Effect of Polyphenols on Inflammation Induced by Membrane Vesicles from Staphylococcus aureus
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemicals
2.2. Bacterial Strain and Culture Conditions
2.3. Measurement of Gene Expression in S. aureus
2.4. Detection of SEA
2.5. Biofilm Formation of S. aureus
2.6. Isolation of MVs
2.7. Particle Size Distribution of MVs
2.8. Identification of Cargo Proteins in MVs
2.9. Inflammation-Related Gene Expression Induced by MVs
2.10. Statistical Analysis
3. Results
3.1. Effect of Polyphenols on Growth of S. aureus
3.2. Effects of Polyphenols on Virulence Factor Gene Expression in S. aureus
3.3. Effect of Polyphenols on Biofilm Formation of S. aureus
3.4. Effect of Polyphenols on Particle Size Distribution of S. aureus-Derived MVs
3.5. Effect of Polyphenols on SEA Production and SEA Content of MVs of S. aureus
3.6. Effect of Polyphenols on the Cargo Proteins in S. aureus-Derived MVs
3.7. Effects of Polyphenols on Expression of Inflammation-Related Genes Induced by S. aureus-Derived MVs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ngo, Q.V.; Faass, L.; Sähr, A.; Hildebrand, D.; Eigenbrod, T.; Heeg, K.; Nurjadi, D. Inflammatory response against Staphylococcus aureus via intracellular sensing of nucleic acids in keratinocytes. Front. Immunol. 2022, 13, 828626. [Google Scholar] [CrossRef] [Scilit]
- Park, H.Y.; Kim, C.R.; Huh, I.S.; Jung, M.Y.; Seo, E.Y.; Park, J.H.; Lee, D.Y.; Yang, J.M. Staphylococcus aureus colonization in acute and chronic skin lesions of patients with atopic dermatitis. Ann. Dermatol. 2013, 25, 410–416. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Katayama, Y.; Baba, T.; Sekine, M.; Fukuda, M.; Hiramatsu, K. Beta-hemolysin promotes skin colonization by Staphylococcus aureus. J. Bacteriol. 2013, 195, 1194–1203. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Musa, A.; Wiman, E.; Selegård, R.; Aili, D.; Bengtsson, T.; Khalaf, H. Plantaricin NC8 αβ prevents Staphylococcus aureus-mediated cytotoxicity and inflammatory responses of human keratinocytes. Sci. Rep. 2021, 11, 12514. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rutherford, S.T.; Bassler, B.L. Bacterial quorum sensing: Its role in virulence and possibilities for its control. Cold Spring Harb. Perspect. Med. 2012, 2, a012427. [Google Scholar] [CrossRef] [Scilit]
- Gupta, R.K.; Luong, T.T.; Lee, C.Y. RNAIII of the Staphylococcus aureus agr system activates global regulator MgrA by stabilizing mRNA. Proc. Natl Acad. Sci. USA 2015, 112, 14036–14041. [Google Scholar] [CrossRef] [Scilit]
- Tremaine, M.T.; Brockman, D.K.; Betley, M.J. Staphylococcal enterotoxin A gene (sea) expression is not affected by the accessory gene regulator (agr). Infect. Immun. 1993, 61, 356–359. [Google Scholar] [CrossRef] [Scilit]
- Kissner, T.L.; Cisney, E.D.; Ulrich, R.G.; Fernandez, S.; Saikh, K.U. Staphylococcal enterotoxin A induction of pro-inflammatory cytokines and lethality in mice is primarily dependent on MyD88. Immunology 2010, 130, 516–526. [Google Scholar] [CrossRef] [Scilit]
- Lee, H.W.; Kim, S.M.; Kim, J.M.; Oh, B.M.; Kim, J.Y.; Jung, H.J.; Lim, H.J.; Kim, B.S.; Lee, W.J.; Lee, S.J.; et al. Potential immunoinflammatory role of staphylococcal enterotoxin a in atopic dermatitis: Immunohistopathological analysis and in vitro assay. Ann. Dermatol. 2013, 25, 173–180. [Google Scholar] [CrossRef] [Scilit]
- Jun, S.H.; Lee, J.H.; Kim, S.I.; Choi, C.W.; Park, T.I.; Jung, H.R.; Cho, J.W.; Kim, S.H.; Lee, J.C. Staphylococcus aureus-derived membrane vesicles exacerbate skin inflammation in atopic dermatitis. Clin. Exp. Allergy 2017, 47, 85–96. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nomura, N.; Toyofuku, M. Bacterial membrane vesicle and its diversity. Drug Deliv. Syst. 2021, 36, 138–144. [Google Scholar] [CrossRef] [Scilit]
- Briaud, P.; Carroll, R.K. Extracellular vesicle biogenesis and functions in Gram-positive bacteria. Infect. Immun. 2020, 88, e00433-20. [Google Scholar] [CrossRef] [Scilit]
- Ellis, T.N.; Kuehn, M.J. Virulence and immunomodulatory roles of bacterial outer membrane vesicles. Microbiol. Mol. Biol. Rev. 2010, 74, 81–94. [Google Scholar] [CrossRef] [Scilit]
- Gurung, M.; Moon, D.C.; Choi, C.W.; Lee, J.H.; Bae, Y.C.; Kim, J.; Lee, Y.C.; Seol, S.Y.; Cho, D.T.; Kim, S.I.; et al. Staphylococcus aureus produces membrane-derived vesicles that induce host cell death. PLoS ONE 2011, 6, e27958. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.; Thompson, C.D.; Weidenmaier, C.; Lee, J.C. Release of Staphylococcus aureus extracellular vesicles and their application as a vaccine platform. Nat. Commun. 2018, 9, 1379. [Google Scholar] [CrossRef] [Scilit]
- Staudenmaier, L.; Focken, J.; Schlatterer, K.; Kretschmer, D.; Schittek, B. Bacterial membrane vesicles shape Staphylococcus aureus skin colonization and induction of innate immune responses. Exp. Dermatol. 2022, 31, 349–361. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shimamura, Y.; Utsumi, M.; Hirai, C.; Nakano, S.; Ito, S.; Tsuji, A.; Ishii, T.; Hosoya, T.; Kan, T.; Ohashi, N.; et al. Binding of catechins to staphylococcal enterotoxin A. Molecules 2018, 23, 1125. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shimamura, Y.; Noaki, R.; Oura, Y.; Ichikawa, K.; Kan, T.; Masuda, S. Regulation of staphylococcal enterotoxin-induced inflammation in spleen cells from diabetic mice by polyphenols. Microorganisms 2023, 11, 1039. [Google Scholar] [CrossRef] [Scilit]
- Taylor, P.W.; Hamilton-Miller, J.M.; Stapleton, P.D. Antimicrobial properties of green tea catechins. Food Sci. Technol. Bull. 2005, 2, 71–81. [Google Scholar] [CrossRef] [Scilit]
- Asakawa, T.; Hiza, A.; Nakayama, M.; Inai, M.; Oyama, D.; Koide, H.; Shimizu, K.; Wakimoto, T.; Harada, N.; Tsukada, H.; et al. PET imaging of nobiletin based on a practical total synthesis. Chem. Commun. 2011, 47, 2868–2870. [Google Scholar] [CrossRef] [Scilit]
- Shimamura, Y.; Kidokoro, S.; Murata, M. Survey and properties of Staphylococcus aureus isolated from Japanese-style desserts. Biosci. Biotechnol. Biochem. 2006, 70, 1571–1577. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yamanashi, Y.; Shimamura, Y.; Sasahara, H.; Komuro, M.; Sasaki, K.; Morimitsu, Y.; Masuda, S. Effects of growth stage on the characterization of enterotoxin A-producing Staphylococcus aureus-derived membrane vesicles. Microorganisms 2022, 10, 574. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Boukamp, P.; Petrussevska, R.T.; Breitkreutz, D.; Hornung, J.; Markham, A.; Fusenig, N.E. Normal keratinization in a spontaneously immortalized aneuploid human keratinocyte cell line. J. Cell Biol. 1988, 106, 761–771. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hu, Z.Q.; Zhao, W.H.; Asano, N.; Yoda, Y.; Hara, Y.; Shimamura, T. Epigallocatechin gallate synergistically enhances the activity of carbapenems against methicillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 2002, 46, 558–560. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cui, Y.; Oh, Y.J.; Lim, J.; Youn, M.; Lee, I.; Pak, H.K.; Park, W.; Jo, W.; Park, S. AFM study of the differential inhibitory effects of the green tea polyphenol (−)-epigallocatechin-3-gallate (EGCG) against Gram-positive and Gram-negative bacteria. Food Microbiol. 2012, 29, 80–87. [Google Scholar] [CrossRef] [Scilit]
- Yi, Z.; Yu, Y.; Liang, Y.; Zeng, B. In vitro antioxidant and antimicrobial activities of the extract of Pericarpium Citri Reticulatae of a new Citrus cultivar and its main flavonoids. Food Sci. Technol. 2008, 41, 597–603. [Google Scholar] [CrossRef] [Scilit]
- Sekowski, S.; Veiko, A.; Olchowik-Grabarek, E.; Dubis, A.; Wilczewska, A.Z.; Markiewicz, K.H.; Zavodnik, I.B.; Lapshina, E.; Dobrzynska, I.; Abdulladjanova, N.; et al. Hydrolysable tannins change physicochemical parameters of lipid nano-vesicles and reduce DPPH radical—Experimental studies and quantum chemical analysis. Biochim. Biophys. Acta Biomembr. 2022, 1864, 183778. [Google Scholar] [CrossRef] [Scilit]
- Morinaga, N.; Iwamaru, Y.; Yahiro, K.; Tagashira, M.; Moss, J.; Noda, M. Differential activities of plant polyphenols on the binding and internalization of cholera toxin in vero cells. J. Biol. Chem. 2005, 280, 23303–23309. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Prabhakara, R.; Harro, J.M.; Leid, J.G.; Harris, M.; Shirtliff, M.E. Murine immune response to a chronic Staphylococcus aureus biofilm infection. Infect. Immun. 2011, 79, 1789–1796. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Le, K.Y.; Otto, M. Quorum-sensing regulation in staphylococci-an overview. Front. Microbiol. 2015, 6, 1174. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Götz, F. Staphylococcus and biofilms. Mol. Microbiol. 2002, 43, 1367–1378. [Google Scholar] [CrossRef] [Scilit]
- Olchowik-Grabarek, E.G.; Sękowski, S.; Kwiatek, A.; Płaczkiewicz, J.; Abdulladjanova, N.; Shlyonsky, V.; Swiecicka, I.; Zamaraeva, M. The structural changes in the membranes of Staphylococcus aureus caused by hydrolysable tannins witness their antibacterial activity. Membranes 2022, 12, 1124. [Google Scholar] [CrossRef] [Scilit]
- Uppu, D.S.; Wang, X.; Lee, J.C. Contribution of extracellular membrane vesicles to the secretome of Staphylococcus aureus. mBio 2023, 14, e0357122. [Google Scholar] [CrossRef] [Scilit]
- Kunkle, T.; Abdeen, S.; Salim, N.; Ray, A.M.; Stevens, M.; Ambrose, A.J.; Victorino, J.; Park, Y.; Hoang, Q.Q.; Chapman, E.; et al. Hydroxybiphenylamide GroEL/ES inhibitors are potent antibacterials against planktonic and biofilm forms of Staphylococcus aureus. J. Med. Chem. 2018, 61, 10651–10664. [Google Scholar] [CrossRef] [Scilit]
- Cho, Y.S.; Schiller, N.L.; Oh, K.H. Antibacterial effects of green tea polyphenols on clinical isolates of methicillin-resistant Staphylococcus aureus. Curr. Microbiol. 2008, 57, 542–546. [Google Scholar] [CrossRef] [Scilit]
- Lade, H.; Park, J.H.; Chung, S.H.; Kim, I.H.; Kim, J.M.; Joo, H.S.; Kim, J.S. Biofilm formation by Staphylococcus aureus clinical isolates is differentially affected by glucose and sodium chloride supplemented culture media. J. Clin. Med. 2019, 8, 1853. [Google Scholar] [CrossRef] [Scilit]
- Carneiro, C.R.W.; Postol, E.; Nomizo, R.; Reis, L.F.L.; Brentani, R.R. Identification of enolase as a laminin-binding protein on the surface of Staphylococcus aureus. Microbes Infect. 2004, 6, 604–608. [Google Scholar] [CrossRef]
- Cho, J.W.; Cho, S.Y.; Lee, K.S. Roles of SEA-expressing Staphylococcus aureus, isolated from an atopic dermatitis patient, on expressions of human beta-defensin-2 and inflammatory cytokines in HaCaT cells. Int. J. Mol. Med. 2009, 23, 331–335. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tsuchiya, H.; Sato, M.; Miyazaki, T.; Fujiwara, S.; Tanigaki, S.; Ohyama, M.; Tanaka, T.; Iinuma, M. Comparative study on the antibacterial activity of phytochemical flavanones against methicillin-resistant Staphylococcus aureus. J. Ethnopharmacol. 1996, 50, 27–34. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sirk, T.W.; Brown, E.F.; Friedman, M.; Sum, A.K. Molecular binding of catechins to biomembranes: Relationship to biological activity. J. Agric. Food Chem. 2009, 57, 6720–6728. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shamsudin, N.F.; Ahmed, Q.U.; Mahmood, S.; Ali Shah, S.A.; Khatib, A.; Mukhtar, S.; Alsharif, M.A.; Parveen, H.; Zakaria, Z.A. Antibacterial effects of flavonoids and their structure-activity relationship study: A comparative interpretation. Molecules 2022, 27, 1149. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tarahovsky, Y.S.; Kim, Y.A.; Yagolnik, E.A.; Muzafarov, E.N. Flavonoid–membrane interactions: Involvement of flavonoid–metal complexes in raft signaling. Biochim. Biophys. Acta 2014, 1838, 1235–1246. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schlatterer, K.; Beck, C.; Hanzelmann, D.; Lebtig, M.; Fehrenbacher, B.; Schaller, M.; Ebner, P.; Nega, M.; Otto, M.; Lretschmer, D.; et al. The mechanism behind bacterial lipoprotein release: Phenol-soluble modulins mediate Toll-like receptor 2 activation via extracellular vesicle release from Staphylococcus aureus. mBio 2018, 9, e01851-18. [Google Scholar] [CrossRef] [Scilit] [PubMed]








| Primer | Forward Primer (5’ to 3’) | Reverse Primer (5’ to 3’) |
|---|---|---|
| GAPDH | GGACCTGACCTGCCGTCTAG | GAGGAGTGGGTGTCGCTGTT |
| IL-6 | TGGCTGAAAAAGATGGATGCT | TCTGCACAGCTCTGGCTTGT |
| IL-8 | TTGGCAGCCTTCCTGATTTC | TGGTCCACTCTCAATCACTCTCA |
| MCP-1 | TCGCTCAGCCAGATGCAAT | TGGCCACAATGGTCTTGAAG |
| TNF-α | CCCAGGGACCTCTCTCTAATC | ATGGGCTACAGGCTTGTCACT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Oura, Y.; Shimamura, Y.; Kan, T.; Masuda, S. Effect of Polyphenols on Inflammation Induced by Membrane Vesicles from Staphylococcus aureus. Cells 2024, 13, 387. https://doi.org/10.3390/cells13050387
Oura Y, Shimamura Y, Kan T, Masuda S. Effect of Polyphenols on Inflammation Induced by Membrane Vesicles from Staphylococcus aureus. Cells. 2024; 13(5):387. https://doi.org/10.3390/cells13050387
Chicago/Turabian StyleOura, Yukino, Yuko Shimamura, Toshiyuki Kan, and Shuichi Masuda. 2024. "Effect of Polyphenols on Inflammation Induced by Membrane Vesicles from Staphylococcus aureus" Cells 13, no. 5: 387. https://doi.org/10.3390/cells13050387
APA StyleOura, Y., Shimamura, Y., Kan, T., & Masuda, S. (2024). Effect of Polyphenols on Inflammation Induced by Membrane Vesicles from Staphylococcus aureus. Cells, 13(5), 387. https://doi.org/10.3390/cells13050387

