Identification of Stable Reference miRNAs for miRNA Expression Analysis in Adult Neurogenesis Across Mouse and Human Tissues
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Model
2.2. Small RNA Sequencing and Data Processing
2.3. Cell Culture and Treatments
2.4. cDNA Synthesis and Real-Time Quantitative PCR (RT-qPCR)
2.5. Statistical Analysis
3. Results
3.1. Selection of Reference miRNA Candidates
3.2. Validation of Selected miRNAs in Mouse and Human NPCs
3.3. Validation of Selected miRNAs in Hippocampal Tissues
3.4. Validation of Selected miRNAs in Different Human Brain Cells
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- O’Brien, J.; Hayder, H.; Zayed, Y.; Peng, C. Overview of MicroRNA Biogenesis, Mechanisms of Actions, and Circulation. Front. Endocrinol. 2018, 9, 402. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Sekar, V.; Mármol-Sánchez, E.; Kalogeropoulos, P.; Stanicek, L.; Sagredo, E.A.; Widmark, A.; Doukoumopoulos, E.; Bonath, F.; Biryukova, I.; Friedländer, M.R. Detection of transcriptome-wide microRNA-target interactions in single cells with agoTRIBE. Nat. Biotechnol. 2024, 42, 1296–1302. [Google Scholar] [CrossRef] [PubMed]
- Ardekani, A.M.; Naeini, M.M. The Role of MicroRNAs in Human Diseases. Avicenna J. Med. Biotechnol. 2010, 2, 161–179. [Google Scholar] [PubMed] [PubMed Central]
- Ranganathan, K.; Sivasankar, V. MicroRNAs—Biology and clinical applications. J. Oral Maxillofac. Pathol. 2014, 18, 229–234. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Vidigal, J.A.; Ventura, A. The biological functions of miRNAs: Lessons from in vivo studies. Trends Cell Biol. 2015, 25, 137–147. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Magill, S.T.; Cambronne, X.A.; Luikart, B.W.; Lioy, D.T.; Leighton, B.H.; Westbrook, G.L.; Mandel, G.; Goodman, R.H. microRNA-132 regulates dendritic growth and arborization of newborn neurons in the adult hippocampus. Proc. Natl. Acad. Sci. USA 2010, 107, 20382–20387. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Sanuki, R.; Onishi, A.; Koike, C.; Muramatsu, R.; Watanabe, S.; Muranishi, Y.; Irie, S.; Uneo, S.; Koyasu, T.; Matsui, R.; et al. miR-124a is required for hippocampal axogenesis and retinal cone survival through Lhx2 suppression. Nat. Neurosci. 2011, 14, 1125–1134. [Google Scholar] [CrossRef] [PubMed]
- Fan, Z.; Lu, M.; Qiao, C.; Zhou, Y.; Ding, J.H.; Hu, G. MicroRNA-7 Enhances Subventricular Zone Neurogenesis by Inhibiting NLRP3/Caspase-1 Axis in Adult Neural Stem Cells. Mol. Neurobiol. 2016, 53, 7057–7069. [Google Scholar] [CrossRef] [PubMed]
- Li, Q.; Bian, S.; Hong, J.; Kawase-Koga, Y.; Zhu, E.; Zheng, Y.; Yang, L.; Sun, T. Timing specific requirement of microRNA function is essential for embryonic and postnatal hippocampal development. PLoS ONE 2011, 6, e26000. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- McLoughlin, H.S.; Fineberg, S.K.; Ghosh, L.L.; Tecedor, L.; Davidson, B.L. Dicer is required for proliferation, viability, migration and differentiation in corticoneurogenesis. Neuroscience 2012, 223, 285–295. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Crookenden, M.A.; Walker, C.G.; Kuhn-Sherlock, B.; Murray, A.; Dukkipati, V.S.R.; Heiser, A.; Roche, J.R. Technical note: Evaluation of endogenous control gene expression in bovine neutrophils by reverse-transcription quantitative PCR using microfluidics gene expression arrays. J. Dairy Sci. 2017, 100, 6763–6771. [Google Scholar] [CrossRef] [PubMed]
- Mandyam, C.D.; Koob, G.F. The addicted brain craves new neurons: Putative role for adult-born progenitors in promoting recovery. Trends Neurosci. 2012, 35, 250–260. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Ihunwo, A.O.; Perego, J.; Martino, G.; Vicenzi, E.; Panina-Bordignon, P. Neurogenesis and Viral Infection. Front. Immunol. 2022, 13, 826091. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Putatunda, R.; Ho, W.Z.; Hu, W. HIV-1 and Compromised Adult Neurogenesis: Emerging Evidence for a New Paradigm of HAND Persistence. AIDS Rev. 2019, 21, 11–22. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- van Praag, H.; Shubert, T.; Zhao, C.; Gage, F.H. Exercise Enhances Learning and Hippocampal Neurogenesis in Aged Mice. J. Neurosci. 2005, 25, 8680–8685. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Albritton, L.M.; Tseng, L.; Scadden, D.; Cunningham, J.M. A putative murine ecotropic retrovirus receptor gene encodes a multiple membrane-spanning protein and confers susceptibility to virus infection. Cell 1989, 57, 659–666. [Google Scholar] [CrossRef] [PubMed]
- Park, M.; Baker, W.; Cambow, D.; Gogerty, D.; Leda, A.R.; Herlihy, B.; Pavlenko, D.; Van Den Nieuwenhuizen, S.; Toborek, M. Methamphetamine Enhances HIV-Induced Aberrant Proliferation of Neural Progenitor Cells via the FOXO3-Mediated Mechanism. Mol. Neurobiol. 2021, 58, 5421–5436. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Skowronska, M.; McDonald, M.; Velichkovska, M.; Leda, A.R.; Park, M.; Toborek, M. Methamphetamine increases HIV infectivity in neural progenitor cells. J. Biol. Chem. 2018, 293, 296–311. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Wolff, G.; Balke, J.E.; Andras, I.E.; Park, M.; Toborek, M. Exercise Modulates Redox-Sensitive Small GTPase Activity in the Brain Microvasculature in a Model of Brain Metastasis Formation. PLoS ONE 2014, 9, e97033. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Love, M.I.; Anders, S.; Kim, V.; Huber, W. RNA-Seq workflow: Gene-level exploratory analysis and differential expression. F1000Res. 2015, 4, 1070. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Andersen, C.L.; Jensen, J.L.; Ørntoft, T.F. Normalization of real-time quantitative reverse transcription-PCR data: A model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 2004, 64, 5245–5250. [Google Scholar] [CrossRef] [PubMed]
- Ribeiro, F.F.; Xapelli, S. An Overview of Adult Neurogenesis. Adv. Exp. Med. Biol. 2021, 1331, 77–94. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Jia, E.; Shi, H.; Li, X.; Jiang, G.; Chi, C.; Liu, W.; Zhang, D. Selection of reference genes for miRNA quantitative PCR and its application in miR-34a/Sirtuin-1 mediated energy metabolism in Megalobrama amblycephala. Fish Physiol. Biochem. 2019, 45, 1663–1681. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Zeng, C.-J.; He, L.; Ding, L.; Tang, K.-Y.; Peng, W.-P. Selection of endogenous reference microRNA genes for quantitative reverse transcription polymerase chain reaction studies of boar spermatozoa cryopreservation. Theriogenology 2015, 83, 634–641. [Google Scholar] [CrossRef] [PubMed]
- Damanti, C.C.; Gaffo, E.; Lovisa, F.; Garbin, A.; Di Battista, P.; Gallingani, I.; Tosato, A.; Pillon, M.; Carraro, E.; Mascarin, M.; et al. MiR-26a-5p as a Reference to Normalize MicroRNA qRT-PCR Levels in Plasma Exosomes of Pediatric Hematological Malignancies. Cells 2021, 10, 101. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Ratert, N.; Meyer, H.A.; Jung, M.; Mollenkopf, H.J.; Wagner, I.; Miller, K.; Kilic, E.; Erbersdobler, A.; Weikert, S.; Jung, K. Reference miRNAs for miRNAome analysis of urothelial carcinomas. PLoS ONE 2012, 7, e39309. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Korma, W.; Mihret, A.; Tarekegn, A.; Chang, Y.; Hwang, D.; Tessema, T.S.; Lee, H. Identification of Circulating miR-22-3p and miR-93-5p as Stable Endogenous Control in Tuberculosis Study. Diagnostics 2020, 10, 868. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- DAS, M.K.; ANDREASSEN, R.; HAUGEN, T.B.; FURU, K. Identification of Endogenous Controls for Use in miRNA Quantification in Human Cancer Cell Lines. Cancer Genom. Proteom. 2016, 13, 63–68. [Google Scholar] [PubMed]
- Niu, Y.; Wu, Y.; Huang, J.; Li, Q.; Kang, K.; Qu, J.; Li, F.; Gou, D. Identification of reference genes for circulating microRNA analysis in colorectal cancer. Sci. Rep. 2016, 6, 35611. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Formosa, A.; Acton, E.; Lee, A.; Turgeon, P.; Izhar, S.; Plant, P.; Tsoporis, J.N.; Soussi, S.; Trahtemberg, U.; Baker, A.; et al. Validation of reference gene stability for miRNA quantification by reverse transcription quantitative PCR in the peripheral blood of patients with COVID-19 critical illness. PLoS ONE 2023, 18, e0286871. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Chen, L.; Jin, Y.; Wang, L.; Sun, F.; Yang, X.; Shi, M.; Zhan, C.; Shi, Y.; Wang, Q. Identification of reference genes and miRNAs for qRT-PCR in human esophageal squamous cell carcinoma. Med. Oncol. 2017, 34, 2. [Google Scholar] [CrossRef] [PubMed]
- Zhan, C.; Yan, L.; Wang, L.; Jiang, W.; Zhang, Y.; Xi, J.; Chen, L.; Jin, Y.; Qiao, Y.; Shi, Y.; et al. Identification of reference miRNAs in human tumors by TCGA miRNA-seq data. Biochem. Biophys. Res. Commun. 2014, 453, 375–378. [Google Scholar] [CrossRef] [PubMed]
- Ghanbari, S.; Salimi, A.; Rahmani, S.; Nafissi, N.; Sharifi-Zarchi, A.; Mowla, S.J. miR-361-5p as a promising qRT-PCR internal control for tumor and normal breast tissues. PLoS ONE 2021, 16, e0253009. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Das, A.; Chai, J.C.; Jung, K.H.; Das, N.D.; Kang, S.C.; Lee, Y.S.; Seo, H.; Chai, Y.G. JMJD2A attenuation affects cell cycle and tumourigenic inflammatory gene regulation in lipopolysaccharide stimulated neuroectodermal stem cells. Exp. Cell Res. 2014, 328, 361–378. [Google Scholar] [CrossRef] [PubMed]
- Das, N.D.; Choi, M.R.; Jung, K.H.; Park, J.H.; Lee, H.T.; Das, A.; Kim, S.H.; Chai, Y.G. Functional analysis of histone demethylase Jmjd2b on lipopolysaccharide-treated murine neural stem cells (NSCs). Neurotox. Res. 2013, 23, 154–165. [Google Scholar] [CrossRef] [PubMed]
- Park, M.; Levine, H.; Toborek, M. Exercise protects against methamphetamine-induced aberrant neurogenesis. Sci. Rep. 2016, 6, 34111. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Toborek, M.; Seelbach, M.; Rashid, C.; Andras, I.; Chen, L.; Park, M.; Esser, K. Voluntary exercise protects against methamphetamine-induced oxidative stress in brain microvasculature and disruption of the blood-brain barrier. Mol. Neurodegener. 2013, 8, 22. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Penning, A.; Snoeck, S.; Garritsen, O.; Tosoni, G.; Hof, A.; de Boer, F.; van Hasenbroek, J.; Zhang, L.; Thrupp, N.; Craessaerts, K.; et al. NACC2, a molecular effector of miR-132 regulation at the interface between adult neurogenesis and Alzheimer’s disease. Sci. Rep. 2024, 14, 21163. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Van Peer, G.; Lefever, S.; Anckaert, J.; Beckers, A.; Rihani, A.; Van Goethem, A.; Volders, P.-J.; Zeka, F.; Ongenaert, M.; Mestdagh, P.; et al. miRBase Tracker: Keeping track of microRNA annotation changes. Database 2014, 2014, bau080. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Liang, Y.; Ridzon, D.; Wong, L.; Chen, C. Characterization of microRNA expression profiles in normal human tissues. BMC Genom. 2007, 8, 166. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Jurkowski, M.P.; Bettio, L.; Woo, E.K.; Patten, A.; Yau, S.Y.; Gil-Mohapel, J. Beyond the Hippocampus and the SVZ: Adult Neurogenesis Throughout the Brain. Front. Cell Neurosci. 2020, 14, 576444. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Wang, M.; Xing, S.; Liu, Y.; An, Z.; Liu, X.; Liu, T.; Zhang, H.; Dai, Y.; Yang, H.; Wang, Y.; et al. 2-Acetylacteoside improves recovery after ischemic stroke by promoting neurogenesis via the PI3K/Akt pathway. Free Radic. Biol. Med. 2024, 225, 415–429. [Google Scholar] [CrossRef] [PubMed]
- Zheng, J.; Zhang, J.; Han, J.; Zhao, Z.; Lin, K. The effect of salidroside in promoting endogenous neural regeneration after cerebral ischemia/reperfusion involves notch signaling pathway and neurotrophic factors. BMC Complement. Med. Ther. 2024, 24, 293. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Inta, D.; Alfonso, J.; von Engelhardt, J.; Kreuzberg, M.M.; Meyer, A.H.; van Hooft, J.A.; Monyer, H. Neurogenesis and widespread forebrain migration of distinct GABAergic neurons from the postnatal subventricular zone. Proc. Natl. Acad. Sci. USA 2008, 105, 20994–20999. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Zhou, Y.; Su, Y.; Li, S.; Kennedy, B.C.; Zhang, D.Y.; Bond, A.M.; Sun, Y.; Jacob, F.; Lu, L.; Hu, P.; et al. Molecular landscapes of human hippocampal immature neurons across lifespan. Nature 2022, 607, 527–533. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Cao, Y.; Liu, P.; Bian, H.; Jin, S.; Liu, J.; Yu, N.; Cui, H.; Sun, F.; Qian, X.; Qiu, W.; et al. Reduced neurogenesis in human hippocampus with Alzheimer’s disease. Brain Pathol. 2024, 34, e13225. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Jonas, S.; Izaurralde, E. Towards a molecular understanding of microRNA-mediated gene silencing. Nat. Rev. Genet. 2015, 16, 421–433. [Google Scholar] [CrossRef] [PubMed]
- Tan, Z.; Li, W.; Cheng, X.; Zhu, Q.; Zhang, X. Non-Coding RNAs in the Regulation of Hippocampal Neurogenesis and Potential Treatment Targets for Related Disorders. Biomolecules 2022, 13, 18. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Liang, H.B.; Lai, Z.H.; Tu, X.Q.; Ding, K.Q.; He, J.R.; Yang, G.Y.; Sheng, H.; Zeng, L.L. MicroRNA-140-5p exacerbates vascular cognitive impairment by inhibiting neurogenesis in the adult mouse hippocampus after global cerebral ischemia. Brain Res. Bull. 2022, 183, 73–83. [Google Scholar] [CrossRef] [PubMed]
- Zeisel, A.; Muñoz-Manchado, A.B.; Codeluppi, S.; Lönnerberg, P.; La Manno, G.; Juréus, A.; Marques, S.; Munguba, H.; He, L.; Betsholtz, C.; et al. Brain Structure. Cell types in the mouse cortex and hippocampus revealed by single-cell RNA-seq. Science 2015, 347, 1138–1142. [Google Scholar] [CrossRef] [PubMed]
Sample Name | Organism | Sample Type (Diases) | Source |
---|---|---|---|
Human brain vascular pericytes | Human | Primary brain vascular pericytes | ScienCell Research Lab (Carlsbad, CA, USA. Cat#1200) |
Pericyte-CON | |||
Pericyte-METH: Pericyte treated with METH (100 µM) for 2 h | |||
Pericyte-LPS: Pericyte treated with LPS (4 µg/ml) for 2 h | |||
HBMEC | Human | Human Brain Microvascular Endothelial Cells | Cell Systems (Kirkland, WA, USA. Cat# ACBRI 376) |
HBMEC-CON | |||
HBMEC-METH: HBMEC treated with METH (100 µM) for 24 h | |||
HBMEC-HIV: HBMEC infected with HIV (NL 4-3) for 24 h | |||
SVG p12 | Human | Human Fetal Glial cells | ATCC (Manassas, VA, USA. Cat# CRL-8621) |
SVG p12- CON | |||
SVG p12- LPS: SVG p12 treated with LPS (1 or 2 µg/mL) for 2 h | |||
ReNcell VM cell line | Human | Neural progenitor cells | Millipore (Burlington, MA, USA. Cat# SC008) |
ReNcell-METH: ReNcell treated with METH (100 µM) for 24 h | |||
ReNcell-Differ: ReNcell induced differentiation for 24 h | |||
ReNcell-Prolif: ReNcell in proliferation condition | |||
Human HP tissue from post-mortem | Human | Hippocampal tissue | University of Miami’s Brain Endowment Bank™ (Miami, FL, USA) |
HP-CON: unaffected control | |||
HP-stroke: hypoxic ischemic encephalopathy or cerebral infarction | |||
NE-4C cell line | Mouse | Neural stem cells | ATCC (Cat# CRL-2925) |
NE-4C-METH: NE-4C treated with METH (100 µM) for 2 h | |||
NE-4C-LPS: NE-4C treated with LPS (10 ng/mL) for 2 h | |||
NE-4C-CON: NE-4C vehicle control | |||
Primary SVZ NPCs isolated from C57/BL6 mouse brain | Mouse | Neural progenitor cells | Park et al. [17] |
NPC-CON: Male mice were injected with saline as a vehicle | |||
NPC-METH: Male mice exposed to METH | |||
NPC-EcoHIV: Male mice exposed to EcoHIV | |||
NPC-METH/EcoHIV: Male mice exposed to METH and EcoHIV | |||
HP tissue dissected from C57/BL6 mouse brain-Cohort I | Mouse | Hippocampal tissue | Wolff et al. [19] |
HP-F-Sed-Con: Female sedentary control mice | |||
HP-F-Ex-Con: Female mice voluntarily exercised for 2 weeks | |||
HP-M-Sed-Con: Male sedentary control mice | |||
HP-M-Ex-Con: Male mice voluntarily exercised for 2 weeks | |||
HP tissue dissected from C57/BL6 mouse brain-Cohort II | Mouse | Hippocampal tissue | |
HP-M-Sed-Con: Male mice exposed to mock controls and sedentary housed for 4 weeks | |||
HP-M-Ex-Con: Male mice exposed to mock controls followed by voluntarily exercised for 4 weeks | |||
HP-M-Sed-METH/EcoHIV: Male mice exposed to METH and EcoHIV and sedentary housed for 4 weeks | |||
HP-M-Ex-METH/EcoHIV: Male mice exposed to METH and EcoHIV followed by voluntarily exercised for 4 weeks |
Target miRNA | Target Sequence | Product Name |
---|---|---|
hsa-miR-93-5p | CAAAGUGCUGUUCGUGCAGGUAG | 478210_mir |
hsa-miR-186-5p | CAAAGAAUUCUCCUUUUGGGCU | 477940_mir |
hsa-miR-361-5p | UUAUCAGAAUCUCCAGGGGUAC | 478056_mir |
hsa-miR-181d-5p | AACAUUCAUUGUUGUCGGUGGGU | 479517_mir |
hsa-let-7d-5p | AGAGGUAGUAGGUUGCAUAGUU | 478439_mir |
hsa-miR-26a-5p | UUCAAGUAAUCCAGGAUAGGCU | 477995_mir |
hsa-miR-125a-5p | UCCCUGAGACCCUUUAACCUGUGA | 477884_mir |
hsa-miR-103a-3p | AGCAGCAUUGUACAGGGCUAUGA | 478253_mir |
mmu-miR-93-5p | CAAAGUGCUGUUCGUGCAGGUAG | mmu481280_mir |
mmu-miR-186-5p | CAAAGAAUUCUCCUUUUGGGCU | mmu_480966_mir |
mmu-miR-361-5p | UUAUCAGAAUCUCCAGGGGUAC | mmu_481127_mir |
mmu-miR-181d-5p | AACAUUCAUUGUUGUCGGUGGGU | mmu_479517_mir |
mmu-let-7d-5p | AGAGGUAGUAGGUUGCAUAGUU | mmu478439_mir |
mmu-miR-26a-5p | UUCAAGUAAUCCAGGAUAGGCU | mmu_481013_mir |
mmu-miR-125a-5p | UCCCUGAGACCCUUUAACCUGUGA | mmu_480906_mir |
mmu-miR-103-3p | AGCAGCAUUGUACAGGGCUAUGA | mmu_478253_mir |
Name of Mature miRNA | Sample Sources | Average RPM * | SD | SD/Avg (%) | Stability ** | References |
---|---|---|---|---|---|---|
mmu-miR-181d-5p | mouse SVZ NPCs | 17,133.43 | 941.94 | 5.50 | 0.037 | N/A a |
mmu-miR-93-5p | mouse SVZ NPCs | 12,526.65 | 799.50 | 6.38 | 0.072 | [27,28,29] |
mmu-miR-103-3p | mouse HP tissues | 7957.05 | 316.53 | 3.98 | 0.041 | [23,24] |
mmu-let-7d-5p | mouse HP tissues | 12,732.27 | 539.82 | 4.24 | 0.046 | |
mmu-miR-26a-5p | mouse SVZ NPCs | 234,194.56 | 16,500.17 | 7.05 | 0.079 | [25] |
mouse HP tissues | 40,821.93 | 2284.65 | 5.60 | 0.041 | ||
mmu-miR-125a-5p | mouse SVZ NPCs | 26,477.70 | 2133.54 | 8.06 | 0.061 | [26] |
mouse HP tissues | 9999.43 | 705.37 | 7.05 | 0.057 |
Souce of Selected miRNA | Reference miRNA Candidate | NE-4C Cell Line (M): con, LPS. METH (N = 4) | ReNcell VM Cell line(H):Prolif, Diff, METH (N = 3~4) | Mouse HP Tissues: con-Sed, MH-Sed, con-Exer, MH-Exer (N = 4) | Human HP Tissues: Control HP (N = 8), Stroke HP (N = 3) | H Pericytes: con, LPS, METH (N = 4) | HBMEC: con, METH, HIV (N = 3~4) | SVG p12 (H Fetal Glial Cells):con, LPS (N = 4) |
---|---|---|---|---|---|---|---|---|
Mouse SVZ NPCs | miR-181d-5p | Stable | * p < 0.05 | *** p < 0.005 | Stable | Stable | ** p < 0.01 | ** p < 0.01 |
miR-93-5p | Stable | * p < 0.05 | ** p < 0.01 | * p < 0.05 | Stable | Stable | ** p < 0.01 | |
Mouse HP tissues | miR-103-3p | Stable | UD a | Stable | Stable | UD | ** p < 0.01 | ** p < 0.01 |
let-7d-5p | Stable | UD | Stable | Stable | Stable | Stable | ** p < 0.01 | |
Both in mouse NPCs and HP | miR-26a-5p | Stable | ** p < 0.01 | *** p < 0.005 | Stable | Stable | Stable | ** p < 0.01 |
miR-125a-5p | Stable | ** p < 0.01 | * p < 0.05 | Stable | Stable | Stable | Stable | |
Known Control miRNAs | miR-186-5p | Stable | Stable | * p < 0.05 | * p < 0.05 | Stable | Stable | * p < 0.05 |
miR-361-5p | Stable | * p < 0.05 | * p < 0.05 | Stable | Stable | Stable | *** p < 0.005 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Levitis, D.L.; Si, J.; Ravishankar, K.; Toborek, M.; Park, M. Identification of Stable Reference miRNAs for miRNA Expression Analysis in Adult Neurogenesis Across Mouse and Human Tissues. Cells 2024, 13, 2060. https://doi.org/10.3390/cells13242060
Levitis DL, Si J, Ravishankar K, Toborek M, Park M. Identification of Stable Reference miRNAs for miRNA Expression Analysis in Adult Neurogenesis Across Mouse and Human Tissues. Cells. 2024; 13(24):2060. https://doi.org/10.3390/cells13242060
Chicago/Turabian StyleLevitis, Daniella Liana, Julia Si, Kushal Ravishankar, Michal Toborek, and Minseon Park. 2024. "Identification of Stable Reference miRNAs for miRNA Expression Analysis in Adult Neurogenesis Across Mouse and Human Tissues" Cells 13, no. 24: 2060. https://doi.org/10.3390/cells13242060
APA StyleLevitis, D. L., Si, J., Ravishankar, K., Toborek, M., & Park, M. (2024). Identification of Stable Reference miRNAs for miRNA Expression Analysis in Adult Neurogenesis Across Mouse and Human Tissues. Cells, 13(24), 2060. https://doi.org/10.3390/cells13242060