628983. [Google Scholar] [CrossRef] [PubMed]
- Davidson, K.C.; Adams, A.M.; Goodson, J.M.; McDonald, C.E.; Potter, J.C.; Berndt, J.D.; Biechele, T.L.; Taylor, R.J.; Moon, R.T. Wnt/beta-catenin signaling promotes differentiation, not self-renewal, of human embryonic stem cells and is repressed by Oct4. Proc. Natl. Acad. Sci. USA 2012, 109, 4485–4490. [Google Scholar] [CrossRef] [PubMed]
- Perugorria, M.J.; Olaizola, P.; Labiano, I.; Esparza-Baquer, A.; Marzioni, M.; Marin, J.J.G.; Bujanda, L.; Banales, J.M. Wnt-beta-catenin signalling in liver development, health and disease. Nat. Rev. Gastroenterol. Hepatol. 2019, 16, 121–136. [Google Scholar] [CrossRef] [PubMed]
- Blagodatski, A.; Klimenko, A.; Jia, L.; Katanaev, V.L. Small Molecule Wnt Pathway Modulators from Natural Sources: History, State of the Art and Perspectives. Cells 2020, 9, 589. [Google Scholar] [CrossRef] [PubMed]
- Snitow, M.E.; Bhansali, R.S.; Klein, P.S. Lithium and Therapeutic Targeting of GSK-3. Cells 2021, 10, 255. [Google Scholar] [CrossRef] [PubMed]
- Ji, Y.; Lv, J.; Sun, D.; Huang, Y. Therapeutic strategies targeting Wnt/beta-catenin signaling for colorectal cancer (Review). Int. J. Mol. Med. 2022, 49, 1. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.; Shao, J.; Wu, X.M.; Pan, F.F.; Yang, S.A.; Pan, X.H.; Jin, A.M. Troxerutin Stimulates Osteoblast Differentiation of Mesenchymal Stem Cell and Facilitates Bone Fracture Healing. Front. Pharmacol. 2021, 12, 723145. [Google Scholar] [CrossRef] [PubMed]
- Ullah, A.; Munir, S.; Badshah, S.L.; Khan, N.; Ghani, L.; Poulson, B.G.; Emwas, A.H.; Jaremko, M. Important Flavonoids and Their Role as a Therapeutic Agent. Molecules 2020, 25, 5243. [Google Scholar] [CrossRef] [PubMed]
- Ninfali, P.; Antonelli, A.; Magnani, M.; Scarpa, E.S. Antiviral Properties of Flavonoids and Delivery Strategies. Nutrients 2020, 12, 2534. [Google Scholar] [CrossRef] [PubMed]
- Shamsudin, N.F.; Ahmed, Q.U.; Mahmood, S.; Ali Shah, S.A.; Khatib, A.; Mukhtar, S.; Alsharif, M.A.; Parveen, H.; Zakaria, Z.A. Antibacterial Effects of Flavonoids and Their Structure-Activity Relationship Study: A Comparative Interpretation. Molecules 2022, 27, 1149. [Google Scholar] [CrossRef] [PubMed]
- Al-Khayri, J.M.; Sahana, G.R.; Nagella, P.; Joseph, B.V.; Alessa, F.M.; Al-Mssallem, M.Q. Flavonoids as Potential Anti-Inflammatory Molecules: A Review. Molecules 2022, 27, 2901. [Google Scholar] [CrossRef] [PubMed]
- Wild, S.L.; Elghajiji, A.; Grimaldos Rodriguez, C.; Weston, S.D.; Burke, Z.D.; Tosh, D. The Canonical Wnt Pathway as a Key Regulator in Liver Development, Differentiation and Homeostatic Renewal. Genes 2020, 11, 1163. [Google Scholar] [CrossRef] [PubMed]
- Lade, A.G.; Monga, S.P. Beta-catenin signaling in hepatic development and progenitors: Which way does the WNT blow? Dev. Dyn. 2011, 240, 486–500. [Google Scholar] [CrossRef] [PubMed]
- Nejak-Bowen, K.; Monga, S.P. Wnt/beta-catenin signaling in hepatic organogenesis. Organogenesis 2008, 4, 92–99. [Google Scholar] [CrossRef] [PubMed]
- Atanasov, A.G.; Zotchev, S.B.; Dirsch, V.M.; the International Natural Product Sciences Taskforce; Supuran, C.T. Natural products in drug discovery: Advances and opportunities. Nat. Rev. Drug Discov. 2021, 20, 200–216. [Google Scholar] [CrossRef] [PubMed]
- Qazi, R.E.; Khan, I.; Haneef, K.; Malick, T.S.; Naeem, N.; Ahmad, W.; Salim, A.; Mohsin, S. Combination of mesenchymal stem cells and three-dimensional collagen scaffold preserves ventricular remodeling in rat myocardial infarction model. World J. Stem Cells 2022, 14, 633–657. [Google Scholar] [CrossRef] [PubMed]
- Russell, J.O.; Monga, S.P. Wnt/beta-Catenin Signaling in Liver Development, Homeostasis, and Pathobiology. Annu. Rev. Pathol. 2018, 13, 351–378. [Google Scholar] [CrossRef] [PubMed]
- Xu, W.; Du, X.; Li, J.; Zhang, Z.; Ma, X.; Luo, D.; Xiao, M.; Sun, Q. SiNiSan alleviates liver injury by promoting hepatic stem cell differentiation via Wnt/beta-catenin signaling pathway. Phytomedicine 2022, 99, 153969. [Google Scholar] [CrossRef] [PubMed]
- Hu, S.; Monga, S.P. Wnt/-Catenin Signaling and Liver Regeneration: Circuit, Biology, and Opportunities. Gene Expr. 2021, 20, 189–199. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; He, L.; Yang, Z.; Li, L.; Cai, W. Lithium chloride promotes proliferation of neural stem cells in vitro, possibly by triggering the Wnt signaling pathway. Anim. Cells Syst. 2019, 23, 32–41. [Google Scholar] [CrossRef] [PubMed]
- Jothimani, G.; Di Liddo, R.; Pathak, S.; Piccione, M.; Sriramulu, S.; Banerjee, A. Wnt signaling regulates the proliferation potential and lineage commitment of human umbilical cord derived mesenchymal stem cells. Mol. Biol. Rep. 2020, 47, 1293–1308. [Google Scholar] [CrossRef] [PubMed]
- Soucek, O.; Cinek, O.; Velentza, L.; Semjonov, V.; Bezdicka, M.; Zaman, F.; Savendahl, L. Lithium rescues cultured rat metatarsals from dexamethasone-induced growth failure. Pediatr. Res. 2024, 96, 925–963. [Google Scholar] [CrossRef] [PubMed]
- Engin, A.B.; Engin, A.; Engin, E.D.; Memis, L. Does lithium attenuate the liver damage due to oxidative stress and liver glycogen depletion in experimental common bile duct obstruction? Toxicol. Appl. Pharmacol. 2023, 466, 116489. [Google Scholar] [CrossRef] [PubMed]
- Srivastava, N.S.; Srivastava, R.A.K. Curcumin and quercetin synergistically inhibit cancer cell proliferation in multiple cancer cells and modulate Wnt/beta-catenin signaling and apoptotic pathways in A375 cells. Phytomedicine 2019, 52, 117–128. [Google Scholar] [CrossRef] [PubMed]
- Seo, S.H.; Lee, S.H.; Cha, P.H.; Kim, M.Y.; Min, S.d.; Choi, K.Y. Polygonum aviculare L. and its active compounds, quercitrin hydrate, caffeic acid, and rutin, activate the Wnt/beta-catenin pathway and induce cutaneous wound healing. Phytother. Res. PTR 2016, 30, 848–854. [Google Scholar] [CrossRef] [PubMed]
- Zhao, B.; Zhang, W.; Xiong, Y.; Zhang, Y.; Zhang, D.; Xu, X. Effects of rutin on the oxidative stress, proliferation and osteogenic differentiation of periodontal ligament stem cells in LPS-induced inflammatory environment and the underlying mechanism. J. Mol. Histol. 2020, 51, 161–171. [Google Scholar] [CrossRef] [PubMed]
- Sheinenzon, A.; Shehadeh, M.; Michelis, R.; Shaoul, E.; Ronen, O. Serum albumin levels and inflammation. Int. J. Biol. Macromol. 2021, 184, 857–862. [Google Scholar] [CrossRef] [PubMed]
- Xie, P.Y.; Hu, X.J.; Guo, R.M.; Meng, X.C.; Pang, P.F.; Zhou, Z.Y.; Li, D.; Shan, H. Generation of functional hepatocyte-like cells from human bone marrow mesenchymal stem cells by overexpression of transcription factor HNF4alpha and FOXA2. Hepatobiliary Pancreat. Dis. Int. 2019, 18, 546–556. [Google Scholar] [CrossRef] [PubMed]
- Rashid, S.; Salim, A.; Qazi, R.; Malick, T.S.; Haneef, K. Sodium Butyrate Induces Hepatic Differentiation of Mesenchymal Stem Cells in 3D Collagen Scaffolds. Appl. Biochem. Biotechnol. 2022, 194, 3721–3732. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Jin, Q.; Yao, Q.; Xu, B.; Li, L.; Zhang, S.; Tu, C. The Flavonoid Quercetin Ameliorates Liver Inflammation and Fibrosis by Regulating Hepatic Macrophages Activation and Polarization in Mice. Front. Pharmacol. 2018, 9, 72. [Google Scholar] [CrossRef] [PubMed]
- Itaba, N.; Sakabe, T.; Kanki, K.; Azumi, J.; Shimizu, H.; Kono, Y.; Matsumi, Y.; Abe, K.I.; Tonoi, T.; Oka, H.; et al. Identification of the small molecule compound which induces hepatic differentiation of human mesenchymal stem cells. Regen. Ther. 2015, 2, 32–41. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Tschudy-Seney, B.; Ma, X.; Zern, M.A.; Liu, P.; Duan, Y. Salvianolic Acid B Enhances Hepatic Differentiation of Human Embryonic Stem Cells Through Upregulation of WNT Pathway and Inhibition of Notch Pathway. Stem Cells Dev. 2018, 27, 252–261. [Google Scholar] [CrossRef] [PubMed]
- Ke, Z.; Zhou, F.; Wang, L.; Chen, S.; Liu, F.; Fan, X.; Tang, F.; Liu, D.; Zhao, G. Down-regulation of Wnt signaling could promote bone marrow-derived mesenchymal stem cells to differentiate into hepatocytes. Biochem. Biophys. Res. Commun. 2008, 367, 342–348. [Google Scholar] [CrossRef] [PubMed]










| Primer Sequence 5′-3′ | Product Size | |
|---|---|---|
| Albumin | ||
| Forward Primer | AGCTGTCCGTCAGAGGATGA | 302 |
| Reverse Primer | TCTCAGCGAGACACTGGGAT | |
| LDLR | ||
| Forward Primer | CGGCCACCAGTGTGAAGATA | 428 |
| Reverse Primer | CCGTCCAGTAGATGTTGCCA | |
| FoxA2 | ||
| Forward Primer | GCTAAGCGGGGCTTCCTG | 204 |
| Reverse Primer | GGCTCGTGCCCTTCCATC | |
| AFP | ||
| Forward Primer | GCCTGAAATGACAGAGGAGCA | 244 |
| Reverse Primer | CCACATGGAAGTCTCCACCAG | |
| CK-18 | ||
| Forward Primer | GACTCCAGCAACTCCTAGCAA | 110 |
| Reverse Primer | TGAGCCTTAGTGCCTCAGAAC | |
| PPARD | ||
| Forward Primer | TCAGGGTTAGAAGCTACACAGC | 126 |
| Reverse Primer | CCGGGAGAAGAAAGAACAGCTA | |
| Wnt | ||
| Forward Primer | TTGATTTCCAGTGTCCAGAGGG | 148 |
| Reverse Primer | ACCTAGTTGGCAATCTCTGCAA | |
| β-catenin | ||
| Forward Primer | GTTGAGCTGACCAGTTCCCT | 106 |
| Reverse Primer | GGCGATATCCAAGGGCTTCT | |
| Axin | ||
| Forward Primer | CAGATCCGGGAGGATGAAGAAA | 108 |
| Reverse Primer | TTCATAGCTGCCAGAGGGTAAG | |
| TCF | ||
| Forward Primer | ACACAAAGCAAACATTATTGGTCA | 111 |
| Reverse Primer | CTGAAGATCAGCTACTGGTTACAT | |
| GAPDH | ||
| Forward Primer | GGAAAGCTGTGGCGTGATGG | 414 |
| Reverse Primer | GTAGGCCATGAGGTCCACCA | |
| Compound Treatment | Time Points (Days) |
|---|---|
| Quercetin (Q14) | 14 |
| Rutin (R14) | 14 |
| Lithium chloride (LiCl) | 14 |
| Rutin + Quercetin (RQ) | 10 + 4 |
| Rutin + Lithium chloride (RL) | 10 + 4 |
| Quercetin + Rutin (QR) | 10 + 4 |
| Quercetin + Lithium chloride (QL) | 10 + 4 |
| Lithium chloride + Quercetin (LQ) | 10 + 4 |
| Lithium chloride + Rutin (LR) | 10 + 4 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Malick, T.S.; Qazi, R.-E.-M.; Ishaque, A.; Fatima, A.; Khan, I.; Faizi, S.; Salim, A.; Zaman, F. Transplantation of Mesenchymal Stem Cell-Derived Hepatocytes Primed with Quercetin Alone or in Combination with Rutin and LiCl Enhances Liver Regeneration. Cells 2026, 15, 1206. https://doi.org/10.3390/cells15131206
Malick TS, Qazi R-E-M, Ishaque A, Fatima A, Khan I, Faizi S, Salim A, Zaman F. Transplantation of Mesenchymal Stem Cell-Derived Hepatocytes Primed with Quercetin Alone or in Combination with Rutin and LiCl Enhances Liver Regeneration. Cells. 2026; 15(13):1206. https://doi.org/10.3390/cells15131206
Chicago/Turabian StyleMalick, Tuba Shakil, Rida-E-Maria Qazi, Aisha Ishaque, Abiha Fatima, Irfan Khan, Shaheen Faizi, Asmat Salim, and Farasat Zaman. 2026. "Transplantation of Mesenchymal Stem Cell-Derived Hepatocytes Primed with Quercetin Alone or in Combination with Rutin and LiCl Enhances Liver Regeneration" Cells 15, no. 13: 1206. https://doi.org/10.3390/cells15131206
APA StyleMalick, T. S., Qazi, R.-E.-M., Ishaque, A., Fatima, A., Khan, I., Faizi, S., Salim, A., & Zaman, F. (2026). Transplantation of Mesenchymal Stem Cell-Derived Hepatocytes Primed with Quercetin Alone or in Combination with Rutin and LiCl Enhances Liver Regeneration. Cells, 15(13), 1206. https://doi.org/10.3390/cells15131206

