Nobiletin Ameliorates Aging of Chicken Ovarian Prehierarchical Follicles by Suppressing Oxidative Stress and Promoting Autophagy
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals and Follicle Collection
2.2. Culture of SWFs and Treatments
2.3. Morphological Observation
2.4. Immunofluorescence Staining
2.5. Western Blot Analysis
2.6. RNA Extraction and Quantitative Real-Time PCR
2.7. Measurement of Oxidative Parameters and ATP Level
2.8. Transmission Electron Microscopy
2.9. Statistical Analysis
3. Results
3.1. Morphological, Proliferative, Apoptotic, and Laying Performance Alterations Associated with Aging in SWFs
3.2. Establishment of the SWF Aging Model
3.3. Effect of Different Concentrations of Nob on D-Gal-Induced Senescence of SWFs
3.4. Effects of Nob on the D-Gal-Induced Aging in SWFs
3.5. Effect of Nob on D-Gal-Induced Aging SWFs’ Protection and Decreased Antioxidant Capacity
3.6. Effect of Nob on Down-Regulation of AMPK and SIRT1 Pathways in the D-Gal-Induced Senescent SWFs
3.7. Nob Attenuates the Mitochondrial Damage Induced by D-Gal in SWF-GCs through the Activation of Mitophagy via AMPK and SIRT1 Pathways
3.8. The Effect of Nob on Delaying Natural Ovarian Aging Is Achieved by Activating Mitophagy
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Tatone, C.; Amicarelli, F. The aging ovary-the poor granulosa cells. Fertil. Steril. 2013, 99, 12–17. [Google Scholar] [CrossRef]
- Li, F.; Chen, Y.; Li, Y.; Huang, M.; Zhao, W. Geniposide alleviates diabetic nephropathy of mice through AMPK/SIRT1/NF-κB pathway. Eur. J. Pharmacol. 2020, 886, 173449. [Google Scholar] [CrossRef]
- Liu, X.; Lin, X.; Zhang, S.; Guo, C.; Li, J.; Mi, Y.; Zhang, C. Lycopene ameliorates oxidative stress in the aging chicken ovary via activation of Nrf2/HO-1 pathway. Aging 2018, 10, 2016–2036. [Google Scholar] [CrossRef]
- Liu, X.; Lin, X.; Mi, Y.; Li, J.; Zhang, C. Grape seed proanthocyanidin extract prevents ovarian aging by inhibiting oxidative stress in the hens. Oxid. Med. Cell. Longev. 2018, 2018, 9390810. [Google Scholar] [CrossRef]
- Wang, S.; Zheng, Y.; Li, J.; Yu, Y.; Zhang, W.; Song, M.; Liu, Z.; Min, Z.; Hu, H.; Jing, Y.; et al. Single-cell transcriptomic atlas of primate ovarian aging. Cell 2020, 180, 585–600.e19. [Google Scholar] [CrossRef] [PubMed]
- Hajam, Y.; Rani, R.; Ganie, S.; Sheikh, T.; Javaid, D.; Qadri, S.; Pramodh, S.; Alsulimani, A.; Alkhanani, M.; Harakeh, S.; et al. Oxidative stress in human pathology and aging: Molecular mechanisms and perspectives. Cells 2022, 11, 552. [Google Scholar] [CrossRef]
- Sobinoff, A.P.; Beckett, E.L.; Jarnicki, A.G.; Sutherland, J.M.; McCluskey, A.; Hansbro, P.M.; McLaughlin, E.A. Scrambled and fried: Cigarette smoke exposure causes antral follicle destruction and oocyte dysfunction through oxidative stress. Toxicol. Appl. Pharmacol. 2013, 271, 156–167. [Google Scholar] [CrossRef]
- Ben-Meir, A.; Burstein, E.; Borrego-Alvarez, A.; Chong, J.; Wong, E.; Yavorska, T.; Naranian, T.; Chi, M.; Wang, Y.; Bentov, Y.; et al. Coenzyme Q10 restores oocyte mitochondrial function and fertility during reproductive aging. Aging Cell 2015, 14, 887–895. [Google Scholar] [CrossRef] [PubMed]
- An, R.; Wang, X.; Yang, L.; Zhang, J.; Wang, N.; Xu, F.; Hou, Y.; Zhang, H.; Zhang, L. Polystyrene microplastics cause granulosa cells apoptosis and fibrosis in ovary through oxidative stress in rats. Toxicology 2021, 449, 152665. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Yang, C.; Elsheikh, N.; Li, C.; Yang, F.; Wang, G.; Li, L. HO-1 reduces heat stress-induced apoptosis in bovine granulosa cells by suppressing oxidative stress. Aging 2019, 11, 5535–5547. [Google Scholar] [CrossRef]
- Gu, Y.; Han, J.; Jiang, C.; Zhang, Y. Biomarkers, oxidative stress and autophagy in skin aging. Ageing Res. Rev. 2020, 59, 101036. [Google Scholar] [CrossRef]
- Ornatowski, W.; Lu, Q.; Yegambaram, M.; Garcia, A.E.; Zemskov, E.A.; Maltepe, E.; Fineman, J.R.; Wang, T.; Black, S.M. Complex interplay between autophagy and oxidative stress in the development of pulmonary disease. Redox Biol. 2020, 36, 101679. [Google Scholar] [CrossRef]
- Patel, J.; Baptiste, B.A.; Kim, E.; Hussain, M.; Croteau, D.L.; Bohr, V.A. DNA damage and mitochondria in cancer and aging. Carcinogenesis 2020, 41, 1625–1634. [Google Scholar] [CrossRef]
- van der Reest, J.; Nardini, C.; Haigis, M.C.; Kordowitzki, P. Mitochondria: Their relevance during oocyte ageing. Ageing Res. Rev. 2021, 70, 101378. [Google Scholar] [CrossRef]
- Kirillova, A.; Smitz, J.; Sukhikh, G.T.; Mazunin, I. The Role of mitochondria in oocyte maturation. Cells 2021, 10, 2484. [Google Scholar] [CrossRef]
- Das, M.; Sauceda, C.; Webster, N. Mitochondrial dysfunction in obesity and reproduction. Endocrinology 2021, 162, bqaa158. [Google Scholar] [CrossRef]
- Li, C.; Lin, L.; Tsai, H.; Wen, Z.; Tsui, K. Phosphoglycerate mutase family member 5 maintains oocyte quality via mitochondrial dynamic rearrangement during aging. Aging Cell 2022, 21, e13546. [Google Scholar] [CrossRef]
- Dong, J.; Guo, C.; Yang, Z.; Wu, Y.; Zhang, C. Follicle-stimulating hormone alleviates ovarian aging by modulating mitophagy- and glycophagy-based energy metabolism in hens. Cells 2022, 11, 3270. [Google Scholar] [CrossRef]
- Yan, Z.; Dai, Y.; Fu, H.; Zheng, Y.; Bao, D.; Yin, Y.; Chen, Q.; Nie, X.; Hao, Q.; Hou, D.; et al. Curcumin exerts a protective effect against premature ovarian failure in mice. J. Mol. Endocrinol. 2018, 60, 261–271. [Google Scholar] [CrossRef]
- Chen, P.; Chen, F.; Lei, J.; Li, Q.; Zhou, B. Activation of the miR-34a-mediated SIRT1/mTOR signaling pathway by urolithin a attenuates D-galactose-induced brain aging in mice. Neurotherapeutics 2019, 16, 1269–1282. [Google Scholar] [CrossRef]
- Kim, E.; Lim, J.; Kim, M.; Ban, T.; Jang, I.; Yoon, H.; Park, C.; Chang, Y.; Choi, B. Resveratrol, an Nrf2 activator, ameliorates aging-related progressive renal injury. Aging 2018, 10, 83–99. [Google Scholar] [CrossRef]
- Cajas, Y.N.; Cañón-Beltrán, K.; Ladrón de Guevara, M.; Millán de la Blanca, M.G.; Ramos-Ibeas, P.; Gutiérrez-Adán, A.; Rizos, D.; González, E.M. Antioxidant nobiletin enhances oocyte maturation and subsequent embryo development and quality. Int. J. Mol. Sci. 2020, 21, 5340. [Google Scholar] [CrossRef]
- Li, S.; Li, X.; Chen, F.; Liu, M.; Ning, L.; Yan, Y.; Zhang, S.; Huang, S.; Tu, C. Nobiletin mitigates hepatocytes death, liver inflammation, and fibrosis in a murine model of NASH through modulating hepatic oxidative stress and mitochondrial dysfunction. J. Nutr. Biochem. 2022, 100, 108888. [Google Scholar] [CrossRef]
- Wang, D.; Gao, F.; Hu, F.; Wu, J. Nobiletin alleviates astrocyte activation and oxidative stress induced by hypoxia in vitro. Molecules 2022, 27, 1962. [Google Scholar] [CrossRef]
- Dusabimana, T.; Kim, S.; Kim, H.; Park, S.; Kim, H. Nobiletin ameliorates hepatic ischemia and reperfusion injury through the activation of SIRT1/FOXO3a-mediated autophagy and mitochondrial biogenesis. Exp. Mol. Med. 2019, 51, 1–16. [Google Scholar] [CrossRef]
- Wu, Y.; Zhou, S.; Zhao, A.; Mi, Y.; Zhang, C. Protective effect of rutin on ferroptosis-induced oxidative stress in aging laying hens through Nrf2/HO-1 signaling. Cell Biol. Int. 2023, 47, 598–611. [Google Scholar] [CrossRef]
- Miwa, S.; Kashyap, S.; Chini, E.; Von, Z. Mitochondrial dysfunction in cell senescence and aging. J. Clin. Investig. 2022, 132, e158447. [Google Scholar] [CrossRef]
- Kala, M.; Shaikh, M.; Nivsarkar, M. Equilibrium between anti-oxidants and reactive oxygen species: A requisite for oocyte development and maturation. Reprod. Med. Biol. 2016, 16, 28–35. [Google Scholar] [CrossRef]
- Luderer, U. Ovarian toxicity from reactive oxygen species. Vitam. Horm. 2014, 94, 99–127. [Google Scholar]
- Nagata, S.; Tatematsu, K.; Kansaku, K.; Inoue, Y.; Kobayashi, M.; Shirasuna, K.; Iwata, H. Effect of aging on mitochondria and metabolism of bovine granulosa cells. J. Reprod. Dev. 2020, 66, 547–554. [Google Scholar] [CrossRef]
- Camaioni, A.; Ucci, M.; Campagnolo, L.; De, F.; Klinger, F.G. The process of ovarian aging: It is not just about oocytes and granulosa cells. J. Assist. Reprod. Genet. 2022, 39, 783–792. [Google Scholar] [CrossRef]
- Sreerangaraja, U.; Wu, W.; Komrskova, K.; Postlerova, P.; Lin, Y.; Tzeng, C.; Kao, S. Mitochondrial function in modulating human granulosa cell steroidogenesis and female fertility. Int. J. Mol. Sci. 2020, 21, 3592. [Google Scholar] [CrossRef]
- Yang, L.; Chen, Y.; Liu, Y.; Xing, Y.; Miao, C.; Zhao, Y.; Chang, X.; Zhang, Q. The role of oxidative stress and natural antioxidants in ovarian aging. Front. Pharmacol. 2021, 11, 617843. [Google Scholar] [CrossRef]
- Rong, X.; Xu, J.; Jiang, Y.; Li, F.; Chen, Y.; Dou, Q.; Li, D. Citrus peel flavonoid nobiletin alleviates lipopolysaccharide-induced inflammation by activating IL-6/STAT3/FOXO3a-mediated autophagy. Food Funct. 2021, 12, 1305–1317. [Google Scholar] [CrossRef]
- Feng, S.; Zhou, Y.; Huang, H.; Lin, Y.; Zeng, Y.; Han, S.; Huang, K.; Liu, Q.; Zhu, W.; Yuan, Z.; et al. Nobiletin induces ferroptosis in human skin melanoma cells through the GSK3β-mediated Keap1/Nrf2/HO-1 signalling pathway. Front. Genet. 2022, 13, 865073. [Google Scholar] [CrossRef]
- Liu, B.; Deng, Q.; Zhang, L.; Zhu, W. Nobiletin alleviates ischemia/reperfusion injury in the kidney by activating PI3K/AKT pathway. Mol. Med. Rep. 2020, 22, 4655–4662. [Google Scholar] [CrossRef]
- Cajas, Y.N.; Cañón-Beltrán, K.; Núñez-Puente, C.; Gutierrez-Adán, A.; González, E.M.; Agirregoitia, E.; Rizos, D. Nobiletin-induced partial abrogation of deleterious effects of AKT inhibition on preimplantation bovine embryo development in vitro†. Biol. Reprod. 2021, 105, 1427–1442. [Google Scholar] [CrossRef]
- Wu, J.; Liu, Y.; Song, Y.; Wang, L.; Ai, J.; Li, K. Aging conundrum: A perspective for ovarian aging. Front. Endocrinol. 2022, 13, 952471. [Google Scholar] [CrossRef]
- Tesarik, J.; Galán-Lázaro, M.; Mendoza-Tesarik, R. Ovarian aging: Molecular mechanisms and medical management. Int. J. Mol. Sci. 2021, 22, 1371. [Google Scholar] [CrossRef]
- Hernandez-Segura, A.; Nehme, J.; Demaria, M. Hallmarks of cellular senescence. Trends Cell Biol. 2018, 28, 436–453. [Google Scholar] [CrossRef]
- Liang, X.; Yan, Z.; Ma, W.; Qian, Y.; Zou, X.; Cui, Y.; Liu, J.; Meng, Y. Peroxiredoxin 4 protects against ovarian ageing by ameliorating D-galactose-induced oxidative damage in mice. Cell Death Dis. 2020, 11, 053. [Google Scholar] [CrossRef]
- Zhou, P.; Deng, F.; Yang, Z.; Cao, C.; Zhao, H.; Liu, F.; Zhong, K.; Fu, L.; Peng, T.; Sun, D.; et al. Ginsenoside Rb1 inhibits oxidative stress-induced ovarian granulosa cell injury through Akt-FoxO1 interaction. Sci. China Life Sci. 2022, 65, 2301–2315. [Google Scholar] [CrossRef]
- Bharath, L.P.; Agrawal, M.; McCambridge, G.; Nicholas, D.; Hasturk, H.; Liu, J.; Jiang, K.; Liu, R.; Guo, Z.; Deeney, J.; et al. Metformin enhances autophagy and normalizes mitochondrial function to alleviate aging-associated inflammation. Cell Metab. 2020, 32, 44–55.e6. [Google Scholar] [CrossRef]
- Chiang, J.; Shukla, P.; Pagidas, K.; Ahmed, N.S.; Karri, S.; Gunn, D.D.; Hurd, W.W.; Singh, K.K. Mitochondria in ovarian aging and reproductive longevity. Ageing Res. Rev. 2020, 63, 101168. [Google Scholar] [CrossRef]
- Green, D.R.; Galluzzi, L.; Kroemer, G. Mitochondria and the autophagy-inflammation-cell death axis in organismal aging. Science 2011, 333, 1109–1112. [Google Scholar] [CrossRef]
- Wang, C.; Wu, S.; Wu, Y.; Wei, Y. Oxidative stress response elicited by mitochondrial dysfunction: Implication in the pathophysiology of aging. Exp. Biol. Med. 2013, 238, 450–460. [Google Scholar] [CrossRef]
- Wu, X.; Zheng, D.; Qin, Y.; Liu, Z.; Zhang, G.; Zhu, X.; Zeng, L.; Liang, Z. Nobiletin attenuates adverse cardiac remodeling after acute myocardial infarction in rats via restoring autophagy flux. Biochem. Biophys. Res. Commun. 2017, 492, 262–268. [Google Scholar] [CrossRef]
- Wang, H.; Sun, Y.; Qu, T.; Sang, X.; Zhou, L.; Li, Y.; Ren, F. Nobiletin prevents D-galactose-induced C2C12 cell aging by improving mitochondrial function. Int. J. Mol. Sci. 2022, 23, 11963. [Google Scholar] [CrossRef]
- Shirakabe, A.; Ikeda, Y.; Sciarretta, S.; Zablocki, D.K.; Sadoshima, J. Aging and autophagy in the heart. Circ. Res. 2016, 118, 1563–1576. [Google Scholar] [CrossRef]
- Kaushik, S.; Tasset, I.; Arias, E.; Pampliega, O.; Wong, E.; Martinez-Vicente, M.; Cuervo, A. Autophagy and the hallmarks of aging. Ageing Res. Rev. 2021, 72, 101468. [Google Scholar] [CrossRef]
- Herzig, S.; Shaw, R. AMPK: Guardian of metabolism and mitochondrial homeostasis. Nat. Rev. Mol. Cell Biol. 2018, 19, 121–135. [Google Scholar] [CrossRef]
- Mihaylova, M.; Shaw, R. The AMPK signalling pathway coordinates cell growth, autophagy and metabolism. Nat. Cell Biol. 2011, 13, 1016–1023. [Google Scholar] [CrossRef]
- Xu, T.; Li, H.; Dai, Z.; Lau, G.; Li, B.; Zhu, W.; Liu, X.; Liu, H.; Cai, W.; Huang, S.; et al. Spermidine and spermine delay brain aging by inducing autophagy in SAMP8 mice. Aging 2020, 12, 6401–6414. [Google Scholar] [CrossRef]
- Tang, B. SIRT1 and the mitochondria. Mol. Cells 2016, 3, 87–95. [Google Scholar] [CrossRef]
- Jiang, Y.; Chen, D.; Gong, Q.; Xu, Q.; Pan, D.; Lu, F.; Tang, Q. Elucidation of SIRT1/PGC-1α-associated mitochondrial dysfunction and autophagy in nonalcoholic fatty liver disease. Lipids Health Dis. 2021, 20, 40. [Google Scholar] [CrossRef]
- Chen, C.; Zhou, M.; Ge, Y.; Wang, X. SIRT1 and aging related signaling pathways. Mech. Ageing Dev. 2020, 187, 111215. [Google Scholar] [CrossRef]
- Hu, J.; Liu, T.; Fu, F.; Cui, Z.; Lai, Q.; Zhang, Y.; Yu, B.; Liu, F.; Kou, J.; Li, F. Omentin1 ameliorates myocardial ischemia-induced heart failure via SIRT3/FOXO3a-dependent mitochondrial dynamical homeostasis and mitophagy. J. Transl. Med. 2022, 20, 447. [Google Scholar] [CrossRef]
- Shin, H.; Kim, H.; Oh, S.; Lee, J.; Kee, M.; Ko, H.; Kweon, M.; Won, K.; Baek, S. AMPK-SKP2-CARM1 signalling cascade in transcriptional regulation of autophagy. Nature 2016, 534, 553–557. [Google Scholar] [CrossRef]
Genes | Accession No. | Primer Sequence (5′–3′) |
---|---|---|
CDK-2 | NM_001199857.1 | TCCGTATCTTCCGCACGTTG GCTTGTTGGGATCTAGTGC |
PCNA | NM_204170.2 | GGGCGTCAACTAAACAGCA AGCCAACGTATCCGCATTGT |
CCND1 | NM_205381.1 | CCGAAGGTTGTGTTCCAGTGAGAG CGTGTGTTGGCACCAAAGGATTTC |
Caspase-3 | NM_204725.2 | ATTGAAGCAGACAGTGGACCAGATG TGCGTTCCTCCAGGAGTAGTAGC |
Bcl-2 | NM_205339.2 | GCTGCTTTACTCTTGGGGGT CTTCAGCACTATCTCGCGGT |
CAT | NM_001031215.2 | CGGGATGCAATGTTGTTTCCAT AGACTCAGGGCGAAGACTCA |
SOD1 | NM_205064.2 | TGACCTCGGCAATGTGACTG CACTTTTTGCATGGACCACCA |
β-actin | NM_205518 | ACACCCACACCCCTGTGATGAA TGCTGCTGACACCTTCACCATTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bai, J.; Wang, X.; Chen, Y.; Yuan, Q.; Yang, Z.; Mi, Y.; Zhang, C. Nobiletin Ameliorates Aging of Chicken Ovarian Prehierarchical Follicles by Suppressing Oxidative Stress and Promoting Autophagy. Cells 2024, 13, 415. https://doi.org/10.3390/cells13050415
Bai J, Wang X, Chen Y, Yuan Q, Yang Z, Mi Y, Zhang C. Nobiletin Ameliorates Aging of Chicken Ovarian Prehierarchical Follicles by Suppressing Oxidative Stress and Promoting Autophagy. Cells. 2024; 13(5):415. https://doi.org/10.3390/cells13050415
Chicago/Turabian StyleBai, Jingchun, Xinyu Wang, Yiqiu Chen, Qiongyu Yuan, Zhaoyu Yang, Yuling Mi, and Caiqiao Zhang. 2024. "Nobiletin Ameliorates Aging of Chicken Ovarian Prehierarchical Follicles by Suppressing Oxidative Stress and Promoting Autophagy" Cells 13, no. 5: 415. https://doi.org/10.3390/cells13050415
APA StyleBai, J., Wang, X., Chen, Y., Yuan, Q., Yang, Z., Mi, Y., & Zhang, C. (2024). Nobiletin Ameliorates Aging of Chicken Ovarian Prehierarchical Follicles by Suppressing Oxidative Stress and Promoting Autophagy. Cells, 13(5), 415. https://doi.org/10.3390/cells13050415