Next Article in Journal
Current Status of α-Synuclein Biomarkers and the Need for α-Synuclein PET Tracers
Next Article in Special Issue
Therapeutic and Clinical Potential of Adipose-Derived Stem Cell Secretome for Skin Regeneration
Previous Article in Journal
The Dark Side of Vascular Aging: Noncoding Ribonucleic Acids in Heart Failure with Preserved Ejection Fraction
Previous Article in Special Issue
Human Stem Cell Use in Androgenetic Alopecia: A Systematic Review
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

CELTPLUS Fat Increases the Metabolic Activity as Well as the SVF-Yield Significantly When Compared to CELT Fat, Even After Cryopreservation with DMSO

1
Department of Plastic, Hand and Reconstructive Surgery, University Hospital Regensburg, Franz-Josef-Strauss-Allee 11, 93053 Regensburg, Germany
2
Medical Device Lab, Regensburg Center of Biomedical Engineering (RCBE), Faculty of Mechanical Engineering, Ostbayerische Technische Hochschule Regensburg, Galgenbergstraße 30, 93053 Regensburg, Germany
3
Institute of Pathology, University of Regensburg, Franz-Josef-Strauss-Allee 11, 93053 Regensburg, Germany
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Cells 2025, 14(16), 1270; https://doi.org/10.3390/cells14161270
Submission received: 24 July 2025 / Revised: 5 August 2025 / Accepted: 16 August 2025 / Published: 17 August 2025
(This article belongs to the Special Issue Adipose-Derived Stem Cells for Tissue Regeneration)

Abstract

Lipofilling has far more applications than cosmetic surgery alone. Due to its high content of stromal vascular fraction (SVF) cells, lipoaspirate can also be used to treat wounds, as its cellular components may accelerate wound healing. Using our CELTPLUS protocol, we can increase the number of SVF cells per volume. Unfortunately, some patients require more than one treatment to achieve an optimal outcome, but would unnecessarily suffer from repeated liposuction. Therefore, our objective was to test whether cryopreserving CELTPLUS fat could offer a solution, potentially avoiding the need for repeated liposuction procedures. DMSO was used as a cryoprotective agent for proof-of-principle testing, although other non-toxic cryoprotective agents should be considered in the future. The rest of our freezing protocol is a clinically friendly attempt to facilitate the translation into clinical practice. We tested the cryopreserved tissue using histological evaluation, metabolism measurement, SVF cell yield estimation, PCRs from both whole tissue and from cultured SVF cells, and Oil Red “O” staining. We found that freezing CELTPLUS fat with DMSO yields better results than without cryoprotection in all evaluated methods. Until non-toxic cryoprotective agents are tested on CELTPLUS fat, we do not recommend initiating animal or human testing.

1. Introduction

Lipofilling is a popular plastic surgery technique that involves taking fat from one area of the body and using it to increase or restore volume in another area. This technique has many applications in plastic surgery and has become increasingly popular in recent years. One of the most common uses of lipofilling is breast augmentation. Instead of using breast implants, which can sometimes feel unnatural and bear the risk of foreign body reaction, lipofilling allows surgeons to use the patient’s own fat to enhance the size and shape of the breasts [1,2,3]. This technique can also be used for breast reconstruction after mastectomy. Lipofilling is also commonly used in facial rejuvenation [4]. As we age, our face loses volume, which can lead to sagging and wrinkles. Lipofilling can be used to restore this lost volume, giving the face a more youthful appearance. This technique can also be used to enhance the cheeks, lips, and chin, or to correct asymmetries and deformities caused by injury or congenital conditions [5]. Lipofilling has also shown promising results in scar revision. By injecting fat underneath scar tissue, lipofilling can help smooth the surface of the skin, promote wound healing, and reduce the appearance of scars [6].
These properties are believed to be mediated by adipose tissue-derived stem cells (ADSCs), endothelial precursor cells, pericytes, and fibroblasts in the lipoaspirate, which are part of the stromal vascular fraction (SVF) [7,8]. These stem cells produce growth factors, such as VEGF or PDGF, which promote revascularization of the wound bed and proliferation of connective tissue [9,10]. We have developed a method of lipoaspirate processing that approximately doubles the SVF concentration per volume and thereby also increases the number of ADSCs: the Cell Enriched Lipotransfere (CELT) protocol [4,9,11,12,13]. Depending on the exact protocol, lipoaspirate processed according to the CELT protocol results in CELT fat (Cleaned and Enriched Lipid Tissue) or CELTPLUS fat (Cleaned and Enriched Lipid Tissue—Purified Long-lasting Ultra-concentrated Supergraft), which are also less susceptible to shear forces, making it ideal for lipofilling in mechanically demanding areas, such as the face, the soles of the feet, or generally near joints [9,12]. Another application for CELT and CELTPLUS fat could be the treatment of chronic wounds, where the use of lipoaspirate has already shown beneficial effects [14,15,16]. Since SVF cells are largely responsible for the observed improvements in wound healing, their increased concentration in CELT and CELTPLUS fat could enhance these therapeutic effects [17,18,19]. Other research groups have already demonstrated beneficial effects of processed lipoaspirate—referred to as SVF-gel in their studies—on wound healing.
Repeated treatments may improve the outcome but involve all the risks and inconveniences associated with undergoing multiple liposuctions [20,21]. Especially when treating patients with impaired wound healing, it is essential to limit the number of sessions to avoid creating more wounds through liposuction, which have the potential to develop into chronic wounds themselves, creating a vicious circle of causing wounds to heal them. One method to avoid multiple liposuctions would be to harvest more lipoaspirate than needed for the first lipofilling and cryopreserve the unused rest for future applications. Since the main goal of lipoaspirate cryopreservation is to maintain SVF viability and yield, it should be possible to cryopreserve CELT and CELTPLUS fat as well, since the main difference is the increased SVF-yield and the denser extracellular matrix. To our knowledge, no comparison of cryopreservation outcomes between differently processed samples using cryoprotective agents (CPAs) has been reported. However, we are aware of two recent studies that investigated the cryopreservation of SVF-gel at −20 °C without the use of additional CPAs: one by Tao, Zhao et al., 2023 [22] and the other by Feng, Hu et al., 2019 [23]. In our opinion, those were well-conducted studies that reported interesting findings. However, Hua, Wei et al., 2023 [24] published an open letter in response to Tao, Zhao et al., 2023 [22], raising two concerns regarding their methodology. The first concern was that −20 °C is not cold enough for long-term cryopreservation, and the second was that the absence of CPAs in cryopreservation does not guarantee the best possible post-thaw outcome. Several studies have shown that the use of CPAs shows superior results compared to dry freezing of lipoaspirate [25,26,27,28,29]. Furthermore, the literature findings suggest a cryopreservation temperature of −80 °C or liquid nitrogen vapor phase [25,27,30,31]. Hua and Wei [24] concluded that cryopreserved SVF-gel lacks clinical relevance. We sincerely think that, with further improvements to the cryopreservation process, we can justify the usage of cryopreserved CELTPLUS fat in clinical usage, as, for example, wound healing improvement, because the results of Tao, Zhao et al. [22] and Feng, Hu et al. [23] showed promising results.
However, it is important to note that cryopreservation of lipoaspirate has limitations. The viability of the fat cells may be reduced during the cryopreservation process, potentially affecting the success of the lipofilling procedure [25,26,30]. A proper freezing and thawing protocol that reduces cell death at these critical stages was invented by Pu et al., 2004, using a programmable methanol freezing bath and a liquid nitrogen freezing tank [28]. However, we will be using a protocol that is compatible with clinical use to facilitate the transition to clinical practice. We aim to determine whether replacing a programmable methanol freezing bath and a liquid nitrogen freezing tank with a conventional Mr. Frosty™ freezing container and a −80 °C freezer will yield acceptable results in our in vitro study. We will utilize DMSO as a CPA, as its usage is well documented and established. However, this will serve as a proof of principle before other CPAs are tested.
In this study we aim to validate the CELT protocol for additional purposes. We will compare the outcome of cryopreservation of CELT fat and CELTPLUS fat with and without DMSO as a CPA.

2. Material and Methods

2.1. Harvesting and Preparation of Lipoaspirates

Tests were conducted on lipoaspirate obtained from 14 patients (10 female and 4 male) with a mean age of 48.8 ± 12.7 years and a mean BMI of 31.5 ± 6.5 kg/m2. All patients gave written consent to the use of their tissues. This study was approved by the Ethics Committee of the University Hospital of Regensburg (08/117). The liposuction was performed as previously described in more detail [13]. Briefly, a tumescent solution containing 0.9% (w/v) NaCl mixed with epinephrine in a ratio of 1:200,000 is injected into the harvesting site with a 2.5 mm injection cannula and is allowed to incubate for about 15 min. Epinephrine, in such concentrations, is a well-documented and established pharmaceutical agent, with a thirty-year history of use in the field of liposuction to reduce blood loss [32,33]. For harvesting of the lipoaspirate, we use a 3.8 mm cannula (Human Med AG, Schwerin, Germany). Our liposuction device of choice (Body-Jet®, Human Med AG, Schwerin, Germany) is a waterjet-assisted liposuction system with constant negative pressure of less than 0.5 mbar. The aspirates were harvested at the Caritas St. Josef Hospital, Regensburg, and were transferred to the University Hospital, Regensburg. Following sedimentation, all collected aspirates were subjected to the respective treatments. For CELTPLUS processing, the lipoaspirate was treated as described earlier in Prantl et al., 2020 [9], as illustrated in Figure 1. Briefly, the lipoaspirate is allowed to sediment for ten minutes to achieve a separation of the adipose tissue from the tumescence solution. Sedimented lipoaspirate is transferred to a 20 mL luer-lock syringe (Becton Dickinson S.A., Madrid, Spain) and centrifuged for 2 min at 1600 rcf (Rotina 380R; Andreas Hettich GmbH & Co. KG, Tuttlingen, Germany), resulting in a big aqueous phase, the tissue phase, and a small lipid phase. The supernatant lipid layer and infernatant tumescence layer are disposed to receive CELT fat. For shear-force intersyringe processing, the syringe is connected to a second 20 mL luer-lock syringe via a three-way stopcock, with an inner diameter of 1.2 mm (B. Braun Melsungen AG; Melsungen, Germany). Now, we vigorously pressed the CELT fat back and forth 10 times for homogenization. We performed this to enrich the fraction of stromal vascular cells in the remaining tissue that are less susceptible to sheer forces [9,12]. The subsequent second centrifugation for 2 min at 1600 rcf results in a big lipid phase from disrupted adipocytes, which is also discarded. The remaining tissue is greatly reduced in volume but has a higher ECM and ADSC concentration. In the following we will refer to the processed tissue after Step 5 as “CELTPLUS fat” and to the unprocessed but centrifuged lipoaspirate after Step 4 as “CELT fat”.

2.2. Preparation of CPA Solutions

Dimethyl sulfoxide (Sigma Aldrich, St. Louis, MO, USA) (DMSO) in a concentration of 20% (v/v, DMSO, α-MEM, and FCS in a 2:4:4 ratio) was used as a CPA. After mixing 1:1 with CELT fat or CELTPLUS fat, we received the final concentrations for the CPA (10% v/v). Regarding cryopreservation, both the CELTPLUS fat and the CELT fat were treated with one of the following protocols:
Treatment 1: Fresh unfrozen control (control) right after processing;
Treatment 2: Frozen without a CPA (w/o) for 24 h at −80 °C;
Treatment 3: Frozen mixed with the same volume of CPA (DMSO) for 24 h at −80 °C.
The concentration of a final 10% DMSO was chosen from the literature for the cryopreservation of SVF derived from fat tissue [34,35,36].

2.3. Freezing and Thawing Protocol

Control samples were subjected to evaluation immediately. Samples with (DMSO) or without (w/o) a CPA were put into the −80 °C freezer for 24 h in freezing containers (Nalgene ™ Cryo 1 °C Freezing Container, Thermo Fisher, New York, NY, USA), which ensure a constant freezing rate of 1–2 °C/min. This slow cooling rate reduces artificially induced ice formation (30). All samples were thawed 24 h after freezing using a water bath (Memmert GmbH + Co. KG, Schwabach, Germany) at 37 °C for 3.5 min. This allows sufficient time for the samples to thaw thoroughly. This protocol is a simplified version of the well-documented and experimentally approved ones from Cui et al. [25] and Pu et al. [28], as described earlier in the introduction.

2.4. Histological Evaluation

CELT and CELTPLUS samples were fixed in a neutral buffered formalin and embedded in paraffin. The paraffin block was sectioned into 4 µm thick slices. The histological slides were deparaffinized with xylene and rehydrated through a graded alcohol series. After hematoxylin/eosin staining, the slides were digitized using a P1000 slide digitalization system (3D Histech Kft., Budapest, Hungary). The MAs and SVFCs were counted.

2.5. Vitality Assay

For vitality determination, 50 µL CELT/CELTPLUS aliquots were incubated with resazurin (Sigma Aldrich, St. Louis, MO, USA) in quadruplicates. The blue resazurin is a cell-permeable redox indicator that can be reduced to the pink resorufin with, in this case, NADH from living, metabolically active cells. This change in fluorescence intensity can be measured with a 560 nm excitation and 590 nm emission filter set. Each sample was filled up with 45 µL of 0.7 M resazurin and 0.405 mL of α-MEM + FCS to bring the combined volume of every sample to 0.500 mL in total. Immediately after mixing we transferred all samples into an incubator with a drive tube rotator at 37 °C, 10 rpm, for 1 h before we centrifuged them once again, now at 525 rcf for 2 min. We then performed a measurement of the fluorescence intensity using 100 µL of each fluid phase from the bottom layer of each cup in single wells of a 96-well plate. The plate reader (VarioScan; Thermo Scientific, Waltham, MA, USA) measures the fluorescence intensity in each well. Since fluorescence intensity is directly proportional to the metabolic activity of each sample, we conclude that cell survival and fluorescence are also linked.

2.6. Cell Count

We adjusted our sample to a volume of 0.7 mL of fat to ensure a reasonable amount of SVF cells for the cell culture. All groups were mixed with an isovolumetric amount of 0.2% collagenase type 1 (from Clostridium histolyticum, Sigma Aldrich, St. Louis, MO, USA) and rotated at 10 rpm for an hour at 37 °C. All samples were spun through 250 µm tissue strainers (Thermo Fisher, Pierce® Tissue Strainers, New York, NY, USA) with 500 rcf for 2 min to remove undigested particles. The digestion is then stopped by adding double the volume of α-MEM (Pan Biotech, Aidenbach, Germany) with 10% FCS. The isolated cells were diluted 1:1 (v/v) with PBS and centrifuged at 200 rcf for 10 min. After resuspending the SVF to a volume of 700 µL each, we took 100 µL suspension and mixed it with 100 µL 0.4% trypan blue (Sigma Aldrich, St. Louis, MO, USA). We then counted the living cells of 10 µL of this mixture in a Neubauer chamber at ×40 magnification.

2.7. Cell Culture/Adipogenic Differentiation Potential Cell Media

For the cell culture, α-MEM (Pan Biotech, Aidenbach, Germany) + 10% FCS + 1% penicillin/streptomycin was used. For adipogenic differentiation, this cell culture medium was supplemented with 1 µL/mL of 500 mM IBMX (SERVA, Heidelberg, Germany), 1 µL/mL of 1 mM dexamethasone (Pan Biotech, Aidenbach, Germany), 5.7 µL/mL of 9.5–11.5 mg/mL human insulin (Merck, Darmstadt, Germany), and 2 µL/mL of 100 mM indomethacin (Sigma Aldrich, St. Louis, MO, USA).
The remaining 600 µL of cell suspension from the cell count was cultured in single wells of a 6-well plate (Cellstar™, Greiner Bio-One International GmbH, Gremsmünster, Austria) with a total of 2 mL α-MEM (Pan Biotech, Aidenbach, Germany) + 10% FCS and 1% penicillin/streptomycin, cultivated in a 37 °C 5% carbon dioxide atmosphere. The medium was changed three times a week. After reaching subconfluency, the cells were passaged into a T75 flask (Cellstar™, Greiner Bio-One International GmbH, Gremsmünster, Austria). After the second and final passage of the cells into 6- and 24-well plates (Cellstar™, Greiner Bio-One International GmbH, Gremsmünster, Austria), differentiation assays were conducted. After two weeks of cultivation with an adipogenic differentiation medium, the cells were either harvested by lysis for RNA isolation or were fixed with formalin for subsequent Oil Red O staining.

2.8. RNA Isolation, Reverse Transcription, and qPCR

First 150 mg of adipose tissue is mixed with 1 mL of Trizol (TRI Reagent®, Sigma Aldrich, St. Louis, MO, USA). We performed this by using two syringes and one three-way stopcock. The homogenisate is then spun at 16,000 rcf for 5 min at 4 °C (Refrigerated Centrifuge Biofuge fresco, Heraeus, Hanau, Germany). After the first centrifugation the red infranatant is transferred into a new 1.5 mL Eppendorf cup to be spun again at 12,000 rcf for 5 min at 4 °C. If there was a lipid layer on top, we discarded it and mixed the infranatant with 200 µL of chloroform. The mixture was shaken for 1 min. We let the mixture incubate at room temperature for 5 min to let the nucleoprotein complex dissociate. We centrifuged once again at 16,000 rcf for 15 min at 4 °C. The clear supernatant is transferred to a fresh Eppendorf cup and mixed with the same volume of 70% ethanol. The whole protocol is a slightly changed version of Zhang et al., 2023 [37].
The RNA from the cell culture was collected using the Qiagen RNeasy Mini kit. The RNA to cDNA transcription was performed using the QuantiTect™ Reverse Transcription Kit from Qiagen (Hilden, Germany), according to the manufacturer’s protocol. The PCRs were performed using the Takyon™ No ROX SYBR® MasterMix blue dTTP (Takyon, Milano, Italy), the primers for GAPDH, PPAR-γ, and C/EBP from Table 1, and cDNA in a three-step real-time PCR.

2.9. Oil Red O Staining

Cells that underwent two weeks of adipogenic differentiation were stained with Oil Red O (Sigma Aldrich, St. Louis, MO, USA). After microscopic documentation, cells were destained using 100% isopropanol for quantification. Quantification was conducted by measuring the optical density (VarioScan; Thermo Scientific, Waltham, MA, USA) at 510 nm.

2.10. Statistical Analysis

For the resazurin assay and SVF-yield, all results were normalized to the control CELT fat before expressing them as the mean + standard deviation (mean + SD). The Oil Red O staining results, as well as the histological examination, were expressed as the mean + standard deviation (mean + SD). All PCRs were evaluated using the ∆∆Ct method [38,39]. In the present analysis, a paired Student’s t-test was employed to compare the data between the different conditions. A p-value of <0.05 was considered statistically significant. All groups that were compared using Student’s t-test were normally distributed according to the Kolmogorov–Smirnov test. The evaluation of data with limited replication was conducted through descriptive analysis. To assess the effect size, we calculated Cohen’s d.

3. Results

3.1. Histological Examination

The CELTPLUS fat group yields more SVF cells than equally treated CELT fat samples and fewer mature adipocytes. Also, the number of intact MAs decreased through the freezing and thawing process while the number of SVF cells increased, as seen in Figure 2.

3.2. Vitality Assay and Cell Count

The CELTPLUS fresh control samples, on average, had 1.31 ± 0.68 times higher fluorescence intensity than the CELT fat, as seen in Figure 3A. Their not normalized mean values were 686.65 ± 358.22 vs. 524.81 ± 287.29. However, for the frozen samples, the highest values came from DMSO CELTPLUS fat (0.90 ± 0.42 times the value of the control CELT fat group) with significant (p < 0.05) differences to all CELT fat samples except control CELT fat, with p = 0.34. Cohen’s d comparing the control CELT vs. the control CELTPLUS fat and DMSO CELT vs. DMSO CELTPLUS fat indicates high differences with values of 1.1 and 1.2. The results were normalized to their corresponding control CELT fat absorbance for better comparison. The non-normalized values of CELT DMSO, CELT w/o, CELTPLUS DMSO, and CELTPLUS w/o were 350.83 ± 169.15, 49.09 ± 55.20, 472.14 ± 217.97, and 103.78 ± 85.43, respectively.
The CELTPLUS fat control samples, on average, had a 2.05 ± 0.36 times higher yield of SVF cells than their CELT fat counterpart, as seen in Figure 3B. Their non-normalized mean values were 814,500.00 ± 141,835.29 cells/mL vs. 398,071.43 ± 93,582.91 cells/mL. As in the resazurin assay, the DMSO CELTPLUS treatment came out superior to the other frozen groups (0.93 ± 0.26). With significantly higher yields in comparison to all CELT fat samples (with p < 0.05) except the control CELT fat, with p = 0.54. The CELTPLUS fat DMSO group had the best results for the cell yield of the frozen groups. Cohen’s d comparing the control CELT vs. the control CELTPLUS fat and DMSO CELT vs. DMSO CELTPLUS fat indicates high differences with values of 4.6 and 2.2. The results were normalized to their corresponding control CELT fat cell yield for better comparison. The non-normalized values for cells/mL of CELT DMSO, CELT w/o, CELTPLUS DMSO, and CELTPLUS w/o were 173,500.00 ± 53,946.73, 71,666.67 ± 25,385.91, 368,500.00 ± 105,048.80, and 167,777.78 ± 67,827.85, respectively.
As demonstrated in Figure 3C, the differences in the optical density measurements between the DMSO and w/o groups can be displayed by dividing the optical density of the DMSO groups by that of the corresponding w/o group. This coefficient is higher for CELT than for CELTPLUS fat, with 8.7 times ± 3.4 (6.7 times ± 5.0 for CELTPLUS fat) higher optical density for CELT. Because of the high standard deviation, no statistically significant differences were found.
As demonstrated in Figure 3D, the differences in the cell count between the DMSO and w/o groups can be displayed by dividing the cell count of the DMSO groups by that of the corresponding w/o group. This coefficient is higher for CELT than for CELTPLUS fat, with a 2.7 times ± 0.8 (2.6 times ± 0.8 for CELTPLUS fat) higher normalized cell count for CELT. Because of the high standard deviation, no statistically significant differences occurred.

3.3. PCR from Whole Tissue and Cell Culture

Despite the repeated attempts to collect RNA from the w/o samples, the quantity obtained was insufficient for the PCR for both whole tissue and the cell culture. Nevertheless, as seen in Figure 4, a comparison of the control and DMSO samples reveals that PDGF and VEGFR2 exhibit the highest increase from CELT to CELTPLUS, while for VEGF, only a comparatively moderate increase was measured. The apoptosis marker Bcl 2 demonstrated a decrease in expression, while Caspase 3 exhibited an increase in expression when comparing CELT to CELTPLUS for both control and DMSO samples. A comparison of the control group with the DMSO group reveals no major alterations in PDGFRA, VEGF, and VEGFR2. The expression levels of the apoptotic markers Bcl 2 and Caspase 3 exhibited an increase, except for Caspase 3 in CELTPLUS fat. The expression of PDGFRA was found to be relatively stable across all groups.
Upregulation of adipogenic marker genes PPARγ and CEB/P was retained after cryopreservation. However, whereas in CELT, upregulation was decreased (PPARγ) or consistent (CEB/P), in CELTPLUS, the upregulation was consistent for PPARγ and increased for the CEB/P group, as seen in Figure 5.

3.4. Oil Red O Staining

The absorbance in the control group is higher than in the corresponding DMSO groups, and the CELT group yields less absorbance than its corresponding CELTPLUS fat group, as seen in Figure 6.

4. Discussion

There are many protocols for the cryopreservation of adipose tissue in the form of lipoaspirate [25,26,27,29]. The main novelty of this study is the use of CELTPLUS fat for cryopreservation in comparison to CELT fat. The histological slides in Figure 2 show that the microscopic appearance of the two tissues varies greatly, as do their properties before and after freezing/thawing. It showed that after cryopreservation, the preparation of the samples was of comparable quality, that the composition of the samples was similar, and that potential architectural changes could be described. There is no possibility to determine dead SVF cells in HE staining, while damaged MAs could be detected through a fractured cell membrane. It became clear that post-thawed CELTPLUS fat had fewer architecturally intact MAs than before freezing. This could be because of the two MAs' destructive effects, one being CELTPLUS preparation and the other freeze–thawing. Therefore, the SVF count was slightly higher, as seen in the graphs of Figure 2, probably because the damaged MAs occupy less space due to rupture, and therefore, the SVFCs move together in a tighter space. However, since the integrity of MAs is not that important for clinical use, this finding is bearable. In addition, more vessels are found in CELTPLUS, which could potentially lead to higher retention rates. Anyway, the histological appearance shows that the SVFCs can be increased per volume.
Feng et al., 2019 [23] investigated the properties of what they called “cryo-gel”, which is essentially the same as cryopreserved CELTPLUS fat. They tested a mouse model of ischemic wound healing treated with frozen lipoaspirate and cryo-gel. They found accelerated wound healing when cryo-gel was used, with higher retention rates and fewer oil cysts [23]. Due to the absence of CPAs and cryopreservation at −20 °C, they found that normal cryopreserved lipoaspirate did not provide a better wound healing outcome compared to no treatment. This could be explained by our findings that the mean metabolic activity and mean cell count are higher for CELTPLUS fat without any CPA than for CELT fat without any CPA; see Figure 3A,B. Therefore, in Feng et al., 2019 [23], cryo-gel may have been able to deliver a positive effect when aspirate did not.
The increase in cell yield was greater than the increase in metabolism when comparing CELTPLUS fat to CELT fat, with both being significant and with high values for Cohen’s d in the control CELT vs. the control CELTPLUS fat and DMSO CELT vs. DMSO CELTPLUS. A 1.31 ± 0.68-fold increase in metabolism and a 2.05 ± 0.36-fold increase in cell yield were recorded when comparing DMSO CELTPLUS fat with DMSO CELT fat. However, Figure 3C,D show that the effect of the CPA on the cell count and the metabolic activity is even stronger for CELT and CELTPLUS fat compared to non-CPA-treated fat (w/o). This also explains why we were unable to establish stable cell cultures from non-CPA-treated fat. It is also noteworthy that the increase in these properties is higher for CELT than for CELTPLUS fat. Two explanations could be the better survival of CELTPLUS fat in the absence of a CPA due to a protective effect of the thicker extracellular matrix, which becomes less impactful when using a CPA, or a minor cryoprotective effect of a CPA for CELTPLUS fat since the optimum DMSO concentration for CELTPLUS fat could be different from that for CELT fat. Nonetheless, the freezing of CELT fat alone, and the subsequent processing of the thawed product as CELTPLUS fat, is not a viable proposition. The reason for this is that CELT fat would require a substantially greater volume of storage space than CELTPLUS fat. This, in turn, would present a significant challenge in terms of its clinical application. Consequently, the most effective concentration of cryoprotective agents for CELTPLUS fat should be determined to optimize the process.
Since living cells can change their gene expression in a short time to adapt to new circumstances, the method of whole tissue PCR offers many possibilities in the field of lipoaspirate research. Cultured cells are still the method of choice for assessing gene expression. However, for some questions, it is more interesting to spare the cells the time to adapt to cell culture conditions and to look at the gene expression as it is in the lipoaspirate at a certain moment after a specific effect of interest. In our example, the effect of interest is cryopreservation. Whole tissue PCR showed that important parameters of lipograft retention, such as VEGF, VEGFR2, and PDGF, were expressed at higher levels in the CELTPLUS fat than in CELT fat, even after cryopreservation; see Figure 4. These growth factors and the growth factor receptor support the migration, proliferation, and overall survival of the lipograft [40,41,42]. The expression of apoptosis markers indicates a slightly higher rate of apoptosis in CELTPLUS fat, which is most likely due to the mechanical preparation. To further validate these findings regarding the apoptosis, flow cytometry with annexin V and propidium iodide staining should be performed. Nonetheless, given the observation that the living SVF cells and metabolic activity exhibited a significant increase in CELTPLUS, this finding only constitutes a minor downside of the protocol. Surprisingly, the cryopreservation process did not appear to increase the rate of apoptosis; in fact, it appeared to decrease it slightly. This phenomenon may be attributable to the fact that cryopreservation predominantly results in necrosis rather than apoptosis. However, further research is necessary to elucidate this observation. Of course, these shifted gene expressions are a manifestation of different ratios of SVFCs to MAs, as seen in the histological examination, since we have already shown that the CELTPLUS protocol does not manipulate the pre-existing cells in their secretom [9]. These findings suggest that CELTPLUS fat keeps its favorable wound healing properties after cryopreservation.
The reconstructive potential of SVF cells is promising [7,43,44,45]. Even after cryopreservation they can still differentiate into adipogenic cell lines [45,46,47,48]. This makes it a target for enrichment in lipografts for various scenarios, such as the treatment of wound healing disorders, where the containment of the SVF has beneficial effects in reducing inflammation and restoring lost tissue volume [6,23,47,49,50]. The semiquantitative evaluation in Figure 5 shows the increase in adipogenic-specific RNA markers, C/EBP, and PPAR-γ, which indicates a successful adipogenic differentiation in vitro, which is preserved even after cryopreservation. PPAR-γ from the DMSO-treated CELT group seems decreased, and C/EBP from the DMSO-treated CELTPLUS fat group seems increased. The quantitative evaluation with Oil Red “O” shows better results in terms of differentiation for CELTPLUS fat than for CELT fat and better results for the control group compared to the DMSO-treated group, as seen in Figure 6.
Because of the short period of time that the samples are frozen, it is not crucial for a successful cryopreservation to freeze in a vapor nitrogen phase [31]. To validate the damage caused by cryopreservation, the freezing and thawing process is the most important part [25]. Also, some protocols from other workgroups that focus on long-term preservation of lipoaspirate transfer their samples from −80 °C to vapor nitrogen after 24 h, at which time we start our thawing [27]. Shu et al., 2015 even recommended storing at −80 °C if the storage time falls below one year [30].
Metabolic activity and cell yield were increased when comparing CPA-treated CELTPLUS fat to non-CPA-treated CELTPLUS fat, and adipogenic differentiation, RNA expression, and histological features were only slightly decreased when comparing cryopreserved CELTPLUS fat to the control CELTPLUS fat. Bearing all this in mind, the clinical potential of cryopreserved CELTPLUS fat does seem very promising. We suggest testing optimal concentrations of non-toxic CPAs for cryopreservation of CELTPLUS fat since this would be necessary for clinical trials. It is also crucial to start in vivo testing of CPA-treated CELTPLUS fat to investigate the retention rate and common side effects, as to our knowledge, this has not been performed to date.
As demonstrated by Zhang et al. (2022), trehalose and glycerol have the potential to be superior to DMSO in terms of cryopreserving lipoaspirate [26]. Further approaches to determine the optimal concentrations of the non-toxic CPAs should be conducted to optimize the cryopreservation of CELT and, particularly, CELTPLUS derivatives. To the best of our knowledge, this has not been undertaken previously. The high post-thaw metabolic activity and the successful differentiation observed in the assay suggest that the applied DMSO concentration did not induce significant toxicity under the conditions of the assay. A further limitation of the present study is that the freezing time was only 24 h. As previously indicated, the extant literature suggests that the freezing and thawing process exerts the greatest damage to the cells, with storage time having a comparatively lesser effect. The present study was conducted to provide proof of concept that cells in CELT and CELTPLUS fat can survive cryopreservation. Nevertheless, the investigation of extended storage periods should be considered, as this is the current focus of the research. The viability, differentiation capacity, and functional recovery of the material, as well as graft retention and vascularization in in vivo models, are currently being investigated to facilitate the next step in the direction of clinical translation.

5. Conclusions

Cryopreservation of CELTPLUS fat is possible, and we believe it has great potential for wound healing and lipofilling in mechanically demanding areas. The transdifferentiation capacity of frozen fat was slightly limited, but generally at a high level. CELTPLUS fat also contains higher levels of growth factors compared to normal CELT fat, such as VEGF and PDGF, which are responsible for retention after lipofilling. To validate whether the CELTPLUS protocol was successful, a histological examination should look like Figure 2B.

Author Contributions

Conceptualization, T.S., L.P., K.S. and O.F.; methodology, T.S., L.P., K.S., K.U., A.E. and O.F.; investigation, T.S., L.P., K.S. and O.F.; data curation, T.S., L.P., K.S. and O.F.; validation, O.F., A.E. and R.L.; writing—original draft preparation, T.S., L.P., K.S. and O.F.; writing—review and editing, T.S., L.P., K.S., R.L. and O.F.; visualization, T.S. and A.E.; supervision, L.P.; project administration, T.S. and O.F. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding authors.

Conflicts of Interest

The authors declare no conflicts of interest. The authors have no financial interest in any of the products, devices, or drugs mentioned in this manuscript.

References

  1. Al Sufyani, M.A.; Al Hargan, A.H.; Al Shammari, N.A.; Al Sufyani, M.A. Autologous Fat Transfer for Breast Augmentation: A Review. Dermatol. Surg. 2016, 42, 1235–1242. [Google Scholar] [CrossRef]
  2. Rosing, J.H.; Wong, G.; Wong, M.S.; Sahar, D.; Stevenson, T.R.; Pu, L.L.Q. Autologous fat grafting for primary breast augmentation: A systematic review. Aesthetic Plast. Surg. 2011, 35, 882–890. [Google Scholar] [CrossRef]
  3. Largo, R.D.; Tchang, L.A.H.; Mele, V.; Scherberich, A.; Harder, Y.; Wettstein, R.; Schaefer, D.J. Efficacy, safety and complications of autologous fat grafting to healthy breast tissue: A systematic review. J. Plast. Reconstr. Aesthetic Surg. 2014, 67, 437–448. [Google Scholar] [CrossRef] [PubMed]
  4. Prantl, L.; Brix, E.; Kempa, S.; Felthaus, O.; Eigenberger, A.; Brébant, V.; Anker, A.; Strauss, C. Facial Rejuvenation with Concentrated Lipograft—A 12 Month Follow-Up Study. Cells 2021, 10, 594. [Google Scholar] [CrossRef]
  5. Simonacci, F.; Bertozzi, N.; Grieco, M.P.; Grignaffini, E.; Raposio, E. Procedure, applications, and outcomes of autologous fat grafting. Ann. Med. Surg. 2017, 20, 49–60. [Google Scholar] [CrossRef] [PubMed]
  6. Spiekman, M.; Francia, D.L.; Mossel, D.M.; Brouwer, L.A.; Diercks, G.F.H.; Vermeulen, K.M.; Folkertsma, M.; Ghods, M.; Kzhyshkowska, J.; Klüter, H.; et al. Autologous Lipofilling Improves Clinical Outcome in Patients with Symptomatic Dermal Scars Through Induction of a Pro-Regenerative Immune Response. Aesthetic Surg. J. 2022, 42, NP244–NP256. [Google Scholar] [CrossRef]
  7. Nguyen, A.; Guo, J.; Banyard, D.A.; Fadavi, D.; Toranto, J.D.; Wirth, G.A.; Paydar, K.Z.; Evans, G.R.; Widgerow, A.D. Stromal vascular fraction: A regenerative reality? Part 1: Current concepts and review of the literature. J. Plast. Reconstr. Aesthetic Surg. 2016, 69, 170–179. [Google Scholar] [CrossRef]
  8. Bi, H.; Li, H.; Zhang, C.; Mao, Y.; Nie, F.; Xing, Y.; Sha, W.; Wang, X.; Irwin, D.M.; Tan, H. Stromal vascular fraction promotes migration of fibroblasts and angiogenesis through regulation of extracellular matrix in the skin wound healing process. Stem Cell Res. Ther. 2019, 10, 302. [Google Scholar] [CrossRef] [PubMed]
  9. Prantl, L.; Eigenberger, A.; Klein, S.; Limm, K.; Oefner, P.J.; Schratzenstaller, T.; Felthaus, O. Shear Force Processing of Lipoaspirates for Stem Cell Enrichment Does Not Affect Secretome of Human Cells Detected by Mass Spectrometry In Vitro. Plast. Reconstr. Surg. 2020, 146, 749e–758e. [Google Scholar] [CrossRef] [PubMed]
  10. Gehmert, S.; Gehmert, S.; Hidayat, M.; Sultan, M.; Berner, A.; Klein, S.; Zellner, J.; Müller, M.; Prantl, L. Angiogenesis: The role of PDGF-BB on adipose-tissue derived stem cells (ASCs). Clin. Hemorheol. Microcirc. 2011, 48, 5–13. Available online: https://pubmed.ncbi.nlm.nih.gov/21876230/ (accessed on 15 December 2024). [CrossRef]
  11. Prantl, L.; Eigenberger, A.; Brix, E.; Kempa, S.; Baringer, M.; Felthaus, O. Adipose Tissue-Derived Stem Cell Yield Depends on Isolation Protocol and Cell Counting Method. Cells 2021, 10, 1113. [Google Scholar] [CrossRef]
  12. Eigenberger, A.; Felthaus, O.; Schratzenstaller, T.; Haerteis, S.; Utpatel, K.; Prantl, L. The Effects of Shear Force-Based Processing of Lipoaspirates on White Adipose Tissue and the Differentiation Potential of Adipose Derived Stem Cells. Cells 2022, 11, 2543. [Google Scholar] [CrossRef]
  13. Prantl, L.; Eigenberger, A.; Reinhard, R.; Siegmund, A.; Heumann, K.; Felthaus, O. Cell-Enriched Lipotransfer (CELT) Improves Tissue Regeneration and Rejuvenation without Substantial Manipulation of the Adipose Tissue Graft. Cells 2022, 11, 3159. [Google Scholar] [CrossRef] [PubMed]
  14. Eschborn, J.; Kruppa, P.; Georgiou, I.; Infanger, M.; Ghods, M. Long-term Results After Autologous Fat Transfer for Treatment of Chronic Lower Extremity Wounds. Int. J. Low. Extrem. Wounds 2023, 22, 524–530. [Google Scholar] [CrossRef]
  15. Saeed, K.; Khan, F.A.; Qudus, S.B.A.; Javed, S. Autologous Fat Grafting—A Step Forward in Wound Management. Int. J. Low. Extrem. Wounds 2022, 21, 647–650. [Google Scholar] [CrossRef]
  16. Malik, D.; Luck, J.; Smith, O.J.; Mosahebi, A. A Systematic Review of Autologous Fat Grafting in the Treatment of Acute and Chronic Cutaneous Wounds. Plast. Reconstr. Surg. Glob. Open 2020, 8, e2835. [Google Scholar] [CrossRef]
  17. Sun, M.; He, Y.; Zhou, T.; Zhang, P.; Gao, J.; Lu, F. Adipose Extracellular Matrix/Stromal Vascular Fraction Gel Secretes Angiogenic Factors and Enhances Skin Wound Healing in a Murine Model. Biomed Res. Int. 2017, 2017, 3105780. [Google Scholar] [CrossRef]
  18. Cai, Y.; Zhang, F.; Feng, J.; Wu, B.; Li, H.; Xiao, S.; Lu, F.; Wei, Z.; Deng, C. Long-term follow-up and exploration of the mechanism of stromal vascular fraction gel in chronic wounds. Stem Cell Res. Ther. 2023, 14, 163. [Google Scholar] [CrossRef] [PubMed]
  19. Xing, N.; Yang, J.; Wang, H.; Peng, L.; Liu, X.; Chen, J.; Liu, Y. Stromal vascular fraction gel promoted wound healing and peripheral nerve repair in diabetic rats via TLRs/MyD88/NF-κB signaling pathway. J. Biomater. Appl. 2023, 38, 146–156. [Google Scholar] [CrossRef]
  20. Piccolo, N.S.; Piccolo, M.S.; Piccolo, M.T.S. Fat grafting for treatment of burns, burn scars, and other difficult wounds. Clin. Plast. Surg. 2015, 42, 263–283. [Google Scholar] [CrossRef] [PubMed]
  21. Stasch, T.; Hoehne, J.; Huynh, T.; de Baerdemaeker, R.; Grandel, S.; Herold, C. Débridement and Autologous Lipotransfer for Chronic Ulceration of the Diabetic Foot and Lower Limb Improves Wound Healing. Plast. Reconstr. Surg. 2015, 136, 1357–1366. [Google Scholar] [CrossRef]
  22. Tao, Y.; Zhao, Z.-N.; Xiang, X.-J.; Liang, Z.-X.; Zhao, Y. SVF-GEL Cryopreserved for Different Times Exhibits Varied Preservation and Regeneration Potential After Transplantation in a Mouse Model. Aesthetic Plast. Surg. 2023, 47, 842–851. [Google Scholar] [CrossRef]
  23. Feng, J.; Hu, W.; Fanai, M.L.; Zhu, S.; Wang, J.; Cai, J.; Lu, F. Mechanical process prior to cryopreservation of lipoaspirates maintains extracellular matrix integrity and cell viability: Evaluation of the retention and regenerative potential of cryopreserved fat-derived product after fat grafting. Stem Cell Res. Ther. 2019, 10, 283. [Google Scholar] [CrossRef] [PubMed]
  24. Hua, Z.; Wei, P. Letter on SVF-GEL Cryopreserved for Different Times Exhibits Varied Preservation and Regeneration Potential After Transplantation in a Mouse Model. Aesthetic Plast. Surg. 2023, 48, 49–50. [Google Scholar] [CrossRef]
  25. Cui, X.D.; Gao, D.Y.; Fink, B.F.; Vasconez, H.C.; Pu, L.L.Q. Cryopreservation of human adipose tissues. Cryobiology 2007, 55, 269–278. [Google Scholar] [CrossRef]
  26. Zhang, P.-Q.; Tan, P.-C.; Gao, Y.-M.; Zhang, X.-J.; Xie, Y.; Zheng, D.-N.; Zhou, S.-B.; Li, Q.-F. The effect of glycerol as a cryoprotective agent in the cryopreservation of adipose tissue. Stem Cell Res. Ther. 2022, 13, 152. [Google Scholar] [CrossRef] [PubMed]
  27. Moscatello, D.K.; Dougherty, M.; Narins, R.S.; Lawrence, N. Cryopreservation of human fat for soft tissue augmentation: Viability requires use of cryoprotectant and controlled freezing and storage. Dermatol. Surg. 2005, 31 Pt 2, 1506–1510. [Google Scholar] [CrossRef]
  28. Pu, L.L.Q.; Cui, X.; Fink, B.B.F.; Cibull, M.L.; Gao, D. Long-term preservation of adipose aspirates after conventional lipoplasty. Aesthetic Surg. J. 2004, 24, 536–541. [Google Scholar] [CrossRef] [PubMed]
  29. Pu, L.L.Q.; Cui, X.; Fink, B.F.; Cibull, M.L.; Gao, D. Cryopreservation of adipose tissues: The role of trehalose. Aesthetic Surg. J. 2005, 25, 126–131. [Google Scholar] [CrossRef] [PubMed]
  30. Shu, Z.; Gao, D.; Pu, L.L. Update on cryopreservation of adipose tissue and adipose-derived stem cells. Clin. Plast. Surg. 2015, 42, 209–218. [Google Scholar] [CrossRef]
  31. Roato, I.; Alotto, D.; Belisario, D.C.; Casarin, S.; Fumagalli, M.; Cambieri, I.; Piana, R.; Stella, M.; Ferracini, R.; Castagnoli, C.; et al. Adipose Derived-Mesenchymal Stem Cells Viability and Differentiating Features for Orthopaedic Reparative Applications: Banking of Adipose Tissue. Stem Cells Int. 2016, 2016, 4968724. [Google Scholar] [CrossRef] [PubMed]
  32. Brown, S.A.; Lipschitz, A.H.; Kenkel, J.M.; Sorokin, E.; Shepherd, G.; Grebe, S.; Oliver, L.K.; Luby, M.; Rohrich, R.J. Pharmacokinetics and Safety of Epinephrine Use in Liposuction. Plast. Reconstr. Surg. 2004, 114, 756–763. [Google Scholar] [CrossRef] [PubMed]
  33. Burk, R.W.; Guzman-Stein, G.; Vasconez, L.O. Lidocaine and Epinephrine Levels in Tumescent Technique Liposuction. Plast. Reconstr. Surg. 1996, 97, 1379–1384. [Google Scholar] [CrossRef]
  34. Thirumala, S.; Gimble, J.M.; Devireddy, R.V. Cryopreservation of stromal vascular fraction of adipose tissue in a serum-free freezing medium. J. Tissue Eng. Regen. Med. 2010, 4, 224–232. [Google Scholar] [CrossRef] [PubMed]
  35. Agostini, F.; Rossi, F.M.; Aldinucci, D.; Battiston, M.; Lombardi, E.; Zanolin, S.; Massarut, S.; Parodi, P.C.; Da Ponte, A.; Tessitori, G.; et al. Improved GMP compliant approach to manipulate lipoaspirates, to cryopreserve stromal vascular fraction, and to expand adipose stem cells in xeno-free media. Stem Cell Res. Ther. 2018, 9, 130. [Google Scholar] [CrossRef]
  36. Kamenaga, T.; Kuroda, Y.; Nagai, K.; Tsubosaka, M.; Takashima, Y.; Kikuchi, K.; Fujita, M.; Ikuta, K.; Anjiki, K.; Maeda, T.; et al. Cryopreserved human adipose-derived stromal vascular fraction maintains fracture healing potential via angiogenesis and osteogenesis in an immunodeficient rat model. Stem Cell Res. Ther. 2021, 12, 110. [Google Scholar] [CrossRef]
  37. Zhang, H.; Liu, Y.; Yu, B.; Lu, R. An optimized TRIzol-based method for isolating RNA from adipose tissue. BioTechniques 2023, 74, 203–209. [Google Scholar] [CrossRef]
  38. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  39. Yuan, J.S.; Reed, A.; Chen, F.; Stewart, C.N. Statistical analysis of real-time PCR data. BMC Bioinform. 2006, 7, 85. [Google Scholar] [CrossRef]
  40. Bora, P.; Majumdar, A.S. Adipose tissue-derived stromal vascular fraction in regenerative medicine: A brief review on biology and translation. Stem Cell Res. Ther. 2017, 8, 145. [Google Scholar] [CrossRef]
  41. Traktuev, D.O.; Prater, D.N.; Merfeld-Clauss, S.; Sanjeevaiah, A.R.; Saadatzadeh, M.R.; Murphy, M.; Johnstone, B.H.; Ingram, D.A.; March, K.L. Robust functional vascular network formation in vivo by cooperation of adipose progenitor and endothelial cells. Circ. Res. 2009, 104, 1410–1420. [Google Scholar] [CrossRef]
  42. Traktuev, D.O.; Merfeld-Clauss, S.; Li, J.; Kolonin, M.; Arap, W.; Pasqualini, R.; Johnstone, B.H.; March, K.L. A population of multipotent CD34-positive adipose stromal cells share pericyte and mesenchymal surface markers, reside in a periendothelial location, and stabilize endothelial networks. Circ. Res. 2008, 102, 77–85. [Google Scholar] [CrossRef]
  43. Sowa, Y.; Mazda, O.; Tsuge, I.; Inafuku, N.; Kishida, T.; Morimoto, N. Roles of adipose-derived stem cells in cell-based therapy: Current status and future scope—A narrative review. Dig. Med. Res. 2022, 5, 57. [Google Scholar] [CrossRef]
  44. Naderi, N.; Combellack, E.J.; Griffin, M.; Sedaghati, T.; Javed, M.; Findlay, M.W.; Wallace, C.G.; Mosahebi, A.; Butler, P.E.; Seifalian, A.M.; et al. The regenerative role of adipose-derived stem cells (ADSC) in plastic and reconstructive surgery. Int. Wound J. 2017, 14, 112–124. [Google Scholar] [CrossRef]
  45. Wu, S.-H.; Liao, Y.-T.; Huang, C.-H.; Chen, Y.-C.; Chiang, E.-R.; Wang, J.-P. Comparison of the Confluence-Initiated Neurogenic Differentiation Tendency of Adipose-Derived and Bone Marrow-Derived Mesenchymal Stem Cells. Biomedicines 2021, 9, 1503. [Google Scholar] [CrossRef]
  46. Zhang, T.-Y.; Tan, P.-C.; Xie, Y.; Zhang, X.-J.; Zhang, P.-Q.; Gao, Y.-M.; Zhou, S.-B.; Li, Q.-F. The combination of trehalose and glycerol: An effective and non-toxic recipe for cryopreservation of human adipose-derived stem cells. Stem Cell Res. Ther. 2020, 11, 460. [Google Scholar] [CrossRef] [PubMed]
  47. Feng, J.; Doi, K.; Kuno, S.; Mineda, K.; Kato, H.; Kinoshita, K.; Kanayama, K.; Mashiko, T.; Yoshimura, K. Micronized cellular adipose matrix as a therapeutic injectable for diabetic ulcer. Regen. Med. 2015, 10, 699–708. [Google Scholar] [CrossRef] [PubMed]
  48. Parsons, A.M.; Ciombor, D.M.; Liu, P.Y.; Darling, E.M. Regenerative Potential and Inflammation-Induced Secretion Profile of Human Adipose-Derived Stromal Vascular Cells Are Influenced by Donor Variability and Prior Breast Cancer Diagnosis. Stem Cell Rev. Rep. 2018, 14, 546–557. [Google Scholar] [CrossRef]
  49. Kim, H.; Lee, B.-K. Anti-Inflammatory Effect of Adipose-Derived Stromal Vascular Fraction on Osteoarthritic Temporomandibular Joint Synoviocytes. Tissue Eng. Regen. Med. 2020, 17, 351–362. [Google Scholar] [CrossRef] [PubMed]
  50. Zhu, M.; Xue, J.; Lu, S.; Yuan, Y.; Liao, Y.; Qiu, J.; Liu, C.; Liao, Q. Anti-inflammatory effect of stromal vascular fraction cells in fat transplantation. Exp. Ther. Med. 2019, 17, 1435–1439. [Google Scholar] [CrossRef]
Figure 1. Visualization of our standardized protocol to produce CELTPLUS fat from lipoaspirate: Lipoaspirate is allowed to sediment (1) and is subsequently transferred to a syringe (2). After centrifugation (3) the aqueous phase and the lipid phase are discarded (4), and the CELT fat is subjected to shear forces by intersyringe processing. After a second centrifugation (5) the lipids released by disrupted mature adipocytes are discarded.
Figure 1. Visualization of our standardized protocol to produce CELTPLUS fat from lipoaspirate: Lipoaspirate is allowed to sediment (1) and is subsequently transferred to a syringe (2). After centrifugation (3) the aqueous phase and the lipid phase are discarded (4), and the CELT fat is subjected to shear forces by intersyringe processing. After a second centrifugation (5) the lipids released by disrupted mature adipocytes are discarded.
Cells 14 01270 g001
Figure 2. Histological images of control CELT fat (A) and CELTPLUS fat (B). Mature adipocytes (MA), extracellular matrix (ECM), connective tissue (ct), erythrocytes (Er), vessels (V), endothelial cells (En), and other SVF cells (SVC). Left pictures are in 20-fold magnification and right pictures are clippings (red frame) in 40-fold magnification. (C) Showing mean count of mature adipocytes per 0.30 mm2 and SVF cells per 0.03 mm2.
Figure 2. Histological images of control CELT fat (A) and CELTPLUS fat (B). Mature adipocytes (MA), extracellular matrix (ECM), connective tissue (ct), erythrocytes (Er), vessels (V), endothelial cells (En), and other SVF cells (SVC). Left pictures are in 20-fold magnification and right pictures are clippings (red frame) in 40-fold magnification. (C) Showing mean count of mature adipocytes per 0.30 mm2 and SVF cells per 0.03 mm2.
Cells 14 01270 g002
Figure 3. Metabolism of the whole tissue and cell yield of the SVF. (A) Resazurin assay normalized to control CELT fat. (B) Cell count normalized to control CELT fat. (C) The fluorescence intensity from CPA-treated fat divided by the fluorescence intensity from w/o. (D) The cell counts from CPA-treated fat divided by the cell count from w/o. Please note that the y-axis of (AD) is not equally scaled. *: p ≤ 0.05; **: p ≤ 0.01; ***: p ≤ 0.001.
Figure 3. Metabolism of the whole tissue and cell yield of the SVF. (A) Resazurin assay normalized to control CELT fat. (B) Cell count normalized to control CELT fat. (C) The fluorescence intensity from CPA-treated fat divided by the fluorescence intensity from w/o. (D) The cell counts from CPA-treated fat divided by the cell count from w/o. Please note that the y-axis of (AD) is not equally scaled. *: p ≤ 0.05; **: p ≤ 0.01; ***: p ≤ 0.001.
Cells 14 01270 g003
Figure 4. PCRs from whole tissue from control fat, as well as DMSO cryopreserved fat. Important genes for graft retention and regeneration potential (PDGFRA, PDGF, VEGFR2, and VEGF), as well as for apoptosis (Bcl 2 and Caspase 3).
Figure 4. PCRs from whole tissue from control fat, as well as DMSO cryopreserved fat. Important genes for graft retention and regeneration potential (PDGFRA, PDGF, VEGFR2, and VEGF), as well as for apoptosis (Bcl 2 and Caspase 3).
Cells 14 01270 g004
Figure 5. PCRs from cell culture from control fat, as well as DMSO cryopreserved fat. Relative gene expression of marker genes for adipogenic differentiation (PPAR-γ and C/EBP) is shown.
Figure 5. PCRs from cell culture from control fat, as well as DMSO cryopreserved fat. Relative gene expression of marker genes for adipogenic differentiation (PPAR-γ and C/EBP) is shown.
Cells 14 01270 g005
Figure 6. Oil Red O staining after two weeks of differentiation. (A) All groups right after staining. The pictures were taken from spots of high density of differentiated cell conglomerates. The red bar in the bottom right corner equals 50 nm. (B) The optical density was determined by first destaining the cell cultures with 100% isopropanol and subsequently measuring the optical density of the isopropanol.
Figure 6. Oil Red O staining after two weeks of differentiation. (A) All groups right after staining. The pictures were taken from spots of high density of differentiated cell conglomerates. The red bar in the bottom right corner equals 50 nm. (B) The optical density was determined by first destaining the cell cultures with 100% isopropanol and subsequently measuring the optical density of the isopropanol.
Cells 14 01270 g006
Table 1. Primer pairs used for PCR.
Table 1. Primer pairs used for PCR.
Forward PrimerReverse Primer
GAPDHGGGAGCGAGATCCCTCCAAAATGGCTGTTGTCATACTTCTCATGG
PPAR-γCACGGAGCTGATCCCAAAGTTATAGGCTGGGCTTCCCCTT
C/EBPTATAGGCTGGGCTTCCCCTTAGCTTTCTGGTGTGACTCGG
PDGFCCCCTGCCCATTCGGAGGAAGAGTTGGCCACCTTGACGCTGCGGTG
VEGFAACCAGCAGAAAGAGGAAAGAGGCCAAAAGCAGGTCACTCACTTTG
Caspase 3GCAAACCTCAGGGAAACATTTTTTCAGGTCAACAACAGGTCCA
Bcl2ATCGCCCTGTGGATGACTGAGCAGCCAGGAGAAATCAAACAGAGG
VEGEFR2AATCTCTGGTGGAAGCCACGTCTGGGGTGGGACATACACA
PDGFRAGGGCACGCTCTTTACTCCATGCTCTGGGAAACTTCTCCTCC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Schimanski, T.; Prantl, L.; Eigenberger, A.; Felthaus, O.; Loucas, R.; Utpatel, K.; Steer, K. CELTPLUS Fat Increases the Metabolic Activity as Well as the SVF-Yield Significantly When Compared to CELT Fat, Even After Cryopreservation with DMSO. Cells 2025, 14, 1270. https://doi.org/10.3390/cells14161270

AMA Style

Schimanski T, Prantl L, Eigenberger A, Felthaus O, Loucas R, Utpatel K, Steer K. CELTPLUS Fat Increases the Metabolic Activity as Well as the SVF-Yield Significantly When Compared to CELT Fat, Even After Cryopreservation with DMSO. Cells. 2025; 14(16):1270. https://doi.org/10.3390/cells14161270

Chicago/Turabian Style

Schimanski, Tom, Lukas Prantl, Andreas Eigenberger, Oliver Felthaus, Rafael Loucas, Kirsten Utpatel, and Kerstin Steer. 2025. "CELTPLUS Fat Increases the Metabolic Activity as Well as the SVF-Yield Significantly When Compared to CELT Fat, Even After Cryopreservation with DMSO" Cells 14, no. 16: 1270. https://doi.org/10.3390/cells14161270

APA Style

Schimanski, T., Prantl, L., Eigenberger, A., Felthaus, O., Loucas, R., Utpatel, K., & Steer, K. (2025). CELTPLUS Fat Increases the Metabolic Activity as Well as the SVF-Yield Significantly When Compared to CELT Fat, Even After Cryopreservation with DMSO. Cells, 14(16), 1270. https://doi.org/10.3390/cells14161270

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop