miR-223 and Chromogranin A Affect Inflammatory Immune Cell Activation in Liver Metastasis of Neuroendocrine Neoplasms
Abstract
:1. Introduction
2. Materials and Methods
2.1. Patient Cohort
2.2. Blood Flow Cytometry Preparation
2.3. Fam-Flica Caspase 1 Activity Assay/CgA
2.4. Microscopy and Microdissection
2.5. Immunofluorescence Microscopy
2.6. RoboPALM/Microdissection
2.7. Cell Culture and Transfection
2.8. BrdU
2.9. Primary Cell Isolation
2.10. qPCR miRNA and Regular SYBR Green
2.11. Western Blotting
2.12. Sequencing and Correlation of Inflammatory/NEN Marker Expression
2.13. Statistical Analysis
3. Results
3.1. Serum miR-223 Expression Correlates with Circulating Neutrophil Markers in NEN
3.2. Knockdown of miR-223 Promotes Expression of NEN Differentiation Markers
3.3. Alpha-2-Antiplasmin Reverts miR-223 Induced Phenotype in NEN Cells
3.4. Neutrophils Are Activated Following Stimulation with BON Supernatant (SN)
3.5. Co-Culture of miR-223 Knockdown in BON Induces Increased Tumor Cell Clearance by Neutrophils
3.6. Sequencing Data of G1-G3 NEN Indicate Correlations Between Inflammatory and Functional Genes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Rindi, G.; Mete, O.; Uccella, S.; Basturk, O.; La Rosa, S.; Brosens, L.A.A.; Ezzat, S.; de Herder, W.W.; Klimstra, D.S.; Papotti, M.; et al. Overview of the 2022 WHO Classification of Neuroendocrine Neoplasms. Endocr. Pathol. 2022, 33, 115–154. [Google Scholar] [CrossRef]
- Rickman, D.S.; Beltran, H.; Demichelis, F.; Rubin, M.A. Biology and evolution of poorly differentiated neuroendocrine tumors. Nat. Med. 2017, 23, 1–10. [Google Scholar] [CrossRef]
- Hofland, J.; Kaltsas, G.; de Herder, W.W. Advances in the Diagnosis and Management of Well-Differentiated Neuroendocrine Neoplasms. Endocr. Rev. 2020, 41, 371–403. [Google Scholar] [CrossRef] [PubMed]
- Sorbye, H.; Welin, S.; Langer, S.W.; Vestermark, L.W.; Holt, N.; Osterlund, P.; Dueland, S.; Hofsli, E.; Guren, M.G.; Ohrling, K.; et al. Predictive and prognostic factors for treatment and survival in 305 patients with advanced gastrointestinal neuroendocrine carcinoma (WHO G3): The NORDIC NEC study. Ann. Oncol. 2013, 24, 152–160. [Google Scholar] [CrossRef] [PubMed]
- Kawasaki, K.; Rekhtman, N.; Quintanal-Villalonga, A.; Rudin, C.M. Neuroendocrine neoplasms of the lung and gastrointestinal system: Convergent biology and a path to better therapies. Nat. Rev. Clin. Oncol. 2023, 20, 16–32. [Google Scholar] [CrossRef]
- Marotta, V.; Zatelli, M.C.; Sciammarella, C.; Ambrosio, M.R.; Bondanelli, M.; Colao, A.; Faggiano, A. Chromogranin A as circulating marker for diagnosis and management of neuroendocrine neoplasms: More flaws than fame. Endocr. Relat. Cancer 2018, 25, R11–R29. [Google Scholar] [CrossRef]
- Massironi, S.; Fraquelli, M.; Paggi, S.; Sangiovanni, A.; Conte, D.; Sciola, V.; Ciafardini, C.; Colombo, M.; Peracchi, M. Chromogranin A levels in chronic liver disease and hepatocellular carcinoma. Dig. Liver Dis. 2009, 41, 31–35. [Google Scholar] [CrossRef]
- Peracchi, M.; Gebbia, C.; Basilisco, G.; Quatrini, M.; Tarantino, C.; Vescarelli, C.; Massironi, S.; Conte, D. Plasma chromogranin A in patients with autoimmune chronic atrophic gastritis, enterochromaffin-like cell lesions and gastric carcinoids. Eur. J. Endocrinol. 2005, 152, 443–448. [Google Scholar] [CrossRef]
- Massironi, S.; Zilli, A.; Cavalcoli, F.; Conte, D.; Peracchi, M. Chromogranin A and other enteroendocrine markers in inflammatory bowel disease. Neuropeptides 2016, 58, 127–134. [Google Scholar] [CrossRef]
- Khan, W.I.; Ghia, J.E. Gut hormones: Emerging role in immune activation and inflammation. Clin. Exp. Immunol. 2010, 161, 19–27. [Google Scholar] [CrossRef]
- D’Amico, M.A.; Ghinassi, B.; Izzicupo, P.; Manzoli, L.; Di Baldassarre, A. Biological function and clinical relevance of chromogranin A and derived peptides. Endocr. Connect. 2014, 3, R45–R54. [Google Scholar] [CrossRef] [PubMed]
- Zhang, D.; Shooshtarizadeh, P.; Laventie, B.J.; Colin, D.A.; Chich, J.F.; Vidic, J.; de Barry, J.; Chasserot-Golaz, S.; Delalande, F.; Van Dorsselaer, A.; et al. Two chromogranin a-derived peptides induce calcium entry in human neutrophils by calmodulin-regulated calcium independent phospholipase A2. PLoS ONE 2009, 4, e4501. [Google Scholar] [CrossRef]
- Werner, L.E.; Wagner, U. Calcium-sensing receptor-mediated NLRP3 inflammasome activation in rheumatoid arthritis and autoinflammation. Front. Physiol. 2022, 13, 1078569. [Google Scholar] [CrossRef]
- Milione, M.; Maisonneuve, P.; Spada, F.; Pellegrinelli, A.; Spaggiari, P.; Albarello, L.; Pisa, E.; Barberis, M.; Vanoli, A.; Buzzoni, R.; et al. The Clinicopathologic Heterogeneity of Grade 3 Gastroenteropancreatic Neuroendocrine Neoplasms: Morphological Differentiation and Proliferation Identify Different Prognostic Categories. Neuroendocrinology 2017, 104, 85–93. [Google Scholar] [CrossRef]
- Panzuto, F.; Lamarca, A.; Fazio, N. Comparative analysis of international guidelines on the management of advanced non-functioning well-differentiated pancreatic neuroendocrine tumors. Cancer Treat. Rev. 2024, 129, 102803. [Google Scholar] [CrossRef]
- Scoazec, J.Y. Angiogenesis in neuroendocrine tumors: Therapeutic applications. Neuroendocrinology 2013, 97, 45–56. [Google Scholar] [CrossRef]
- De Palma, M.; Biziato, D.; Petrova, T.V. Microenvironmental regulation of tumour angiogenesis. Nat. Rev. Cancer 2017, 17, 457–474. [Google Scholar] [CrossRef]
- Katz, S.C.; Donkor, C.; Glasgow, K.; Pillarisetty, V.G.; Gonen, M.; Espat, N.J.; Klimstra, D.S.; D’Angelica, M.I.; Allen, P.J.; Jarnagin, W.; et al. T cell infiltrate and outcome following resection of intermediate-grade primary neuroendocrine tumours and liver metastases. HPB 2010, 12, 674–683. [Google Scholar] [CrossRef] [PubMed]
- Busse, A.; Mochmann, L.H.; Spenke, C.; Arsenic, R.; Briest, F.; Johrens, K.; Lammert, H.; Sipos, B.; Kuhl, A.A.; Wirtz, R.; et al. Immunoprofiling in Neuroendocrine Neoplasms Unveil Immunosuppressive Microenvironment. Cancers 2020, 12, 3448. [Google Scholar] [CrossRef]
- Milione, M.; Miceli, R.; Barretta, F.; Pellegrinelli, A.; Spaggiari, P.; Tagliabue, G.; Centonze, G.; Paolino, C.; Mangogna, A.; Kankava, K.; et al. Microenvironment and tumor inflammatory features improve prognostic prediction in gastro-entero-pancreatic neuroendocrine neoplasms. J. Pathol. Clin. Res. 2019, 5, 217–226. [Google Scholar] [CrossRef] [PubMed]
- Cai, L.; Michelakos, T.; Deshpande, V.; Arora, K.S.; Yamada, T.; Ting, D.T.; Taylor, M.S.; Castillo, C.F.; Warshaw, A.L.; Lillemoe, K.D.; et al. Role of Tumor-Associated Macrophages in the Clinical Course of Pancreatic Neuroendocrine Tumors (PanNETs). Clin. Cancer Res. 2019, 25, 2644–2655. [Google Scholar] [CrossRef]
- Ozdirik, B.; Stueven, A.K.; Mohr, R.; Geisler, L.; Wree, A.; Knorr, J.; Demir, M.; Vucur, M.; Loosen, S.H.; Benz, F.; et al. Analysis of miR-29 Serum Levels in Patients with Neuroendocrine Tumors-Results from an Exploratory Study. J. Clin. Med. 2020, 9. [Google Scholar] [CrossRef] [PubMed]
- Hellberg, T.; Mohr, R.; Geisler, L.; Knorr, J.; Wree, A.; Demir, M.; Benz, F.; Lambrecht, J.; Loosen, S.H.; Tacke, F.; et al. Serum levels of miR-223 but not miR-21 are decreased in patients with neuroendocrine tumors. PLoS ONE 2020, 15, e0244504. [Google Scholar] [CrossRef] [PubMed]
- Geisler, L.; Mohr, R.; Lambrecht, J.; Knorr, J.; Jann, H.; Loosen, S.H.; Ozdirik, B.; Luedde, T.; Hammerich, L.; Tacke, F.; et al. The Role of miRNA in the Pathophysiology of Neuroendocrine Tumors. Int. J. Mol. Sci. 2021, 22, 8569. [Google Scholar] [CrossRef]
- Gu, J.; Xu, H.; Chen, Y.; Li, N.; Hou, X. MiR-223 as a Regulator and Therapeutic Target in Liver Diseases. Front. Immunol. 2022, 13, 860661. [Google Scholar] [CrossRef]
- Aziz, F.; Chakraborty, A.; Khan, I.; Monts, J. Relevance of miR-223 as Potential Diagnostic and Prognostic Markers in Cancer. Biology 2022, 11, 249. [Google Scholar] [CrossRef]
- Xu, Y.; Sengupta, T.; Kukreja, L.; Minella, A.C. MicroRNA-223 regulates cyclin E activity by modulating expression of F-box and WD-40 domain protein 7. J. Biol. Chem. 2010, 285, 34439–34446. [Google Scholar] [CrossRef] [PubMed]
- Jia, C.Y.; Li, H.H.; Zhu, X.C.; Dong, Y.W.; Fu, D.; Zhao, Q.L.; Wu, W.; Wu, X.Z. MiR-223 suppresses cell proliferation by targeting IGF-1R. PLoS ONE 2011, 6, e27008. [Google Scholar] [CrossRef]
- Pulikkan, J.A.; Dengler, V.; Peramangalam, P.S.; Peer Zada, A.A.; Muller-Tidow, C.; Bohlander, S.K.; Tenen, D.G.; Behre, G. Cell-cycle regulator E2F1 and microRNA-223 comprise an autoregulatory negative feedback loop in acute myeloid leukemia. Blood 2010, 115, 1768–1778. [Google Scholar] [CrossRef] [PubMed]
- He, Y.; Hwang, S.; Cai, Y.; Kim, S.J.; Xu, M.; Yang, D.; Guillot, A.; Feng, D.; Seo, W.; Hou, X.; et al. MicroRNA-223 Ameliorates Nonalcoholic Steatohepatitis and Cancer by Targeting Multiple Inflammatory and Oncogenic Genes in Hepatocytes. Hepatology 2019, 70, 1150–1167. [Google Scholar] [CrossRef] [PubMed]
- Favero, A.; Segatto, I.; Perin, T.; Belletti, B. The many facets of miR-223 in cancer: Oncosuppressor, oncogenic driver, therapeutic target, and biomarker of response. Wiley Interdiscip. Rev. RNA 2021, 12, e1659. [Google Scholar] [CrossRef] [PubMed]
- Haneklaus, M.; Gerlic, M.; O’Neill, L.A.; Masters, S.L. miR-223: Infection, inflammation and cancer. J. Intern. Med. 2013, 274, 215–226. [Google Scholar] [CrossRef]
- Boxberger, N.; Hecker, M.; Zettl, U.K. Dysregulation of Inflammasome Priming and Activation by MicroRNAs in Human Immune-Mediated Diseases. J. Immunol. 2019, 202, 2177–2187. [Google Scholar] [CrossRef] [PubMed]
- Feng, Z.; Qi, S.; Zhang, Y.; Qi, Z.; Yan, L.; Zhou, J.; He, F.; Li, Q.; Yang, Y.; Chen, Q.; et al. Ly6G+ neutrophil-derived miR-223 inhibits the NLRP3 inflammasome in mitochondrial DAMP-induced acute lung injury. Cell Death Dis. 2017, 8, e3170. [Google Scholar] [CrossRef]
- Johnnidis, J.B.; Harris, M.H.; Wheeler, R.T.; Stehling-Sun, S.; Lam, M.H.; Kirak, O.; Brummelkamp, T.R.; Fleming, M.D.; Camargo, F.D. Regulation of progenitor cell proliferation and granulocyte function by microRNA-223. Nature 2008, 451, 1125–1129. [Google Scholar] [CrossRef] [PubMed]
- Calvente, C.J.; Tameda, M.; Johnson, C.D.; Del Pilar, H.; Lin, Y.C.; Adronikou, N.; De Mollerat Du Jeu, X.; Llorente, C.; Boyer, J.; Feldstein, A.E. Neutrophils contribute to spontaneous resolution of liver inflammation and fibrosis via microRNA-223. J. Clin. Invest. 2019, 129, 4091–4109. [Google Scholar] [CrossRef] [PubMed]
- Guo, H.; Callaway, J.B.; Ting, J.P. Inflammasomes: Mechanism of action, role in disease, and therapeutics. Nat. Med. 2015, 21, 677–687. [Google Scholar] [CrossRef] [PubMed]
- Yu, P.; Zhang, X.; Liu, N.; Tang, L.; Peng, C.; Chen, X. Pyroptosis: Mechanisms and diseases. Signal Transduct. Target. Ther. 2021, 6, 128. [Google Scholar] [CrossRef] [PubMed]
- Zhong, Z.; Umemura, A.; Sanchez-Lopez, E.; Liang, S.; Shalapour, S.; Wong, J.; He, F.; Boassa, D.; Perkins, G.; Ali, S.R.; et al. NF-kappaB Restricts Inflammasome Activation via Elimination of Damaged Mitochondria. Cell 2016, 164, 896–910. [Google Scholar] [CrossRef] [PubMed]
- Gurung, P.; Li, B.; Subbarao Malireddi, R.K.; Lamkanfi, M.; Geiger, T.L.; Kanneganti, T.D. Chronic TLR Stimulation Controls NLRP3 Inflammasome Activation through IL-10 Mediated Regulation of NLRP3 Expression and Caspase-8 Activation. Sci. Rep. 2015, 5, 14488. [Google Scholar] [CrossRef]
- Zhou, X.; Tao, Y.; Shi, Y. Unraveling the NLRP family: Structure, function, activation, critical influence on tumor progression, and potential as targets for cancer therapy. Cancer Lett. 2024, 605, 217283. [Google Scholar] [CrossRef]
- Zaki, M.H.; Vogel, P.; Body-Malapel, M.; Lamkanfi, M.; Kanneganti, T.D. IL-18 production downstream of the Nlrp3 inflammasome confers protection against colorectal tumor formation. J. Immunol. 2010, 185, 4912–4920. [Google Scholar] [CrossRef] [PubMed]
- Guo, L.; Yang, Y.; Sheng, Y.; Wang, J.; Li, W.; Zhou, X.; Ruan, S.; Han, C. Galloflavin Relieves the Malignant Behavior of Colorectal Cancer Cells in the Inflammatory Tumor Microenvironment. Front. Pharmacol. 2021, 12, 752118. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.; Xu, W.; Zhou, R. NLRP3 inflammasome activation and cell death. Cell Mol. Immunol. 2021, 18, 2114–2127. [Google Scholar] [CrossRef] [PubMed]
- Geisler, L.; Hellberg, T.; Lambrecht, J.; Jann, H.; Knorr, J.; Eschrich, J.; Loosen, S.H.; Wree, A.; Hammerich, L.; Krieg, A.; et al. Inflammatory Cytokines Associated with Diagnosis, Tumor Grade and Prognosis in Patients with Neuroendocrine Tumors. J. Clin. Med. 2022, 11, 6191. [Google Scholar] [CrossRef]
- Beilharz, M.; De Nardo, D.; Latz, E.; Franklin, B.S. Measuring NLR Oligomerization II: Detection of ASC Speck Formation by Confocal Microscopy and Immunofluorescence. Methods Mol. Biol. 2016, 1417, 145–158. [Google Scholar] [PubMed]
- Otto, R.; Detjen, K.M.; Riemer, P.; Fattohi, M.; Grotzinger, C.; Rindi, G.; Wiedenmann, B.; Sers, C.; Leser, U. Transcriptomic Deconvolution of Neuroendocrine Neoplasms Predicts Clinically Relevant Characteristics. Cancers 2023, 15, 936. [Google Scholar] [CrossRef] [PubMed]
- Shirasawa, M.; Yoshida, T.; Horinouchi, H.; Kitano, S.; Arakawa, S.; Matsumoto, Y.; Shinno, Y.; Okuma, Y.; Goto, Y.; Kanda, S.; et al. Prognostic impact of peripheral blood neutrophil to lymphocyte ratio in advanced-stage pulmonary large cell neuroendocrine carcinoma and its association with the immune-related tumour microenvironment. Br. J. Cancer 2021, 124, 925–932. [Google Scholar] [CrossRef] [PubMed]
- Ndlovu, L.N.; Peetluk, L.; Moodley, S.; Nhamoyebonde, S.; Ngoepe, A.T.; Mazibuko, M.; Khan, K.; Karim, F.; Pym, A.S.; Maruri, F.; et al. Increased Neutrophil Count and Decreased Neutrophil CD15 Expression Correlate with TB Disease Severity and Treatment Response Irrespective of HIV Co-infection. Front. Immunol. 2020, 11, 1872. [Google Scholar] [CrossRef]
- Wang, Z.; Yang, C.; Li, L.; Jin, X.; Zhang, Z.; Zheng, H.; Pan, J.; Shi, L.; Jiang, Z.; Su, K.; et al. Tumor-derived HMGB1 induces CD62L(dim) neutrophil polarization and promotes lung metastasis in triple-negative breast cancer. Oncogenesis 2020, 9, 82. [Google Scholar] [CrossRef]
- Peng, Z.; Liu, C.; Victor, A.R.; Cao, D.Y.; Veiras, L.C.; Bernstein, E.A.; Khan, Z.; Giani, J.F.; Cui, X.; Bernstein, K.E.; et al. Tumors exploit CXCR4(hi)CD62L(lo) aged neutrophils to facilitate metastatic spread. Oncoimmunology 2021, 10, 1870811. [Google Scholar] [CrossRef]
- Kakar, S.; Muir, T.; Murphy, L.M.; Lloyd, R.V.; Burgart, L.J. Immunoreactivity of Hep Par 1 in hepatic and extrahepatic tumors and its correlation with albumin in situ hybridization in hepatocellular carcinoma. Am. J. Clin. Pathol. 2003, 119, 361–366. [Google Scholar] [CrossRef]
- Barbagallo, D.; Ponti, D.; Bassani, B.; Bruno, A.; Pulze, L.; Akkihal, S.A.; George-William, J.N.; Gundamaraju, R.; Campomenosi, P. MiR-223-3p in Cancer Development and Cancer Drug Resistance: Same Coin, Different Faces. Int. J. Mol. Sci. 2024, 25, 8191. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; He, Y.; Zhou, Z.; Ramirez, T.; Gao, Y.; Gao, Y.; Ross, R.A.; Cao, H.; Cai, Y.; Xu, M.; et al. MicroRNA-223 ameliorates alcoholic liver injury by inhibiting the IL-6-p47(phox)-oxidative stress pathway in neutrophils. Gut 2017, 66, 705–715. [Google Scholar] [CrossRef] [PubMed]
- Parekh, D.; Ishizuka, J.; Townsend, C.M., Jr.; Haber, B.; Beauchamp, R.D.; Karp, G.; Kim, S.W.; Rajaraman, S.; Greeley, G., Jr.; Thompson, J.C. Characterization of a human pancreatic carcinoid in vitro: Morphology, amine and peptide storage, and secretion. Pancreas 1994, 9, 83–90. [Google Scholar] [CrossRef] [PubMed]
- Zaytouni, T.; Tsai, P.Y.; Hitchcock, D.S.; DuBois, C.D.; Freinkman, E.; Lin, L.; Morales-Oyarvide, V.; Lenehan, P.J.; Wolpin, B.M.; Mino-Kenudson, M.; et al. Critical role for arginase 2 in obesity-associated pancreatic cancer. Nat. Commun. 2017, 8, 242. [Google Scholar] [CrossRef]
- Burke, S.J.; Stadler, K.; Lu, D.; Gleason, E.; Han, A.; Donohoe, D.R.; Rogers, R.C.; Hermann, G.E.; Karlstad, M.D.; Collier, J.J. IL-1beta reciprocally regulates chemokine and insulin secretion in pancreatic beta-cells via NF-kappaB. Am. J. Physiol. Endocrinol. Metab. 2015, 309, E715–E726. [Google Scholar] [CrossRef]
- Herremans, K.M.; Szymkiewicz, D.D.; Riner, A.N.; Bohan, R.P.; Tushoski, G.W.; Davidson, A.M.; Lou, X.; Leong, M.C.; Dean, B.D.; Gerber, M.; et al. The interleukin-1 axis and the tumor immune microenvironment in pancreatic ductal adenocarcinoma. Neoplasia 2022, 28, 100789. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Q.; Taupenot, L.; Mahata, S.K.; Mahata, M.; O’Connor, D.T.; Miles, L.A.; Parmer, R.J. Proteolytic cleavage of chromogranin A (CgA) by plasmin. Selective liberation of a specific bioactive CgA fragment that regulates catecholamine release. J. Biol. Chem. 2001, 276, 25022–25029. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Q.; Yasothornsrikul, S.; Taupenot, L.; Miles, L.A.; Parmer, R.J. The local chromaffin cell plasminogen/plasmin system and the regulation of catecholamine secretion. Ann. N. Y. Acad. Sci. 2002, 971, 445–449. [Google Scholar] [CrossRef] [PubMed]
- Parmer, R.J.; Gong, Y.; Yoo, S.H.; Miles, L.A. Neuroendocrine Targeting of Tissue Plasminogen Activator (t-PA). J. Neurol. Disord. Stroke 2020, 7, 1153. [Google Scholar]
- Elias, S.; Delestre, C.; Ory, S.; Marais, S.; Courel, M.; Vazquez-Martinez, R.; Bernard, S.; Coquet, L.; Malagon, M.M.; Driouich, A.; et al. Chromogranin A induces the biogenesis of granules with calcium- and actin-dependent dynamics and exocytosis in constitutively secreting cells. Endocrinology 2012, 153, 4444–4456. [Google Scholar] [CrossRef] [PubMed]
- Courel, M.; Rodemer, C.; Nguyen, S.T.; Pance, A.; Jackson, A.P.; O’Connor, D.T.; Taupenot, L. Secretory granule biogenesis in sympathoadrenal cells: Identification of a granulogenic determinant in the secretory prohormone chromogranin A. J. Biol. Chem. 2006, 281, 38038–38051. [Google Scholar] [CrossRef] [PubMed]
- Cao, H.; Xiang, Y.; Zhang, S.; Chao, Y.; Guo, J.; Aurich, T.; Ho, J.W.; Huang, Y.; Liu, P.; Sugimura, R. PD-L1 regulates inflammatory programs of macrophages from human pluripotent stem cells. Life Sci. Alliance 2024, 7, e202302461. [Google Scholar] [CrossRef]
- Antonangeli, F.; Natalini, A.; Garassino, M.C.; Sica, A.; Santoni, A.; Di Rosa, F. Regulation of PD-L1 Expression by NF-kappaB in Cancer. Front. Immunol. 2020, 11, 584626. [Google Scholar] [CrossRef] [PubMed]
- Zhou, M.; Barkema, H.W.; Gao, J.; Yang, J.; Wang, Y.; Kastelic, J.P.; Khan, S.; Liu, G.; Han, B. MicroRNA miR-223 modulates NLRP3 and Keap1, mitigating lipopolysaccharide-induced inflammation and oxidative stress in bovine mammary epithelial cells and murine mammary glands. Vet. Res. 2023, 54, 78. [Google Scholar] [CrossRef] [PubMed]
- Jimenez Calvente, C.; Del Pilar, H.; Tameda, M.; Johnson, C.D.; Feldstein, A.E. MicroRNA 223 3p Negatively Regulates the NLRP3 Inflammasome in Acute and Chronic Liver Injury. Mol. Ther. 2020, 28, 653–663. [Google Scholar] [CrossRef] [PubMed]
- Giannetta, E.; La Salvia, A.; Rizza, L.; Muscogiuri, G.; Campione, S.; Pozza, C.; Colao, A.A.L.; Faggiano, A. Are Markers of Systemic Inflammatory Response Useful in the Management of Patients With Neuroendocrine Neoplasms? Front. Endocrinol. 2021, 12, 672499. [Google Scholar] [CrossRef]
- Cigrovski Berkovic, M.; Cacev, T.; Catela Ivkovic, T.; Zjacic-Rotkvic, V.; Kapitanovic, S. New insights into the role of chronic inflammation and cytokines in the etiopathogenesis of gastroenteropancreatic neuroendocrine tumors. Neuroendocrinology 2014, 99, 75–84. [Google Scholar] [CrossRef]
- Vitale, G.; Carra, S.; Ferrau, F.; Guadagno, E.; Faggiano, A.; Colao, A. Nike Gastroenteropancreatic neuroendocrine neoplasms and inflammation: A complex cross-talk with relevant clinical implications. Crit. Rev. Oncol. Hematol. 2020, 146, 102840. [Google Scholar] [CrossRef] [PubMed]
- Du, T.; Wang, D.; Wan, X.; Xu, J.; Xiao, Q.; Liu, B. Regulatory effect of microRNA-223-3p on breast cancer cell processes via the Hippo/Yap signaling pathway. Oncol. Lett. 2021, 22, 516. [Google Scholar] [CrossRef]
- Kuo, K.T.; Lin, C.H.; Wang, C.H.; Pikatan, N.W.; Yadav, V.K.; Fong, I.H.; Yeh, C.T.; Lee, W.H.; Huang, W.C. HNMT Upregulation Induces Cancer Stem Cell Formation and Confers Protection against Oxidative Stress through Interaction with HER2 in Non-Small-Cell Lung Cancer. Int. J. Mol. Sci. 2022, 23. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Yu, H.; Li, J.; Fan, J.; Chen, J. 2-Methoxyestradiol combined with ascorbic acid facilitates the apoptosis of chronic myeloid leukemia cells via the microRNA-223/Fms-like tyrosine kinase 3/phosphatidylinositol-3 kinase/protein kinase B axis. Bioengineered 2022, 13, 3470–3485. [Google Scholar] [CrossRef] [PubMed]
- Kesavardhana, S.; Kanneganti, T.D. Mechanisms governing inflammasome activation, assembly and pyroptosis induction. Int. Immunol. 2017, 29, 201–210. [Google Scholar] [CrossRef]
- Lai, T.Y.; Chiang, T.C.; Lee, C.Y.; Kuo, T.C.; Wu, C.H.; Chen, Y.I.; Hu, C.M.; Maskey, M.; Tang, S.C.; Jeng, Y.M.; et al. Unraveling the impact of cancer-associated fibroblasts on hypovascular pancreatic neuroendocrine tumors. Br. J. Cancer 2024, 130, 1096–1108. [Google Scholar] [CrossRef] [PubMed]
- Ye, Z.; Zhou, Y.; Hu, Y.; Li, Q.; Xu, Z.; Lou, X.; Zhang, W.; Zhu, D.; Xie, C.; Zhou, Q.; et al. Single-cell sequencing reveals the heterogeneity of pancreatic neuroendocrine tumors under genomic instability and histological grading. iScience 2024, 27, 110836. [Google Scholar] [CrossRef]
- He, Y.; Dossing, K.B.V.; Rossing, M.; Bagger, F.O.; Kjaer, A. uPAR (PLAUR) Marks Two Intra-Tumoral Subtypes of Glioblastoma: Insights from Single-Cell RNA Sequencing. Int. J. Mol. Sci. 2024, 25, 1998. [Google Scholar] [CrossRef] [PubMed]
- Pan, B.; Yan, S.; Yuan, L.; Xiang, H.; Ju, M.; Xu, S.; Jia, W.; Li, J.; Zhao, Q.; Zheng, M. Multiomics sequencing and immune microenvironment characteristics define three subtypes of small cell neuroendocrine carcinoma of the cervix. J. Pathol. 2024, 263, 372–385. [Google Scholar] [CrossRef] [PubMed]
- Centonze, G.; Lagano, V.; Sabella, G.; Mangogna, A.; Garzone, G.; Filugelli, M.; Belmonte, B.; Cattaneo, L.; Crisafulli, V.; Pellegrinelli, A.; et al. Myeloid and T-Cell Microenvironment Immune Features Identify Two Prognostic Sub-Groups in High-Grade Gastroenteropancreatic Neuroendocrine Neoplasms. J. Clin. Med. 2021, 10, 1741. [Google Scholar] [CrossRef]
- Annunziato, F.; Cosmi, L.; Liotta, F.; Maggi, E.; Romagnani, S. Human Th1 dichotomy: Origin, phenotype and biologic activities. Immunology 2014, 144, 343–351. [Google Scholar] [CrossRef]
Antigen | Fluorophore | Manufacturer Prod. Nr. |
---|---|---|
CD3 | SV538 | Biolegend 300483 |
CD4 | SV480 | BD 746541 |
CD8 | BB515 | BD 564526 |
CD11b | V450 | BD 560455 |
CD11c | AF700 | Biolegend 337220 |
CD14 | PerCPCy5.5 | Biolegend 301824 |
CD19 | PECy5 | Biolegend 302210 |
CD25 | APC/fire | Biolegend 356150 |
CD45 | AF532 | Ebioscience 58-0459-42 |
HLA-DR | BV570 | Biolegend 307638 |
PD-L1 | BV650 | Biolegend 329740 |
S100A9 | FITC | Biolegend 350703 |
CD15 | PE/Cy7 | Biolegend 30192325 |
CD16 | V500 | Biolegend |
CD62L | PE | Biolegend 385103 |
CD63 | APC | Biolegend 353007 |
CD66b | PacBlue | Biolegend 305112 |
Forward | Reverse | |
---|---|---|
Gapdh | TTGGCTACAGCAACAGGGTG | GGGGAGATTCAGTGTGGTGG |
Arg 2 | GGGCCCTGAAGGCTGTAG- | AATGGAGCCACTGCC |
IL1β | GGCCCTAAACAGATGAAGTGCTC | CCAGCATCTTCCTCAGCTTGTC |
IL10 | GGTTGCCAAGCCTTGTCTGAG | GATGACAGCGCCGTAGCC |
CgA | AGAGAGGATTCCAAGGAGGC | TGATTGTTCCCCTCAGCCTTG |
CgB | ATGAAGGAATGGTGACTCGC | CAGTTGTCTCTTTGTCTTTGACG |
Syn | TCG GCTTTGTGAAGGTGCTGC | TCACTCTCGGTCTTGTTGGCAC |
PLAUR | GGTGACGCCTTCAGCATGA | CCCACTGCGGTACTGGACAT |
S100A12 | CACATTCCTGTGCATTGAGG | GGTGTCAAAATGCCCCTTC |
TNFa | CTGTAGCCCATGTTGTAGCAAACC | TGGCCCTTGAAGAGGACCTG |
NSE | AGCCTCTACGGGCATCTATGA | TTCTCAGTCCCATCCAACTCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Geisler, L.; Detjen, K.; Hellberg, T.; Kohlhepp, M.; Grötzinger, C.; Knorr, J.; Eichhorn, I.; Mohr, R.; Holtmann, T.; Wiedenmann, B.; et al. miR-223 and Chromogranin A Affect Inflammatory Immune Cell Activation in Liver Metastasis of Neuroendocrine Neoplasms. Cells 2025, 14, 111. https://doi.org/10.3390/cells14020111
Geisler L, Detjen K, Hellberg T, Kohlhepp M, Grötzinger C, Knorr J, Eichhorn I, Mohr R, Holtmann T, Wiedenmann B, et al. miR-223 and Chromogranin A Affect Inflammatory Immune Cell Activation in Liver Metastasis of Neuroendocrine Neoplasms. Cells. 2025; 14(2):111. https://doi.org/10.3390/cells14020111
Chicago/Turabian StyleGeisler, Lukas, Katharina Detjen, Teresa Hellberg, Marlene Kohlhepp, Carsten Grötzinger, Jana Knorr, Ines Eichhorn, Raphael Mohr, Theresa Holtmann, Bertram Wiedenmann, and et al. 2025. "miR-223 and Chromogranin A Affect Inflammatory Immune Cell Activation in Liver Metastasis of Neuroendocrine Neoplasms" Cells 14, no. 2: 111. https://doi.org/10.3390/cells14020111
APA StyleGeisler, L., Detjen, K., Hellberg, T., Kohlhepp, M., Grötzinger, C., Knorr, J., Eichhorn, I., Mohr, R., Holtmann, T., Wiedenmann, B., Tacke, F., Roderburg, C., & Wree, A. (2025). miR-223 and Chromogranin A Affect Inflammatory Immune Cell Activation in Liver Metastasis of Neuroendocrine Neoplasms. Cells, 14(2), 111. https://doi.org/10.3390/cells14020111