CELTPLUS Fat Increases the Metabolic Activity as Well as the SVF-Yield Significantly When Compared to CELT Fat, Even After Cryopreservation with DMSO
Abstract
1. Introduction
2. Material and Methods
2.1. Harvesting and Preparation of Lipoaspirates
2.2. Preparation of CPA Solutions
2.3. Freezing and Thawing Protocol
2.4. Histological Evaluation
2.5. Vitality Assay
2.6. Cell Count
2.7. Cell Culture/Adipogenic Differentiation Potential Cell Media
2.8. RNA Isolation, Reverse Transcription, and qPCR
2.9. Oil Red O Staining
2.10. Statistical Analysis
3. Results
3.1. Histological Examination
3.2. Vitality Assay and Cell Count
3.3. PCR from Whole Tissue and Cell Culture
3.4. Oil Red O Staining
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Al Sufyani, M.A.; Al Hargan, A.H.; Al Shammari, N.A.; Al Sufyani, M.A. Autologous Fat Transfer for Breast Augmentation: A Review. Dermatol. Surg. 2016, 42, 1235–1242. [Google Scholar] [CrossRef]
- Rosing, J.H.; Wong, G.; Wong, M.S.; Sahar, D.; Stevenson, T.R.; Pu, L.L.Q. Autologous fat grafting for primary breast augmentation: A systematic review. Aesthetic Plast. Surg. 2011, 35, 882–890. [Google Scholar] [CrossRef]
- Largo, R.D.; Tchang, L.A.H.; Mele, V.; Scherberich, A.; Harder, Y.; Wettstein, R.; Schaefer, D.J. Efficacy, safety and complications of autologous fat grafting to healthy breast tissue: A systematic review. J. Plast. Reconstr. Aesthetic Surg. 2014, 67, 437–448. [Google Scholar] [CrossRef] [PubMed]
- Prantl, L.; Brix, E.; Kempa, S.; Felthaus, O.; Eigenberger, A.; Brébant, V.; Anker, A.; Strauss, C. Facial Rejuvenation with Concentrated Lipograft—A 12 Month Follow-Up Study. Cells 2021, 10, 594. [Google Scholar] [CrossRef]
- Simonacci, F.; Bertozzi, N.; Grieco, M.P.; Grignaffini, E.; Raposio, E. Procedure, applications, and outcomes of autologous fat grafting. Ann. Med. Surg. 2017, 20, 49–60. [Google Scholar] [CrossRef] [PubMed]
- Spiekman, M.; Francia, D.L.; Mossel, D.M.; Brouwer, L.A.; Diercks, G.F.H.; Vermeulen, K.M.; Folkertsma, M.; Ghods, M.; Kzhyshkowska, J.; Klüter, H.; et al. Autologous Lipofilling Improves Clinical Outcome in Patients with Symptomatic Dermal Scars Through Induction of a Pro-Regenerative Immune Response. Aesthetic Surg. J. 2022, 42, NP244–NP256. [Google Scholar] [CrossRef]
- Nguyen, A.; Guo, J.; Banyard, D.A.; Fadavi, D.; Toranto, J.D.; Wirth, G.A.; Paydar, K.Z.; Evans, G.R.; Widgerow, A.D. Stromal vascular fraction: A regenerative reality? Part 1: Current concepts and review of the literature. J. Plast. Reconstr. Aesthetic Surg. 2016, 69, 170–179. [Google Scholar] [CrossRef]
- Bi, H.; Li, H.; Zhang, C.; Mao, Y.; Nie, F.; Xing, Y.; Sha, W.; Wang, X.; Irwin, D.M.; Tan, H. Stromal vascular fraction promotes migration of fibroblasts and angiogenesis through regulation of extracellular matrix in the skin wound healing process. Stem Cell Res. Ther. 2019, 10, 302. [Google Scholar] [CrossRef] [PubMed]
- Prantl, L.; Eigenberger, A.; Klein, S.; Limm, K.; Oefner, P.J.; Schratzenstaller, T.; Felthaus, O. Shear Force Processing of Lipoaspirates for Stem Cell Enrichment Does Not Affect Secretome of Human Cells Detected by Mass Spectrometry In Vitro. Plast. Reconstr. Surg. 2020, 146, 749e–758e. [Google Scholar] [CrossRef] [PubMed]
- Gehmert, S.; Gehmert, S.; Hidayat, M.; Sultan, M.; Berner, A.; Klein, S.; Zellner, J.; Müller, M.; Prantl, L. Angiogenesis: The role of PDGF-BB on adipose-tissue derived stem cells (ASCs). Clin. Hemorheol. Microcirc. 2011, 48, 5–13. Available online: https://pubmed.ncbi.nlm.nih.gov/21876230/ (accessed on 15 December 2024). [CrossRef]
- Prantl, L.; Eigenberger, A.; Brix, E.; Kempa, S.; Baringer, M.; Felthaus, O. Adipose Tissue-Derived Stem Cell Yield Depends on Isolation Protocol and Cell Counting Method. Cells 2021, 10, 1113. [Google Scholar] [CrossRef]
- Eigenberger, A.; Felthaus, O.; Schratzenstaller, T.; Haerteis, S.; Utpatel, K.; Prantl, L. The Effects of Shear Force-Based Processing of Lipoaspirates on White Adipose Tissue and the Differentiation Potential of Adipose Derived Stem Cells. Cells 2022, 11, 2543. [Google Scholar] [CrossRef]
- Prantl, L.; Eigenberger, A.; Reinhard, R.; Siegmund, A.; Heumann, K.; Felthaus, O. Cell-Enriched Lipotransfer (CELT) Improves Tissue Regeneration and Rejuvenation without Substantial Manipulation of the Adipose Tissue Graft. Cells 2022, 11, 3159. [Google Scholar] [CrossRef] [PubMed]
- Eschborn, J.; Kruppa, P.; Georgiou, I.; Infanger, M.; Ghods, M. Long-term Results After Autologous Fat Transfer for Treatment of Chronic Lower Extremity Wounds. Int. J. Low. Extrem. Wounds 2023, 22, 524–530. [Google Scholar] [CrossRef]
- Saeed, K.; Khan, F.A.; Qudus, S.B.A.; Javed, S. Autologous Fat Grafting—A Step Forward in Wound Management. Int. J. Low. Extrem. Wounds 2022, 21, 647–650. [Google Scholar] [CrossRef]
- Malik, D.; Luck, J.; Smith, O.J.; Mosahebi, A. A Systematic Review of Autologous Fat Grafting in the Treatment of Acute and Chronic Cutaneous Wounds. Plast. Reconstr. Surg. Glob. Open 2020, 8, e2835. [Google Scholar] [CrossRef]
- Sun, M.; He, Y.; Zhou, T.; Zhang, P.; Gao, J.; Lu, F. Adipose Extracellular Matrix/Stromal Vascular Fraction Gel Secretes Angiogenic Factors and Enhances Skin Wound Healing in a Murine Model. Biomed Res. Int. 2017, 2017, 3105780. [Google Scholar] [CrossRef]
- Cai, Y.; Zhang, F.; Feng, J.; Wu, B.; Li, H.; Xiao, S.; Lu, F.; Wei, Z.; Deng, C. Long-term follow-up and exploration of the mechanism of stromal vascular fraction gel in chronic wounds. Stem Cell Res. Ther. 2023, 14, 163. [Google Scholar] [CrossRef] [PubMed]
- Xing, N.; Yang, J.; Wang, H.; Peng, L.; Liu, X.; Chen, J.; Liu, Y. Stromal vascular fraction gel promoted wound healing and peripheral nerve repair in diabetic rats via TLRs/MyD88/NF-κB signaling pathway. J. Biomater. Appl. 2023, 38, 146–156. [Google Scholar] [CrossRef]
- Piccolo, N.S.; Piccolo, M.S.; Piccolo, M.T.S. Fat grafting for treatment of burns, burn scars, and other difficult wounds. Clin. Plast. Surg. 2015, 42, 263–283. [Google Scholar] [CrossRef] [PubMed]
- Stasch, T.; Hoehne, J.; Huynh, T.; de Baerdemaeker, R.; Grandel, S.; Herold, C. Débridement and Autologous Lipotransfer for Chronic Ulceration of the Diabetic Foot and Lower Limb Improves Wound Healing. Plast. Reconstr. Surg. 2015, 136, 1357–1366. [Google Scholar] [CrossRef]
- Tao, Y.; Zhao, Z.-N.; Xiang, X.-J.; Liang, Z.-X.; Zhao, Y. SVF-GEL Cryopreserved for Different Times Exhibits Varied Preservation and Regeneration Potential After Transplantation in a Mouse Model. Aesthetic Plast. Surg. 2023, 47, 842–851. [Google Scholar] [CrossRef]
- Feng, J.; Hu, W.; Fanai, M.L.; Zhu, S.; Wang, J.; Cai, J.; Lu, F. Mechanical process prior to cryopreservation of lipoaspirates maintains extracellular matrix integrity and cell viability: Evaluation of the retention and regenerative potential of cryopreserved fat-derived product after fat grafting. Stem Cell Res. Ther. 2019, 10, 283. [Google Scholar] [CrossRef] [PubMed]
- Hua, Z.; Wei, P. Letter on SVF-GEL Cryopreserved for Different Times Exhibits Varied Preservation and Regeneration Potential After Transplantation in a Mouse Model. Aesthetic Plast. Surg. 2023, 48, 49–50. [Google Scholar] [CrossRef]
- Cui, X.D.; Gao, D.Y.; Fink, B.F.; Vasconez, H.C.; Pu, L.L.Q. Cryopreservation of human adipose tissues. Cryobiology 2007, 55, 269–278. [Google Scholar] [CrossRef]
- Zhang, P.-Q.; Tan, P.-C.; Gao, Y.-M.; Zhang, X.-J.; Xie, Y.; Zheng, D.-N.; Zhou, S.-B.; Li, Q.-F. The effect of glycerol as a cryoprotective agent in the cryopreservation of adipose tissue. Stem Cell Res. Ther. 2022, 13, 152. [Google Scholar] [CrossRef] [PubMed]
- Moscatello, D.K.; Dougherty, M.; Narins, R.S.; Lawrence, N. Cryopreservation of human fat for soft tissue augmentation: Viability requires use of cryoprotectant and controlled freezing and storage. Dermatol. Surg. 2005, 31 Pt 2, 1506–1510. [Google Scholar] [CrossRef]
- Pu, L.L.Q.; Cui, X.; Fink, B.B.F.; Cibull, M.L.; Gao, D. Long-term preservation of adipose aspirates after conventional lipoplasty. Aesthetic Surg. J. 2004, 24, 536–541. [Google Scholar] [CrossRef] [PubMed]
- Pu, L.L.Q.; Cui, X.; Fink, B.F.; Cibull, M.L.; Gao, D. Cryopreservation of adipose tissues: The role of trehalose. Aesthetic Surg. J. 2005, 25, 126–131. [Google Scholar] [CrossRef] [PubMed]
- Shu, Z.; Gao, D.; Pu, L.L. Update on cryopreservation of adipose tissue and adipose-derived stem cells. Clin. Plast. Surg. 2015, 42, 209–218. [Google Scholar] [CrossRef]
- Roato, I.; Alotto, D.; Belisario, D.C.; Casarin, S.; Fumagalli, M.; Cambieri, I.; Piana, R.; Stella, M.; Ferracini, R.; Castagnoli, C.; et al. Adipose Derived-Mesenchymal Stem Cells Viability and Differentiating Features for Orthopaedic Reparative Applications: Banking of Adipose Tissue. Stem Cells Int. 2016, 2016, 4968724. [Google Scholar] [CrossRef] [PubMed]
- Brown, S.A.; Lipschitz, A.H.; Kenkel, J.M.; Sorokin, E.; Shepherd, G.; Grebe, S.; Oliver, L.K.; Luby, M.; Rohrich, R.J. Pharmacokinetics and Safety of Epinephrine Use in Liposuction. Plast. Reconstr. Surg. 2004, 114, 756–763. [Google Scholar] [CrossRef] [PubMed]
- Burk, R.W.; Guzman-Stein, G.; Vasconez, L.O. Lidocaine and Epinephrine Levels in Tumescent Technique Liposuction. Plast. Reconstr. Surg. 1996, 97, 1379–1384. [Google Scholar] [CrossRef]
- Thirumala, S.; Gimble, J.M.; Devireddy, R.V. Cryopreservation of stromal vascular fraction of adipose tissue in a serum-free freezing medium. J. Tissue Eng. Regen. Med. 2010, 4, 224–232. [Google Scholar] [CrossRef] [PubMed]
- Agostini, F.; Rossi, F.M.; Aldinucci, D.; Battiston, M.; Lombardi, E.; Zanolin, S.; Massarut, S.; Parodi, P.C.; Da Ponte, A.; Tessitori, G.; et al. Improved GMP compliant approach to manipulate lipoaspirates, to cryopreserve stromal vascular fraction, and to expand adipose stem cells in xeno-free media. Stem Cell Res. Ther. 2018, 9, 130. [Google Scholar] [CrossRef]
- Kamenaga, T.; Kuroda, Y.; Nagai, K.; Tsubosaka, M.; Takashima, Y.; Kikuchi, K.; Fujita, M.; Ikuta, K.; Anjiki, K.; Maeda, T.; et al. Cryopreserved human adipose-derived stromal vascular fraction maintains fracture healing potential via angiogenesis and osteogenesis in an immunodeficient rat model. Stem Cell Res. Ther. 2021, 12, 110. [Google Scholar] [CrossRef]
- Zhang, H.; Liu, Y.; Yu, B.; Lu, R. An optimized TRIzol-based method for isolating RNA from adipose tissue. BioTechniques 2023, 74, 203–209. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Yuan, J.S.; Reed, A.; Chen, F.; Stewart, C.N. Statistical analysis of real-time PCR data. BMC Bioinform. 2006, 7, 85. [Google Scholar] [CrossRef]
- Bora, P.; Majumdar, A.S. Adipose tissue-derived stromal vascular fraction in regenerative medicine: A brief review on biology and translation. Stem Cell Res. Ther. 2017, 8, 145. [Google Scholar] [CrossRef]
- Traktuev, D.O.; Prater, D.N.; Merfeld-Clauss, S.; Sanjeevaiah, A.R.; Saadatzadeh, M.R.; Murphy, M.; Johnstone, B.H.; Ingram, D.A.; March, K.L. Robust functional vascular network formation in vivo by cooperation of adipose progenitor and endothelial cells. Circ. Res. 2009, 104, 1410–1420. [Google Scholar] [CrossRef]
- Traktuev, D.O.; Merfeld-Clauss, S.; Li, J.; Kolonin, M.; Arap, W.; Pasqualini, R.; Johnstone, B.H.; March, K.L. A population of multipotent CD34-positive adipose stromal cells share pericyte and mesenchymal surface markers, reside in a periendothelial location, and stabilize endothelial networks. Circ. Res. 2008, 102, 77–85. [Google Scholar] [CrossRef]
- Sowa, Y.; Mazda, O.; Tsuge, I.; Inafuku, N.; Kishida, T.; Morimoto, N. Roles of adipose-derived stem cells in cell-based therapy: Current status and future scope—A narrative review. Dig. Med. Res. 2022, 5, 57. [Google Scholar] [CrossRef]
- Naderi, N.; Combellack, E.J.; Griffin, M.; Sedaghati, T.; Javed, M.; Findlay, M.W.; Wallace, C.G.; Mosahebi, A.; Butler, P.E.; Seifalian, A.M.; et al. The regenerative role of adipose-derived stem cells (ADSC) in plastic and reconstructive surgery. Int. Wound J. 2017, 14, 112–124. [Google Scholar] [CrossRef]
- Wu, S.-H.; Liao, Y.-T.; Huang, C.-H.; Chen, Y.-C.; Chiang, E.-R.; Wang, J.-P. Comparison of the Confluence-Initiated Neurogenic Differentiation Tendency of Adipose-Derived and Bone Marrow-Derived Mesenchymal Stem Cells. Biomedicines 2021, 9, 1503. [Google Scholar] [CrossRef]
- Zhang, T.-Y.; Tan, P.-C.; Xie, Y.; Zhang, X.-J.; Zhang, P.-Q.; Gao, Y.-M.; Zhou, S.-B.; Li, Q.-F. The combination of trehalose and glycerol: An effective and non-toxic recipe for cryopreservation of human adipose-derived stem cells. Stem Cell Res. Ther. 2020, 11, 460. [Google Scholar] [CrossRef] [PubMed]
- Feng, J.; Doi, K.; Kuno, S.; Mineda, K.; Kato, H.; Kinoshita, K.; Kanayama, K.; Mashiko, T.; Yoshimura, K. Micronized cellular adipose matrix as a therapeutic injectable for diabetic ulcer. Regen. Med. 2015, 10, 699–708. [Google Scholar] [CrossRef] [PubMed]
- Parsons, A.M.; Ciombor, D.M.; Liu, P.Y.; Darling, E.M. Regenerative Potential and Inflammation-Induced Secretion Profile of Human Adipose-Derived Stromal Vascular Cells Are Influenced by Donor Variability and Prior Breast Cancer Diagnosis. Stem Cell Rev. Rep. 2018, 14, 546–557. [Google Scholar] [CrossRef]
- Kim, H.; Lee, B.-K. Anti-Inflammatory Effect of Adipose-Derived Stromal Vascular Fraction on Osteoarthritic Temporomandibular Joint Synoviocytes. Tissue Eng. Regen. Med. 2020, 17, 351–362. [Google Scholar] [CrossRef] [PubMed]
- Zhu, M.; Xue, J.; Lu, S.; Yuan, Y.; Liao, Y.; Qiu, J.; Liu, C.; Liao, Q. Anti-inflammatory effect of stromal vascular fraction cells in fat transplantation. Exp. Ther. Med. 2019, 17, 1435–1439. [Google Scholar] [CrossRef]






| Forward Primer | Reverse Primer | |
|---|---|---|
| GAPDH | GGGAGCGAGATCCCTCCAAAAT | GGCTGTTGTCATACTTCTCATGG |
| PPAR-γ | CACGGAGCTGATCCCAAAGT | TATAGGCTGGGCTTCCCCTT |
| C/EBP | TATAGGCTGGGCTTCCCCTT | AGCTTTCTGGTGTGACTCGG |
| PDGF | CCCCTGCCCATTCGGAGGAAGAG | TTGGCCACCTTGACGCTGCGGTG |
| VEGF | AACCAGCAGAAAGAGGAAAGAGG | CCAAAAGCAGGTCACTCACTTTG |
| Caspase 3 | GCAAACCTCAGGGAAACATT | TTTTCAGGTCAACAACAGGTCCA |
| Bcl2 | ATCGCCCTGTGGATGACTGAG | CAGCCAGGAGAAATCAAACAGAGG |
| VEGEFR2 | AATCTCTGGTGGAAGCCACG | TCTGGGGTGGGACATACACA |
| PDGFRA | GGGCACGCTCTTTACTCCAT | GCTCTGGGAAACTTCTCCTCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Schimanski, T.; Prantl, L.; Eigenberger, A.; Felthaus, O.; Loucas, R.; Utpatel, K.; Steer, K. CELTPLUS Fat Increases the Metabolic Activity as Well as the SVF-Yield Significantly When Compared to CELT Fat, Even After Cryopreservation with DMSO. Cells 2025, 14, 1270. https://doi.org/10.3390/cells14161270
Schimanski T, Prantl L, Eigenberger A, Felthaus O, Loucas R, Utpatel K, Steer K. CELTPLUS Fat Increases the Metabolic Activity as Well as the SVF-Yield Significantly When Compared to CELT Fat, Even After Cryopreservation with DMSO. Cells. 2025; 14(16):1270. https://doi.org/10.3390/cells14161270
Chicago/Turabian StyleSchimanski, Tom, Lukas Prantl, Andreas Eigenberger, Oliver Felthaus, Rafael Loucas, Kirsten Utpatel, and Kerstin Steer. 2025. "CELTPLUS Fat Increases the Metabolic Activity as Well as the SVF-Yield Significantly When Compared to CELT Fat, Even After Cryopreservation with DMSO" Cells 14, no. 16: 1270. https://doi.org/10.3390/cells14161270
APA StyleSchimanski, T., Prantl, L., Eigenberger, A., Felthaus, O., Loucas, R., Utpatel, K., & Steer, K. (2025). CELTPLUS Fat Increases the Metabolic Activity as Well as the SVF-Yield Significantly When Compared to CELT Fat, Even After Cryopreservation with DMSO. Cells, 14(16), 1270. https://doi.org/10.3390/cells14161270

