Glycosylated Delphinidins Decrease Chemoresistance to Temozolomide by Regulating NF-κB/MGMT Signaling in Glioblastoma
Abstract
1. Introduction
2. Materials and Methods
2.1. Cells Lines and Delphinidin Stock Preparation
2.2. Viability Assays (MTS)
2.3. Luciferase Rceporter Assays
2.4. Proteome Profiler NF-κB
2.5. Reverse Transcriptase–Quantitative Polymerase Chain Reaction
2.6. Western Blot
2.7. Chromatin Immunoprecipitation
2.8. Apoptosis Assay
2.9. Statistical Analysis
3. Results
3.1. Glycosylated Delphinidins Reduce NF-κB Activity in Glioblastoma Cells
3.2. Glycosylate Delphinidins Reduce the Levels of NF-κB Pathway Proteins That Positively Correlate with MGMT Expression in Glioblastoma In Vitro
3.3. Glycosylated Delphinidins Reduce MGMT Expresion in Glioblastoma Cells
3.4. Glycosylated Delphinidins Negatively Regulate MGMT Promoter Activity in Glioblastoma Cells Through Regulation of the NF-κB Pathway
3.5. Glycosylated Delphinidins Sensitize Glioblastoma Cells to Temozolomide
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Liu, C.A.; Chang, C.Y.; Hsueh, K.W.; Su, H.L.; Chiou, T.W.; Lin, S.Z.; Harn, H.J. Migration/Invasion of Malignant Gliomas and Implications for Therapeutic Treatment. Int. J. Mol. Sci. 2018, 19, 1115. [Google Scholar] [CrossRef] [PubMed]
- Colquhoun, A. Cell biology-metabolic crosstalk in glioma. Int. J. Biochem. Cell Biol. 2017, 89, 171–181. [Google Scholar] [CrossRef] [PubMed]
- Stupp, R.; Mason, W.P.; van den Bent, M.J.; Weller, M.; Fisher, B.; Taphoorn, M.J.; Belanger, K.; Brandes, A.A.; Marosi, C.; Bogdahn, U.; et al. Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. N. Engl. J. Med. 2005, 352, 987–996. [Google Scholar] [CrossRef] [PubMed]
- Chien, C.H.; Hsueh, W.T.; Chuang, J.Y.; Chang, K.Y. Dissecting the mechanism of temozolomide resistance and its association with the regulatory roles of intracellular reactive oxygen species in glioblastoma. J. Biomed. Sci. 2021, 28, 18. [Google Scholar] [CrossRef] [PubMed]
- Stupp, R.; Hegi, M.E.; Mason, W.P.; van den Bent, M.J.; Taphoorn, M.J.; Janzer, R.C.; Ludwin, S.K.; Allgeier, A.; Fisher, B.; Belanger, K.; et al. Effects of radiotherapy with concomitant and adjuvant temozolomide versus radiotherapy alone on survival in glioblastoma in a randomised phase III study: 5-year analysis of the EORTC-NCIC trial. Lancet Oncol. 2009, 10, 459–466. [Google Scholar] [CrossRef]
- Friedman, H.S.; Kerby, T.; Calvert, H. Temozolomide and treatment of malignant glioma. Clin. Cancer Res. 2000, 6, 2585–2597. [Google Scholar]
- Hegi, M.E.; Diserens, A.C.; Gorlia, T.; Hamou, M.F.; de Tribolet, N.; Weller, M.; Kros, J.M.; Hainfellner, J.A.; Mason, W.; Mariani, L.; et al. MGMT gene silencing and benefit from temozolomide in glioblastoma. N. Engl. J. Med. 2005, 352, 997–1003. [Google Scholar] [CrossRef]
- Johannessen, T.C.; Bjerkvig, R. Molecular mechanisms of temozolomide resistance in glioblastoma multiforme. Expert Rev. Anticancer. Ther. 2012, 12, 635–642. [Google Scholar] [CrossRef]
- Cordner, R.; Black, K.L.; Wheeler, C.J. Exploitation of adaptive evolution in glioma treatment. CNS Oncol. 2013, 2, 171–179. [Google Scholar] [CrossRef]
- Lottaz, C.; Beier, D.; Meyer, K.; Kumar, P.; Hermann, A.; Schwarz, J.; Junker, M.; Oefner, P.J.; Bogdahn, U.; Wischhusen, J.; et al. Transcriptional profiles of CD133+ and CD133− glioblastoma-derived cancer stem cell lines suggest different cells of origin. Cancer Res. 2010, 70, 2030–2040. [Google Scholar] [CrossRef]
- Erices, J.I.; Torres, A.; Niechi, I.; Bernales, I.; Quezada, C. Current natural therapies in the treatment against glioblastoma. Phytother. Res. 2018, 32, 2191–2201. [Google Scholar] [CrossRef] [PubMed]
- Cahill, K.E.; Morshed, R.A.; Yamini, B. Nuclear factor-kappaB in glioblastoma: Insights into regulators and targeted therapy. Neuro Oncol. 2016, 18, 329–339. [Google Scholar] [CrossRef] [PubMed]
- Pearson, J.R.D.; Regad, T. Targeting cellular pathways in glioblastoma multiforme. Signal Transduct. Target. Ther. 2017, 2, 17040. [Google Scholar] [CrossRef]
- Caporali, S.; Levati, L.; Graziani, G.; Muzi, A.; Atzori, M.G.; Bonmassar, E.; Palmieri, G.; Ascierto, P.A.; D’Atri, S. NF-kappaB is activated in response to temozolomide in an AKT-dependent manner and confers protection against the growth suppressive effect of the drug. J. Transl. Med. 2012, 10, 252. [Google Scholar] [CrossRef]
- Weaver, K.D.; Yeyeodu, S.; Cusack, J.C., Jr.; Baldwin, A.S., Jr.; Ewend, M.G. Potentiation of chemotherapeutic agents following antagonism of nuclear factor kappa B in human gliomas. J. Neurooncol. 2003, 61, 187–196. [Google Scholar] [CrossRef]
- Lavon, I.; Fuchs, D.; Zrihan, D.; Efroni, G.; Zelikovitch, B.; Fellig, Y.; Siegal, T. Novel mechanism whereby nuclear factor kappaB mediates DNA damage repair through regulation of O(6)-methylguanine-DNA-methyltransferase. Cancer Res. 2007, 67, 8952–8959. [Google Scholar] [CrossRef]
- Yu, Z.; Chen, Y.; Wang, S.; Li, P.; Zhou, G.; Yuan, Y. Inhibition of NF-kappaB results in anti-glioma activity and reduces temozolomide-induced chemoresistance by down-regulating MGMT gene expression. Cancer Lett. 2018, 428, 77–89. [Google Scholar] [CrossRef]
- Masoodi, H.; Villano, D.; Zafrilla, P. A comprehensive review on fruit Aristotelia chilensis (Maqui) for modern health: Towards a better understanding. Food Funct. 2019, 10, 3057–3067. [Google Scholar] [CrossRef]
- Lim, W.; Song, G. Inhibitory effects of delphinidin on the proliferation of ovarian cancer cells via PI3K/AKT and ERK 1/2 MAPK signal transduction. Oncol. Lett. 2017, 14, 810–818. [Google Scholar] [CrossRef]
- Hafeez, B.B.; Siddiqui, I.A.; Asim, M.; Malik, A.; Afaq, F.; Adhami, V.M.; Saleem, M.; Din, M.; Mukhtar, H. A dietary anthocyanidin delphinidin induces apoptosis of human prostate cancer PC3 cells in vitro and in vivo: Involvement of nuclear factor-kappaB signaling. Cancer Res. 2008, 68, 8564–8572. [Google Scholar] [CrossRef]
- Lim, W.C.; Kim, H.; Kim, Y.J.; Park, S.H.; Song, J.H.; Lee, K.H.; Lee, I.H.; Lee, Y.K.; So, K.A.; Choi, K.C.; et al. Delphinidin inhibits BDNF-induced migration and invasion in SKOV3 ovarian cancer cells. Bioorg. Med. Chem. Lett. 2017, 27, 5337–5343. [Google Scholar] [CrossRef] [PubMed]
- Favot, L.; Martin, S.; Keravis, T.; Andriantsitohaina, R.; Lugnier, C. Involvement of cyclin-dependent pathway in the inhibitory effect of delphinidin on angiogenesis. Cardiovasc. Res. 2003, 59, 479–487. [Google Scholar] [CrossRef] [PubMed]
- Feng, R.; Wang, S.Y.; Shi, Y.H.; Fan, J.; Yin, X.M. Delphinidin induces necrosis in hepatocellular carcinoma cells in the presence of 3-methyladenine, an autophagy inhibitor. J. Agric. Food Chem. 2010, 58, 3957–3964. [Google Scholar] [CrossRef] [PubMed]
- Ozbay, T.; Nahta, R. Delphinidin Inhibits HER2 and Erk1/2 Signaling and Suppresses Growth of HER2-Overexpressing and Triple Negative Breast Cancer Cell Lines. Breast Cancer 2011, 5, 143–154. [Google Scholar] [CrossRef]
- Yun, J.M.; Afaq, F.; Khan, N.; Mukhtar, H. Delphinidin, an anthocyanidin in pigmented fruits and vegetables, induces apoptosis and cell cycle arrest in human colon cancer HCT116 cells. Mol. Carcinog. 2009, 48, 260–270. [Google Scholar] [CrossRef]
- Wilson, A.A.; Kwok, L.W.; Porter, E.L.; Payne, J.G.; McElroy, G.S.; Ohle, S.J.; Greenhill, S.R.; Blahna, M.T.; Yamamoto, K.; Jean, J.C.; et al. Lentiviral delivery of RNAi for in vivo lineage-specific modulation of gene expression in mouse lung macrophages. Mol. Ther. 2013, 21, 825–833. [Google Scholar] [CrossRef]
- Carrillo-Beltran, D.; Munoz, J.P.; Guerrero-Vasquez, N.; Blanco, R.; Leon, O.; de Souza Lino, V.; Tapia, J.C.; Maldonado, E.; Dubois-Camacho, K.; Hermoso, M.A.; et al. Human Papillomavirus 16 E7 Promotes EGFR/PI3K/AKT1/NRF2 Signaling Pathway Contributing to PIR/NF-kappaB Activation in Oral Cancer Cells. Cancers 2020, 12, 1904. [Google Scholar] [CrossRef]
- Puliyappadamba, V.T.; Hatanpaa, K.J.; Chakraborty, S.; Habib, A.A. The role of NF-kappaB in the pathogenesis of glioma. Mol. Cell Oncol. 2014, 1, e963478. [Google Scholar] [CrossRef]
- Filipiak, K.; Hidalgo, M.; Silvan, J.M.; Fabre, B.; Carbajo, R.J.; Pineda-Lucena, A.; Ramos, A.; de Pascual-Teresa, B.; de Pascual-Teresa, S. Dietary gallic acid and anthocyanin cytotoxicity on human fibrosarcoma HT1080 cells. A study on the mode of action. Food Funct. 2014, 5, 381–389. [Google Scholar] [CrossRef]
- Mazewski, C.; Kim, M.S.; Gonzalez de Mejia, E. Anthocyanins, delphinidin-3-O-glucoside and cyanidin-3-O-glucoside, inhibit immune checkpoints in human colorectal cancer cells in vitro and in silico. Sci. Rep. 2019, 9, 11560. [Google Scholar] [CrossRef]
- Duraj, T.; Garcia-Romero, N.; Carrion-Navarro, J.; Madurga, R.; Mendivil, A.O.; Prat-Acin, R.; Garcia-Canamaque, L.; Ayuso-Sacido, A. Beyond the Warburg Effect: Oxidative and Glycolytic Phenotypes Coexist within the Metabolic Heterogeneity of Glioblastoma. Cells 2021, 10, 202. [Google Scholar] [CrossRef] [PubMed]
- Wu, X.; Pittman, H.E., 3rd; Prior, R.L. Pelargonidin is absorbed and metabolized differently than cyanidin after marionberry consumption in pigs. J. Nutr. 2004, 134, 2603–2610. [Google Scholar] [CrossRef] [PubMed]
- Wu, X.; Pittman, H.E., 3rd; McKay, S.; Prior, R.L. Aglycones and sugar moieties alter anthocyanin absorption and metabolism after berry consumption in weanling pigs. J. Nutr. 2005, 135, 2417–2424. [Google Scholar] [CrossRef] [PubMed]
- Lee, G.; Na, H.J.; Namkoong, S.; Jeong Kwon, H.; Han, S.; Ha, K.S.; Kwon, Y.G.; Lee, H.; Kim, Y.M. 4-O-methylgallic acid down-regulates endothelial adhesion molecule expression by inhibiting NF-kappaB-DNA-binding activity. Eur. J. Pharmacol. 2006, 551, 143–151. [Google Scholar] [CrossRef]
- Xi, Z.; Hu, X.; Chen, X.; Yang, Y.; Ren, J.; Wang, B.; Zhong, Z.; Sun, Y.; Yang, G.Y.; Sun, Q.; et al. Protocatechuic acid exerts protective effects via suppression of the P38/JNK-NF-kappaB signalling pathway in an experimental mouse model of intracerebral haemorrhage. Eur. J. Pharmacol. 2019, 854, 128–138. [Google Scholar] [CrossRef]
- Soubannier, V.; Stifani, S. NF-kappaB Signalling in Glioblastoma. Biomedicines 2017, 5, 29. [Google Scholar] [CrossRef]
- Husain, A.; Chanana, H.; Khan, S.A.; Dhanalekshmi, U.M.; Ali, M.; Alghamdi, A.A.; Ahmad, A. Chemistry and Pharmacological Actions of Delphinidin, a Dietary Purple Pigment in Anthocyanidin and Anthocyanin Forms. Front. Nutr. 2022, 9, 746881. [Google Scholar] [CrossRef]
- Papa, S.; Zazzeroni, F.; Pham, C.G.; Bubici, C.; Franzoso, G. Linking JNK signaling to NF-kappaB: A key to survival. J. Cell Sci. 2004, 117, 5197–5208. [Google Scholar] [CrossRef]
- Pham, C.G.; Papa, S.; Bubici, C.; Zazzeroni, F.; Franzoso, G. In the Crosshairs: NF-kappaB Targets the JNK Signaling Cascade. Curr. Med. Chem. Anti Inflamm Anti Allergy Agents 2005, 4, 569–576. [Google Scholar] [CrossRef]
- Tian, X.; Traub, B.; Shi, J.; Huber, N.; Schreiner, S.; Chen, G.; Zhou, S.; Henne-Bruns, D.; Knippschild, U.; Kornmann, M. c-Jun N-terminal kinase 2 suppresses pancreatic cancer growth and invasion and is opposed by c-Jun N-terminal kinase 1. Cancer Gene Ther. 2022, 29, 73–86. [Google Scholar] [CrossRef]
- Kitange, G.J.; Carlson, B.L.; Schroeder, M.A.; Grogan, P.T.; Lamont, J.D.; Decker, P.A.; Wu, W.; James, C.D.; Sarkaria, J.N. Induction of MGMT expression is associated with temozolomide resistance in glioblastoma xenografts. Neuro Oncol. 2009, 11, 281–291. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Jia, L.; Jin, X.; Liu, Q.; Cao, W.; Gao, X.; Yang, M.; Sun, B. NF-kappaB inhibitor reverses temozolomide resistance in human glioma TR/U251 cells. Oncol. Lett. 2015, 9, 2586–2590. [Google Scholar] [CrossRef] [PubMed]
- Sharma, A.; Choi, H.K.; Kim, Y.K.; Lee, H.J. Delphinidin and Its Glycosides’ War on Cancer: Preclinical Perspectives. Int. J. Mol. Sci. 2021, 22, 1500. [Google Scholar] [CrossRef] [PubMed]
- Bai, P.; Fan, T.; Wang, X.; Zhao, L.; Zhong, R.; Sun, G. Modulating MGMT expression through interfering with cell signaling pathways. Biochem. Pharmacol. 2023, 215, 115726. [Google Scholar] [CrossRef]
- Guo, Q.; Jin, Y.; Chen, X.; Ye, X.; Shen, X.; Lin, M.; Zeng, C.; Zhou, T.; Zhang, J. NF-kappaB in biology and targeted therapy: New insights and translational implications. Signal Transduct. Target. Ther. 2024, 9, 53. [Google Scholar] [CrossRef]
- Campolo, M.; Lanza, M.; Casili, G.; Paterniti, I.; Filippone, A.; Caffo, M.; Cardali, S.M.; Puliafito, I.; Colarossi, C.; Raciti, G.; et al. TAK1 Inhibitor Enhances the Therapeutic Treatment for Glioblastoma. Cancers 2020, 13, 41. [Google Scholar] [CrossRef]
- Murata, M.; Marugame, Y.; Yamada, S.; Lin, I.; Yamashita, S.; Fujimura, Y.; Tachibana, H. Circulating miRNA profiles in mice plasma following flavonoid intake. Mol. Biol. Rep. 2022, 49, 10399–10407. [Google Scholar] [CrossRef]
- Chakrabarti, M.; Ray, S.K. Direct transfection of miR-137 mimics is more effective than DNA demethylation of miR-137 promoter to augment anti-tumor mechanisms of delphinidin in human glioblastoma U87MG and LN18 cells. Gene 2015, 573, 141–152. [Google Scholar] [CrossRef]
Primer | Forward 5′-3′ | Reverse 5′-3′ |
---|---|---|
CHIP MGMT | AGGACCGGGATTCTCACTAA | AGCCGACCTGAGAAA |
MGMT | GCAATTAGCAGCCCTGGCA | CACTCTGTGGCACGGGA |
β-Actin | GAGCACAGAGCCTCGCCTTT | CACGATGGAGGGGAAGAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Carrillo-Beltrán, D.; Nahuelpan, Y.; Cuevas, C.; Fabres, K.; Silva, P.; Zubieta, J.; Navarro, G.; Muñoz, J.P.; Gleisner, M.A.; Salazar-Onfray, F.; et al. Glycosylated Delphinidins Decrease Chemoresistance to Temozolomide by Regulating NF-κB/MGMT Signaling in Glioblastoma. Cells 2025, 14, 179. https://doi.org/10.3390/cells14030179
Carrillo-Beltrán D, Nahuelpan Y, Cuevas C, Fabres K, Silva P, Zubieta J, Navarro G, Muñoz JP, Gleisner MA, Salazar-Onfray F, et al. Glycosylated Delphinidins Decrease Chemoresistance to Temozolomide by Regulating NF-κB/MGMT Signaling in Glioblastoma. Cells. 2025; 14(3):179. https://doi.org/10.3390/cells14030179
Chicago/Turabian StyleCarrillo-Beltrán, Diego, Yessica Nahuelpan, Constanza Cuevas, Karen Fabres, Pamela Silva, Jimena Zubieta, Giovanna Navarro, Juan P. Muñoz, María A. Gleisner, Flavio Salazar-Onfray, and et al. 2025. "Glycosylated Delphinidins Decrease Chemoresistance to Temozolomide by Regulating NF-κB/MGMT Signaling in Glioblastoma" Cells 14, no. 3: 179. https://doi.org/10.3390/cells14030179
APA StyleCarrillo-Beltrán, D., Nahuelpan, Y., Cuevas, C., Fabres, K., Silva, P., Zubieta, J., Navarro, G., Muñoz, J. P., Gleisner, M. A., Salazar-Onfray, F., Garcia-Romero, N., Ayuso-Sacido, A., Martin, R. S., & Quezada-Monrás, C. (2025). Glycosylated Delphinidins Decrease Chemoresistance to Temozolomide by Regulating NF-κB/MGMT Signaling in Glioblastoma. Cells, 14(3), 179. https://doi.org/10.3390/cells14030179