Generation of Individualized, Standardized, and Electrically Synchronized Human Midbrain Organoids
Abstract
1. Introduction
2. Materials and Methods
2.1. Generation and Culture of Human Brain Organoids
2.1.1. Embryonic Stem Cell Culture and Differentiation
2.1.2. Midbrain Organoids Culture and Differentiation
Generation and Culture of Midbrain Organoids by Forced Aggregation Followed by Immersion (3D-i) [27,28]
Generation and Culture of Midbrain Organoids by Using AirLiwell Technology (3D-ALi) [43]
2.2. Comprehensive Content Analysis of Organoids (Scheme 2)
2.2.1. Bulk RNA Sequencing: Sample Preparation
2.2.2. Bulk RNA-Sequencing Analysis
Library Preparation, Sequencing and Read Mapping to the Reference Genome
Unique Gene Model Construction and Gene Coverage Reporting
RNAseq Analysis
Gene Ontology and/or Pathways Analysis
GSEA: Gene Set/Pathway Enrichment Analysis
De Novo Motif Discovery and Motif Enrichment Analysis
2.2.3. Quantitative RT PCR
2.2.4. Sample Preparation for Single-Cell RNA Sequencing
2.2.5. Single-Cell RNA Sequencing Analysis
2.2.6. Midbrain Organoids Plating on Extracellular Matrix, Immunocytochemistry, and Electron Microscopy
2.2.7. Electrophysiology by Micro-Electrode Array (MEA)
2.2.8. Dopamine Dosage by HPLC
2.2.9. Statistical Analyses
3. Results
3.1. Midbrain Organoids Generated at Air–Liquid Interface Are Highly Standardized
3.2. Bulk RNA Sequencing Confirmed and Showed a Better Neural/Midbrain Specification
3.3. Histological Comparison Reveals Enhanced Homogeneity in 3D-ALi Organoids
3.4. Single Cell Analysis of Organoids Showed a Significantly Higher Yields of Neuronal Cells
3.5. 3D-ALi Organoids Are Electrically Active and Showed a Higher Degree of Synchronization
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lokai, T.; Albin, B.; Qubbaj, K.; Tiwari, A.P.; Adhikari, P.; Yang, I.H. A review on current brain organoid technologies from a biomedical engineering perspective. Exp. Neurol. 2023, 367, 114461. [Google Scholar] [CrossRef] [PubMed]
- Smits, L.M.; Reinhardt, L.; Reinhardt, P.; Glatza, M.; Monzel, A.S.; Stanslowsky, N.; Rosato-Siri, M.D.; Zanon, A.; Antony, P.M.; Bellmann, J.; et al. Modeling Parkinson’s disease in midbrain-like organoids. npj Park. Dis. 2019, 5, 5. [Google Scholar] [CrossRef]
- Jo, J.; Xiao, Y.; Sun, A.X.; Cukuroglu, E.; Tran, H.D.; Goke, J.; Tan, Z.Y.; Saw, T.Y.; Tan, C.P.; Lokman, H.; et al. Midbrain-like Organoids from Human Pluripotent Stem Cells Contain Functional Dopaminergic and Neuromelanin-Producing Neurons. Cell Stem Cell 2016, 19, 248–257. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.P.; Wang, X.Y.; Wang, S.N.; Miao, C.Y. The generation and properties of human cortical organoids as a disease model for malformations of cortical development. Neural Regen. Res. 2023, 18, 2119–2126. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.Q.; Zeng, L.H.; Li, C.T.; He, D.H.; Zhao, H.D.; Xu, Y.N.; Jin, Z.T.; Gao, C. Brain organoids are new tool for drug screening of neurological diseases. Neural Regen. Res. 2023, 18, 1884–1889. [Google Scholar] [CrossRef]
- Renner, H.; Grabos, M.; Becker, K.J.; Kagermeier, T.E.; Wu, J.; Otto, M.; Peischard, S.; Zeuschner, D.; TsyTsyura, Y.; Disse, P.; et al. A fully automated high-throughput workflow for 3D-based chemical screening in human midbrain organoids. eLife 2020, 9, e52904. [Google Scholar] [CrossRef]
- Patikas, N.; Ansari, R.; Metzakopian, E. Single-cell transcriptomics identifies perturbed molecular pathways in midbrain organoids using alpha-synuclein triplication Parkinson’s disease patient-derived iPSCs. Neurosci. Res. 2023, 195, 13–28. [Google Scholar] [CrossRef]
- Zheng, X.; Han, D.; Liu, W.; Wang, X.; Pan, N.; Wang, Y.; Chen, Z. Human iPSC-derived midbrain organoids functionally integrate into striatum circuits and restore motor function in a mouse model of Parkinson’s disease. Theranostics 2023, 13, 2673–2692. [Google Scholar] [CrossRef]
- Sonntag, K.C.; Song, B.; Lee, N.; Jung, J.H.; Cha, Y.; Leblanc, P.; Neff, C.; Kong, S.W.; Carter, B.S.; Schweitzer, J.; et al. Pluripotent stem cell-based therapy for Parkinson’s disease: Current status and future prospects. Prog. Neurobiol. 2018, 168, 1–20. [Google Scholar] [CrossRef]
- Ambasudhan, R.; Dolatabadi, N.; Nutter, A.; Masliah, E.; McKercher, S.R.; Lipton, S.A. Potential for cell therapy in Parkinson’s disease using genetically programmed human embryonic stem cell-derived neural progenitor cells. J. Comp. Neurol. 2014, 522, 2845–2856. [Google Scholar] [CrossRef]
- Guo, X.; Tang, L.; Tang, X. Current Developments in Cell Replacement Therapy for Parkinson’s Disease. Neuroscience 2021, 463, 370–382. [Google Scholar] [CrossRef]
- Foty, R. A simple hanging drop cell culture protocol for generation of 3D spheroids. J. Vis. Exp. 2011, 51, e2720. [Google Scholar] [CrossRef]
- Amaral, R.L.F.; Miranda, M.; Marcato, P.D.; Swiech, K. Comparative Analysis of 3D Bladder Tumor Spheroids Obtained by Forced Floating and Hanging Drop Methods for Drug Screening. Front. Physiol. 2017, 8, 605. [Google Scholar] [CrossRef]
- Gava, F.; Faria, C.; Gravelle, P.; Valero, J.G.; Dobano-Lopez, C.; Morin, R.; Norlund, M.; Gomes, A.; Lagarde, J.M.; Rossi, C.; et al. 3D Model Characterization by 2D and 3D Imaging in t(14;18)-Positive B-NHL: Perspectives for In Vitro Drug Screens in Follicular Lymphoma. Cancers 2021, 13, 1490. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.I.; Yeo, S.I.; Kim, B.B.; Ko, Y.; Park, J.B. Formation of size-controllable spheroids using gingiva-derived stem cells and concave microwells: Morphology and viability tests. Biomed. Rep. 2016, 4, 97–101. [Google Scholar] [CrossRef] [PubMed]
- Gong, X.; Lin, C.; Cheng, J.; Su, J.; Zhao, H.; Liu, T.; Wen, X.; Zhao, P. Generation of Multicellular Tumor Spheroids with Microwell-Based Agarose Scaffolds for Drug Testing. PLoS ONE 2015, 10, e0130348. [Google Scholar] [CrossRef] [PubMed]
- Dhamecha, D.; Le, D.; Chakravarty, T.; Perera, K.; Dutta, A.; Menon, J.U. Fabrication of PNIPAm-based thermoresponsive hydrogel microwell arrays for tumor spheroid formation. Mater. Sci. Eng. C Mater. Biol. Appl. 2021, 125, 112100. [Google Scholar] [CrossRef]
- Razian, G.; Yu, Y.; Ungrin, M. Production of large numbers of size-controlled tumor spheroids using microwell plates. J. Vis. Exp. 2013, 81, e50665. [Google Scholar] [CrossRef]
- Parfenov, V.A.; Khesuani, Y.D.; Petrov, S.V.; Karalkin, P.A.; Koudan, E.V.; Nezhurina, E.K.; Pereira, F.D.; Krokhmal, A.A.; Gryadunova, A.A.; Bulanova, E.A.; et al. Magnetic levitational bioassembly of 3D tissue construct in space. Sci. Adv. 2020, 6, eaba4174. [Google Scholar] [CrossRef]
- Ferreira, L.P.; Gaspar, V.M.; Mano, J.F. Decellularized Extracellular Matrix for Bioengineering Physiomimetic 3D in Vitro Tumor Models. Trends Biotechnol. 2020, 38, 1397–1414. [Google Scholar] [CrossRef]
- Hume, R.D.; Pensa, S.; Brown, E.J.; Kreuzaler, P.A.; Hitchcock, J.; Husmann, A.; Campbell, J.J.; Lloyd-Thomas, A.O.; Cameron, R.E.; Watson, C.J. Tumour cell invasiveness and response to chemotherapeutics in adipocyte invested 3D engineered anisotropic collagen scaffolds. Sci. Rep. 2018, 8, 12658. [Google Scholar] [CrossRef]
- Taubenberger, A.V.; Bray, L.J.; Haller, B.; Shaposhnykov, A.; Binner, M.; Freudenberg, U.; Guck, J.; Werner, C. 3D extracellular matrix interactions modulate tumour cell growth, invasion and angiogenesis in engineered tumour microenvironments. Acta Biomater. 2016, 36, 73–85. [Google Scholar] [CrossRef] [PubMed]
- LeSavage, B.L.; Suhar, R.A.; Broguiere, N.; Lutolf, M.P.; Heilshorn, S.C. Next-generation cancer organoids. Nat. Mater. 2022, 21, 143–159. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.; Min, S.; Choi, Y.S.; Jo, S.H.; Jung, J.H.; Han, K.; Kim, J.; An, S.; Ji, Y.W.; Kim, Y.G.; et al. Tissue extracellular matrix hydrogels as alternatives to Matrigel for culturing gastrointestinal organoids. Nat. Commun. 2022, 13, 1692. [Google Scholar] [CrossRef] [PubMed]
- Giobbe, G.G.; Crowley, C.; Luni, C.; Campinoti, S.; Khedr, M.; Kretzschmar, K.; De Santis, M.M.; Zambaiti, E.; Michielin, F.; Meran, L.; et al. Extracellular matrix hydrogel derived from decellularized tissues enables endodermal organoid culture. Nat. Commun. 2019, 10, 5658. [Google Scholar] [CrossRef]
- Heo, J.H.; Kang, D.; Seo, S.J.; Jin, Y. Engineering the Extracellular Matrix for Organoid Culture. Int. J. Stem Cells 2022, 15, 60–69. [Google Scholar] [CrossRef]
- Tieng, V.; Stoppini, L.; Villy, S.; Fathi, M.; Dubois-Dauphin, M.; Krause, K.H. Engineering of midbrain organoids containing long-lived dopaminergic neurons. Stem Cells Dev. 2014, 23, 1535–1547. [Google Scholar] [CrossRef]
- Cosset, E.; Locatelli, M.; Marteyn, A.; Lescuyer, P.; Dall Antonia, F.; Mor, F.M.; Preynat-Seauve, O.; Stoppini, L.; Tieng, V. Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases. J. Vis. Exp. 2019, 148, e59682. [Google Scholar] [CrossRef]
- Velasco, V.; Shariati, S.A.; Esfandyarpour, R. Microtechnology-based methods for organoid models. Microsyst. Nanoeng. 2020, 6, 76. [Google Scholar] [CrossRef]
- Kim, J.B. Three-dimensional tissue culture models in cancer biology. Semin. Cancer Biol. 2005, 15, 365–377. [Google Scholar] [CrossRef]
- Kumar, A.; Starly, B. Large scale industrialized cell expansion: Producing the critical raw material for biofabrication processes. Biofabrication 2015, 7, 044103. [Google Scholar] [CrossRef] [PubMed]
- Chen, M.; Niclis, J.C.; Denham, M. Protocol for generating reproducible miniaturized controlled midbrain organoids. STAR Protoc. 2023, 4, 102451. [Google Scholar] [CrossRef] [PubMed]
- Lin, R.Z.; Chang, H.Y. Recent advances in three-dimensional multicellular spheroid culture for biomedical research. Biotechnol. J. 2008, 3, 1172–1184. [Google Scholar] [CrossRef] [PubMed]
- Malda, J.; Klein, T.J.; Upton, Z. The roles of hypoxia in the in vitro engineering of tissues. Tissue Eng. 2007, 13, 2153–2162. [Google Scholar] [CrossRef]
- Volkmer, E.; Drosse, I.; Otto, S.; Stangelmayer, A.; Stengele, M.; Kallukalam, B.C.; Mutschler, W.; Schieker, M. Hypoxia in static and dynamic 3D culture systems for tissue engineering of bone. Tissue Eng. Part A 2008, 14, 1331–1340. [Google Scholar] [CrossRef]
- Kultz, D. Molecular and evolutionary basis of the cellular stress response. Annu. Rev. Physiol. 2005, 67, 225–257. [Google Scholar] [CrossRef]
- Mohyeldin, A.; Garzon-Muvdi, T.; Quinones-Hinojosa, A. Oxygen in stem cell biology: A critical component of the stem cell niche. Cell Stem Cell 2010, 7, 150–161. [Google Scholar] [CrossRef]
- Qian, X.; Song, H.; Ming, G.L. Brain organoids: Advances, applications and challenges. Development 2019, 146, dev166074. [Google Scholar] [CrossRef]
- Giandomenico, S.L.; Mierau, S.B.; Gibbons, G.M.; Wenger, L.M.D.; Masullo, L.; Sit, T.; Sutcliffe, M.; Boulanger, J.; Tripodi, M.; Derivery, E.; et al. Cerebral organoids at the air-liquid interface generate diverse nerve tracts with functional output. Nat. Neurosci. 2019, 22, 669–679. [Google Scholar] [CrossRef]
- Qian, X.; Su, Y.; Adam, C.D.; Deutschmann, A.U.; Pather, S.R.; Goldberg, E.M.; Su, K.; Li, S.; Lu, L.; Jacob, F.; et al. Sliced Human Cortical Organoids for Modeling Distinct Cortical Layer Formation. Cell Stem Cell 2020, 26, 766–781.e9. [Google Scholar] [CrossRef]
- Vertesy, A.; Eichmuller, O.L.; Naas, J.; Novatchkova, M.; Esk, C.; Balmana, M.; Ladstaetter, S.; Bock, C.; von Haeseler, A.; Knoblich, J.A. Gruffi: An algorithm for computational removal of stressed cells from brain organoid transcriptomic datasets. EMBO J. 2022, 41, e111118. [Google Scholar] [CrossRef]
- Vives, J.; Batlle-Morera, L. The challenge of developing human 3D organoids into medicines. Stem Cell Res. Ther. 2020, 11, 72. [Google Scholar] [CrossRef]
- El Harane, S.; Durual, S.; Braschler, T.; Andre-Levigne, D.; Brembilla, N.; Krause, K.H.; Modarressi, A.; Preynat-Seauve, O. Adipose-derived stem cell spheroids are superior to single-cell suspensions to improve fat autograft long-term survival. J. Cell Mol. Med. 2022, 26, 1421–1433. [Google Scholar] [CrossRef] [PubMed]
- Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics 2013, 29, 15–21. [Google Scholar] [CrossRef] [PubMed]
- Liao, Y.; Smyth, G.K.; Shi, W. featureCounts: An efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 2014, 30, 923–930. [Google Scholar] [CrossRef]
- Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26, 139–140. [Google Scholar] [CrossRef]
- R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2018. [Google Scholar]
- Mootha, V.K.; Lindgren, C.M.; Eriksson, K.F.; Subramanian, A.; Sihag, S.; Lehar, J.; Puigserver, P.; Carlsson, E.; Ridderstrale, M.; Laurila, E.; et al. PGC-1alpha-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes. Nat. Genet. 2003, 34, 267–273. [Google Scholar] [CrossRef]
- Subramanian, A.; Tamayo, P.; Mootha, V.K.; Mukherjee, S.; Ebert, B.L.; Gillette, M.A.; Paulovich, A.; Pomeroy, S.L.; Golub, T.R.; Lander, E.S.; et al. Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. USA 2005, 102, 15545–15550. [Google Scholar] [CrossRef]
- Bembom, O.; Keles, S.; van der Laan, M.J. Supervised detection of conserved motifs in DNA sequences with cosmo. Stat. Appl. Genet. Mol. Biol. 2007, 6, Article 8. [Google Scholar] [CrossRef]
- Zambelli, F.; Pesole, G.; Pavesi, G. Pscan: Finding over-represented transcription factor binding site motifs in sequences from co-regulated or co-expressed genes. Nucleic Acids Res. 2009, 37, W247–W252. [Google Scholar] [CrossRef]
- Sandelin, A.; Alkema, W.; Engstrom, P.; Wasserman, W.W.; Lenhard, B. JASPAR: An open-access database for eukaryotic transcription factor binding profiles. Nucleic Acids Res. 2004, 32, D91–D94. [Google Scholar] [CrossRef] [PubMed]
- Smith, T.; Heger, A.; Sudbery, I. UMI-tools: Modeling sequencing errors in Unique Molecular Identifiers to improve quantification accuracy. Genome Res. 2017, 27, 491–499. [Google Scholar] [CrossRef] [PubMed]
- Satija, R.; Farrell, J.A.; Gennert, D.; Schier, A.F.; Regev, A. Spatial reconstruction of single-cell gene expression data. Nat. Biotechnol. 2015, 33, 495–502. [Google Scholar] [CrossRef] [PubMed]
- Stuart, T.; Butler, A.; Hoffman, P.; Hafemeister, C.; Papalexi, E.; Mauck, W.M., 3rd; Hao, Y.; Stoeckius, M.; Smibert, P.; Satija, R. Comprehensive Integration of Single-Cell Data. Cell 2019, 177, 1888–1902.e21. [Google Scholar] [CrossRef]
- Han, X.; Wang, R.; Zhou, Y.; Fei, L.; Sun, H.; Lai, S.; Saadatpour, A.; Zhou, Z.; Chen, H.; Ye, F.; et al. Mapping the Mouse Cell Atlas by Microwell-Seq. Cell 2018, 172, 1091–1107.e17. [Google Scholar] [CrossRef]
- Stoppini, L.; Heuschkel, M.O.; Loussert-Fonta, C.; Gomez Baisac, L.; Roux, A. Versatile micro-e lectrode array to monitor human iPSC derived 3D neural tissues at air-liquid interface. Front. Cell Neurosci. 2024, 18, 1389580. [Google Scholar] [CrossRef]
- Domanskyi, A.; Alter, H.; Vogt, M.A.; Gass, P.; Vinnikov, I.A. Transcription factors Foxa1 and Foxa2 are required for adult dopamine neurons maintenance. Front. Cell Neurosci. 2014, 8, 275. [Google Scholar] [CrossRef]
- Ferri, A.L.; Lin, W.; Mavromatakis, Y.E.; Wang, J.C.; Sasaki, H.; Whitsett, J.A.; Ang, S.L. Foxa1 and Foxa2 regulate multiple phases of midbrain dopaminergic neuron development in a dosage-dependent manner. Development 2007, 134, 2761–2769. [Google Scholar] [CrossRef]
- Friedman, J.R.; Kaestner, K.H. The Foxa family of transcription factors in development and metabolism. Cell Mol. Life Sci. 2006, 63, 2317–2328. [Google Scholar] [CrossRef]
- Anderegg, A.; Poulin, J.F.; Awatramani, R. Molecular heterogeneity of midbrain dopaminergic neurons—Moving toward single cell resolution. FEBS Lett. 2015, 589, 3714–3726. [Google Scholar] [CrossRef]
- Saucedo-Cardenas, O.; Quintana-Hau, J.D.; Le, W.D.; Smidt, M.P.; Cox, J.J.; De Mayo, F.; Burbach, J.P.; Conneely, O.M. Nurr1 is essential for the induction of the dopaminergic phenotype and the survival of ventral mesencephalic late dopaminergic precursor neurons. Proc. Natl. Acad. Sci. USA 1998, 95, 4013–4018. [Google Scholar] [CrossRef]
- Alves dos Santos, M.T.; Smidt, M.P. En1 and Wnt signaling in midbrain dopaminergic neuronal development. Neural Dev. 2011, 6, 23. [Google Scholar] [CrossRef] [PubMed]
- Sonnier, L.; Le Pen, G.; Hartmann, A.; Bizot, J.C.; Trovero, F.; Krebs, M.O.; Prochiantz, A. Progressive loss of dopaminergic neurons in the ventral midbrain of adult mice heterozygote for Engrailed1. J. Neurosci. 2007, 27, 1063–1071. [Google Scholar] [CrossRef]
- Grassi, L.; Alfonsi, R.; Francescangeli, F.; Signore, M.; De Angelis, M.L.; Addario, A.; Costantini, M.; Flex, E.; Ciolfi, A.; Pizzi, S.; et al. Organoids as a new model for improving regenerative medicine and cancer personalized therapy in renal diseases. Cell Death Dis. 2019, 10, 201. [Google Scholar] [CrossRef] [PubMed]
- Preynat-Seauve, O.; Suter, D.M.; Tirefort, D.; Turchi, L.; Virolle, T.; Chneiweiss, H.; Foti, M.; Lobrinus, J.A.; Stoppini, L.; Feki, A.; et al. Development of human nervous tissue upon differentiation of embryonic stem cells in three-dimensional culture. Stem Cells 2009, 27, 509–520. [Google Scholar] [CrossRef]
- Binh, N.H.; Aoki, H.; Takamatsu, M.; Hatano, Y.; Hirata, A.; Tomita, H.; Hara, A. Time-sensitive effects of hypoxia on differentiation of neural stem cells derived from mouse embryonic stem cells in vitro. Neurol. Res. 2014, 36, 804–813. [Google Scholar] [CrossRef]
- Steenland, H.W.; McNaughton, B.L. Techniques for Large-Scale Multiunit Recording. In Analysis and Modeling of Coordinated Multi-Neuronal Activity; Tatsuno, M., Ed.; Springer: New York, NY, USA, 2015; pp. 3–39. [Google Scholar]
- Deriche, M.; Arafat, S.; Al-Insaif, S.; Siddiqui, M. Eigenspace Time Frequency Based Features for Accurate Seizure Detection from EEG Data. IRBM 2019, 40, 122–132. [Google Scholar] [CrossRef]
- Harpale, V.; Bairagi, V. An adaptive method for feature selection and extraction for classification of epileptic EEG signal in significant states. J. King Saud. Univ.—Comput. Inf. Sci. 2021, 33, 668–676. [Google Scholar] [CrossRef]
- Fang, X.; Chen, Y.; Wang, J.; Zhang, Z.; Bai, Y.; Denney, K.; Gan, L.; Guo, M.; Weintraub, N.L.; Lei, Y.; et al. Increased intrinsic and synaptic excitability of hypothalamic POMC neurons underlies chronic stress-induced behavioral deficits. Mol. Psychiatry 2023, 28, 1365–1382. [Google Scholar] [CrossRef]
- Valenti, O.; Gill, K.M.; Grace, A.A. Different stressors produce excitation or inhibition of mesolimbic dopamine neuron activity: Response alteration by stress pre-exposure. Eur. J. Neurosci. 2012, 35, 1312–1321. [Google Scholar] [CrossRef]
- Khazipov, R. GABAergic Synchronization in Epilepsy. Cold Spring Harb. Perspect. Med. 2016, 6, a022764. [Google Scholar] [CrossRef]
- Xu, M.Y.; Wong, A.H.C. GABAergic inhibitory neurons as therapeutic targets for cognitive impairment in schizophrenia. Acta Pharmacol. Sin. 2018, 39, 733–753. [Google Scholar] [CrossRef]
Gene | Primer Sequence (Forward) | Primer Sequence (Reverse) |
---|---|---|
Ki-67 | AAGCCCTCCAGCTCCTAGTC | TCCGAAGCACCACTTCTTCT |
MAP-2 | CGAAGCGCCAATGGATTCC | TGAACTATCCTTGCAGACACCT |
TH | GCACCTTCGCGCAGTTCT | CCCGAACTCCACCGTGAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
El Harane, S.; Nazari, B.; El Harane, N.; Locatelli, M.; Zidi, B.; Durual, S.; Karmime, A.; Ravier, F.; Roux, A.; Stoppini, L.; et al. Generation of Individualized, Standardized, and Electrically Synchronized Human Midbrain Organoids. Cells 2025, 14, 1211. https://doi.org/10.3390/cells14151211
El Harane S, Nazari B, El Harane N, Locatelli M, Zidi B, Durual S, Karmime A, Ravier F, Roux A, Stoppini L, et al. Generation of Individualized, Standardized, and Electrically Synchronized Human Midbrain Organoids. Cells. 2025; 14(15):1211. https://doi.org/10.3390/cells14151211
Chicago/Turabian StyleEl Harane, Sanae, Bahareh Nazari, Nadia El Harane, Manon Locatelli, Bochra Zidi, Stéphane Durual, Abderrahim Karmime, Florence Ravier, Adrien Roux, Luc Stoppini, and et al. 2025. "Generation of Individualized, Standardized, and Electrically Synchronized Human Midbrain Organoids" Cells 14, no. 15: 1211. https://doi.org/10.3390/cells14151211
APA StyleEl Harane, S., Nazari, B., El Harane, N., Locatelli, M., Zidi, B., Durual, S., Karmime, A., Ravier, F., Roux, A., Stoppini, L., Preynat-Seauve, O., & Krause, K.-H. (2025). Generation of Individualized, Standardized, and Electrically Synchronized Human Midbrain Organoids. Cells, 14(15), 1211. https://doi.org/10.3390/cells14151211