YAP and ECM Stiffness: Key Drivers of Adipocyte Differentiation and Lipid Accumulation
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Hydrogel Preparation
2.3. Stress and Elastic Modulus Testing of Adipose Tissue and Hydrogels
- σ: Stress in units of pascals (Pa)
- F: The force applied to the material, in units of newtons (N)
- A: The material’s cross-sectional area, measured in square meters (m2)
- E: Young’s modulus is measured in pascals (Pa).
- ϵ: strain (%)
2.4. ADSCs Differentiate into Adipocytes in Hydrogel
2.5. Evaluation of Compatibility Between Adipose Stem Cells and Collagen Hydrogel
2.6. Influence of Hydrogel Matrix Stiffness on Adipocyte Proliferation
2.7. Quantification of Lipid Accumulation in ADSCs Using BODIPY Staining
2.8. Real-Time PCR Quantitative Analysis
2.9. Measurement of Changes in Hydrogel Diameter After Cell Seeding
2.10. YAP Immunofluorescence Staining
2.11. Western Blot
2.12. Porosity Analysis of Freeze-Dried Hydrogels
2.13. Effects of YAP Inhibition on Lipid Droplets in Hydrogels
2.14. Statistical Analysis
3. Results
3.1. From Tissue to Hydrogel: Constructing an In Vitro Model for Accurate Simulation of the Microenvironment for Adipocyte Differentiation
3.2. Fluorescent Staining of Lipid Droplets in 3D Hydrogels
3.3. qRT-PCR Analysis of Adipocyte Marker
3.4. Cytotoxicity Test
3.5. Cell-Mediated Shrinkage of Hydrogels
3.6. Cell Viability and Proliferation
3.7. Modulation of YAP Function and Localization by Hydrogel Stiffness
3.8. Inhibiting YAP Promotes Adipogenesis
3.9. Hydrogel Concentration Regulates Adipocyte Migration Behavior
3.10. Hydrogel Stiffness Modulates YAP-Mediated Adipocyte Differentiation
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Diez, J.F.F.; Tegeler, A.P.; Flesher, C.G.; Michelotti, T.C.; Ford, H.; Hoque, M.N.; Bhattarai, B.; Benitez, O.J.; Christopher, G.F.; Strieder-Barboza, C. Extracellular Matrix Modulates Depot-Specific Adipogenic Capacity in Adipose Tissue of Dairy Cattle. J. Dairy Sci. 2024, 107, 9978–9996. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Karanfil, A.S.; Louis, F.; Sowa, Y.; Matsusaki, M. ECM Proteins and Cationic Polymers Coating Promote Dedifferentiation of Patient-Derived Mature Adipocytes to Stem Cells. Biomater. Sci. 2023, 11, 7623–7638. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qian, Y.; Chen, H.; Pan, T.; Li, T.; Zhang, Z.; Lv, X.; Wang, J.; Ji, Z.; He, Y.; Li, L.; et al. Autologous Decellularized Extracellular Matrix Promotes Adipogenic Differentiation of Adipose Derived Stem Cells in Low Serum Culture System by Regulating the ERK1/2-PPARγ Pathway. Adipocyte 2021, 10, 174–188. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, J.; Pan, Y.; Lu, Y.; Fang, X.; Ma, T.; Chen, X.; Wang, Y.; Fang, X.; Zhang, C.; Song, C. The Function and Mechanism of Long Noncoding RNAs in Adipogenic Differentiation. Genes 2024, 15, 875. [Google Scholar] [CrossRef] [Scilit]
- Discher, D.E.; Janmey, P.; Wang, Y.-L. Tissue Cells Feel and Respond to the Stiffness of Their Substrate. Science 2005, 310, 1139–1143. [Google Scholar] [CrossRef] [Scilit]
- Vogel, V.; Sheetz, M. Local Force and Geometry Sensing Regulate Cell Functions. Nat. Rev. Mol. Cell Biol. 2006, 7, 265–275. [Google Scholar] [CrossRef] [Scilit]
- Wozniak, M.A.; Chen, C.S. Mechanotransduction in Development: A Growing Role for Contractility. Nat. Rev. Mol. Cell Biol. 2009, 10, 34–43. [Google Scholar] [CrossRef] [Scilit]
- DuFort, C.C.; Paszek, M.J.; Weaver, V.M. Balancing Forces: Architectural Control of Mechanotransduction. Nat. Rev. Mol. Cell Biol. 2011, 12, 308–319. [Google Scholar] [CrossRef] [Scilit]
- Kechagia, J.Z.; Ivaska, J.; Roca-Cusachs, P. Integrins as Biomechanical Sensors of the Microenvironment. Nat. Rev. Mol. Cell Biol. 2019, 20, 457–473. [Google Scholar] [CrossRef] [Scilit]
- Baker, B.M.; Chen, C.S. Deconstructing the Third Dimension—How 3D Culture Microenvironments Alter Cellular Cues. J. Cell Sci. 2012, 125, 3015–3024. [Google Scholar] [CrossRef] [Scilit]
- Cukierman, E.; Pankov, R.; Stevens, D.R.; Yamada, K.M. Taking Cell-Matrix Adhesions to the Third Dimension. Dev. Dyn. 2001, 294, 1708–1712. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hilai, K.; Grubich, D.; Akrawi, M.; Zhu, H.; Zaghloul, R.; Shi, C.; Do, M.; Zhu, D.; Zhang, J. Mechanical Evolution of Metastatic Cancer Cells in Three-Dimensional Microenvironment. bioRxiv 2024. [Google Scholar] [CrossRef] [Scilit]
- Bono, N.; Pezzoli, D.; Levesque, L.; Loy, C.; Candiani, G.; Fiore, G.B.; Mantovani, D. Unraveling the Role of Mechanical Stimulation on Smooth Muscle Cells: A Comparative Study between 2D and 3D Models. Biotechnol. Bioeng. 2016, 113, 2254–2263. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, W.Y.C.; Boxer, S.G.; Ferrell, J.E. Signaling Reactions in 2D vs. 3D. Biophys. J. 2024, 123, 21A. [Google Scholar] [CrossRef] [Scilit]
- Warren, K.M.; Islam, M.M.; LeDuc, P.R.; Steward, R., Jr. 2D and 3D Mechanobiology in Human and Nonhuman Systems. ACS Appl. Mater. Interfaces 2016, 8, 21869–21882. [Google Scholar] [CrossRef] [Scilit]
- Di, X.; Gao, X.; Peng, L.; Ai, J.; Jin, X.; Qi, S.; Li, H.; Wang, K.; Luo, D. Cellular Mechanotransduction in Health and Diseases: From Molecular Mechanism to Therapeutic Targets. Sig. Transduct. Target. Ther. 2023, 8, 282. [Google Scholar] [CrossRef] [Scilit]
- Nattasit, P.; Niibe, K.; Yamada, M.; Ohori-Morita, Y.; Limraksasin, P.; Tiskratok, W.; Yamamoto, M.; Egusa, H. Stiffness-Tunable Hydrogel-Sandwich Culture Modulates the YAP-Mediated Mechanoresponse in Induced-Pluripotent Stem Cell Embryoid Bodies and Augments Cardiomyocyte Differentiation. Macromol. Biosci. 2023, 23, e2300021. [Google Scholar] [CrossRef] [Scilit]
- Garrido, C.A.; Garske, D.S.; Amini, S.; Duda, G.N.; Schmidt-Bleek, K.; Cipitria, A. 3D Patterns in Alginate Hydrogel Degradation Spatially Guide YAP Nuclear Translocation and hMSC Osteogenic Differentiation. bioRxiv 2024. [Google Scholar] [CrossRef] [Scilit]
- Leal-Egaña, A.; Braumann, U.-D.; Díaz-Cuenca, A.; Nowicki, M.; Bader, A. Determination of Pore Size Distribution at the Cell-Hydrogel Interface. J. Nanobiotechnol. 2011, 9, 24. [Google Scholar] [CrossRef] [Scilit]
- Kersey, A.L.; Cheng, D.Y.; Deo, K.A.; Dubell, C.R.; Wang, T.-C.; Jaiswal, M.K.; Kim, M.H.; Murali, A.; Hargett, S.E.; Mallick, S.; et al. Stiffness Assisted Cell-Matrix Remodeling Trigger 3D Mechanotransduction Regulatory Programs. Biomaterials 2024, 306, 122473. [Google Scholar] [CrossRef] [Scilit]
- Damkham, N.; Issaragrisil, S.; Lorthongpanich, C. Role of YAP as a Mechanosensing Molecule in Stem Cells and Stem Cell-Derived Hematopoietic Cells. Int. J. Mol. Sci. 2022, 23, 14634. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Elblová, P.; Lunova, M.; Dejneka, A.; Jirsa, M.; Lunov, O. Impact of Mechanical Cues on Key Cell Functions and Cell-Nanoparticle Interactions. Discov. Nano 2024, 19, 106. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khussein, A.M.A. Mechanotransdauction: How Cells Sense and React to Mechanical Stimulation. Fundam. Appl. Res. Key Propr. Areas Bioecol. Biotechnol. 2023, 168–182. [Google Scholar] [CrossRef] [Scilit]
- Jakus, A.E.; Geisendorfer, N.R.; Lewis, P.L.; Shah, R.N. 3D-Printing Porosity: A New Approach to Creating Elevated Porosity Materials and Structures. Acta Biomater. 2018, 72, 94–109. [Google Scholar] [CrossRef] [Scilit]
- Halder, G.; Dupont, S.; Piccolo, S. Transduction of Mechanical and Cytoskeletal Cues by YAP and TAZ. Nat. Rev. Mol. Cell Biol. 2012, 13, 591–600. [Google Scholar] [CrossRef] [Scilit]
- Dupont, S.; Morsut, L.; Aragona, M.; Enzo, E.; Giulitti, S.; Cordenonsi, M.; Zanconato, F.; Le Digabel, J.; Forcato, M.; Bicciato, S.; et al. Role of YAP/TAZ in Mechanotransduction. Nature 2011, 474, 179–183. [Google Scholar] [CrossRef] [Scilit]
- Song, Y.; Na, H.; Lee, S.E.; Kim, Y.M.; Moon, J.; Nam, T.W.; Ji, Y.; Jin, Y.; Park, J.H.; Cho, S.C.; et al. Dysfunctional Adipocytes Promote Tumor Progression through YAP/TAZ-Dependent Cancer-Associated Adipocyte Transformation. Nat. Commun. 2024, 15, 4052. [Google Scholar] [CrossRef] [Scilit]
- Engler, A.J.; Sen, S.; Sweeney, H.L.; Discher, D.E. Matrix Elasticity Directs Stem Cell Lineage Specification. Cell 2006, 126, 677–689. [Google Scholar] [CrossRef] [Scilit]
- Zhao, B.; Li, L.; Wang, L.; Wang, C.-Y.; Yu, J.; Guan, K.-L. Cell Detachment Activates the Hippo Pathway via Cytoskeleton Reorganization to Induce Anoikis. Genes Dev. 2012, 26, 54–68. [Google Scholar] [CrossRef] [Scilit]
- Piccolo, S.; Dupont, S.; Cordenonsi, M. The Biology of YAP/TAZ: Hippo Signaling and Beyond. Physiol. Rev. 2014, 94, 1287–1312. [Google Scholar] [CrossRef] [Scilit]
- Lian, I.; Kim, J.; Okazawa, H.; Zhao, J.; Zhao, B.; Yu, J.; Chinnaiyan, A.; Israel, M.A.; Goldstein, L.S.B.; Abujarour, R.; et al. The Role of YAP Transcription Coactivator in Regulating Stem Cell Self-Renewal and Differentiation. Genes Dev. 2010, 24, 1106–1118. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lorthongpanich, C.; Thumanu, K.; Tangkiettrakul, K.; Jiamvoraphong, N.; Laowtammathron, C.; Damkham, N.; U-Pratya, Y.; Issaragrisil, S. YAP as a Key Regulator of Adipo-Osteogenic Differentiation in Human MSCs. Stem Cell Res. Ther. 2019, 10, 402. [Google Scholar] [CrossRef] [Scilit]
- Quan, Y.; Shan, X.; Hu, M.; Jin, P.; Ma, J.; Fan, J.; Yang, J.; Zhang, H.; Fan, X.; Gong, Y.; et al. YAP Inhibition Promotes Endothelial Cell Differentiation from Pluripotent Stem Cell through EC Master Transcription Factor FLI1. J. Mol. Cell. Cardiol. 2022, 163, 81–96. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Berthold, R.; Isfort, I.; Erkut, C.; Heinst, L.; Grünewald, I.; Wardelmann, E.; Kindler, T.; Åman, P.; Grünewald, T.G.P.; Cidre-Aranaz, F.; et al. Fusion Protein-Driven IGF-IR/PI3K/AKT Signals Deregulate Hippo Pathway Promoting Oncogenic Cooperation of YAP1 and FUS-DDIT3 in Myxoid Liposarcoma. Oncogenesis 2022, 11, 20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Duan, Y.; Li, X.; Zuo, X.; Shen, T.; Yu, S.; Deng, L.; Gao, C. Migration of Endothelial Cells and Mesenchymal Stem Cells into Hyaluronic Acid Hydrogels with Different Moduli under Induction of Pro-Inflammatory Macrophages. J. Mater. Chem. B 2019, 7, 5478–5489. [Google Scholar] [CrossRef] [Scilit]
- Cai, G.; Li, X.; Lin, S.-S.; Chen, S.J.; Rodgers, N.C.; Koning, K.M.; Bi, D.; Liu, A.P. Matrix Confinement Modulates 3D Spheroid Sorting and Burst-like Collective Migration. Acta Biomater. 2024, 179, 192–206. [Google Scholar] [CrossRef] [Scilit]
- Oliver-De La Cruz, J.; Nardone, G.; Vrbsky, J.; Pompeiano, A.; Perestrelo, A.R.; Capradossi, F.; Melajová, K.; Filipensky, P.; Forte, G. Substrate Mechanics Controls Adipogenesis through YAP Phosphorylation by Dictating Cell Spreading. Biomaterials 2019, 205, 64–80. [Google Scholar] [CrossRef] [Scilit]
- Choi, S.; Kang, J.-G.; Tran, Y.T.H.; Jeong, S.-H.; Park, K.-Y.; Shin, H.; Kim, Y.H.; Park, M.; Nahmgoong, H.; Seol, T.; et al. Hippo-YAP/TAZ Signalling Coordinates Adipose Plasticity and Energy Balance by Uncoupling Leptin Expression from Fat Mass. Nat. Metab. 2024, 6, 847–860. [Google Scholar] [CrossRef] [Scilit]
- Pan, J.-X.; Xiong, L.; Zhao, K.; Zeng, P.; Wang, B.; Tang, F.-L.; Sun, D.; Guo, H.; Yang, X.; Cui, S.; et al. YAP Promotes Osteogenesis and Suppresses Adipogenic Differentiation by Regulating β-Catenin Signaling. Bone Res. 2018, 6, 18. [Google Scholar] [CrossRef] [Scilit]
- Emon, B.; Joy, M.S.H.; Lalonde, L.; Ghrayeb, A.; Doha, U.; Ladehoff, L.; Brockstein, R.; Saengow, C.; Ewoldt, R.H.; Saif, M.T.A. Nuclear Deformation Regulates YAP Dynamics in Cancer Associated Fibroblasts. Acta Biomater. 2024, 173, 93–108. [Google Scholar] [CrossRef] [Scilit]
- Ehrlicher, A. Nuclear Mechanics and Deformation Regulate Cellular Lineage and Senescence via YAP Mechanotransduction. Biophys. J. 2024, 123, 2A. [Google Scholar] [CrossRef] [Scilit]
- Scott, K.E.; Fraley, S.I.; Rangamani, P. A Spatial Model of YAP/TAZ Signaling Reveals How Stiffness, Dimensionality, and Shape Contribute to Emergent Outcomes. Proc. Natl. Acad. Sci. USA 2021, 118, e2021571118. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brusatin, G.; Panciera, T.; Gandin, A.; Citron, A.; Piccolo, S. Biomaterials and Engineered Microenvironments to Control YAP/TAZ-Dependent Cell Behavior. Nat. Mater. 2018, 17, 1063–1075. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, M.; Spill, F.; Zaman, M.H. A Computational Model of YAP/TAZ Mechanosensing. Biophys. J. 2016, 110, 2540–2550. [Google Scholar] [CrossRef] [Scilit]
- Mikos, A.G. 3D Micropattern Force Regulates Stem Cell Function. Natl. Sci. Rev. 2023, 10, nwad198. [Google Scholar] [CrossRef] [Scilit]
- Virdi, J.K.; Pethe, P. Biomaterials Regulate Mechanosensors YAP/TAZ in Stem Cell Growth and Differentiation. Tissue Eng. Regen. Med. 2021, 18, 199–215. [Google Scholar] [CrossRef] [Scilit]
- Dasgupta, I.; McCollum, D. Control of Cellular Responses to Mechanical Cues through YAP/TAZ Regulation. J. Biol. Chem. 2019, 294, 17693–17706. [Google Scholar] [CrossRef] [Scilit]
- Petersen, O.W.; Rønnov-Jessen, L.; Howlett, A.R.; Bissell, M.J. Interaction with Basement Membrane Serves to Rapidly Distinguish Growth and Differentiation Pattern of Normal and Malignant Human Breast Epithelial Cells. Proc. Natl. Acad. Sci. USA 1992, 89, 9064–9068. [Google Scholar] [CrossRef] [Scilit]






| Target | Forward Primer (3′–5′) | Reverse Primer (5′–3′) |
|---|---|---|
| GAPDH | GCATCTTCTTGTGCAGTGCC | GATGGTGATGGGTTTCCCGT |
| LPL | GAGAAGGGGCTTGGAGATGT | ATGCCTTGCTGGGGTTTTCT |
| ADIPOQ | CCGTTCTCTTCACCTACGAC | TTCCCCATACACTTGGAGCC |
| PPARa | TCGTGGAGTCCTGGAACTGA | CTTCAGTCTTGGCTCGCCTC |
| FABP-4 | AGAAGTGGGAGTTGGCTTCG | ACTCTCTGACCGGATGACGA |
| Antibody | Company | Item Number | Attributes | Dilution Ratio |
|---|---|---|---|---|
| Phospho-YAP | Cell Signaling | 4911 | Rabbit | 1:1000 |
| YAP | Cell Signaling | 14074S | Rabbit | 1:1000 |
| GAPDH | Santa Cruz Biotechnology | SC-47724 | Mouse | 1:500 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dong, D.-L.; Jin, G.-Z. YAP and ECM Stiffness: Key Drivers of Adipocyte Differentiation and Lipid Accumulation. Cells 2024, 13, 1905. https://doi.org/10.3390/cells13221905
Dong D-L, Jin G-Z. YAP and ECM Stiffness: Key Drivers of Adipocyte Differentiation and Lipid Accumulation. Cells. 2024; 13(22):1905. https://doi.org/10.3390/cells13221905
Chicago/Turabian StyleDong, Da-Long, and Guang-Zhen Jin. 2024. "YAP and ECM Stiffness: Key Drivers of Adipocyte Differentiation and Lipid Accumulation" Cells 13, no. 22: 1905. https://doi.org/10.3390/cells13221905
APA StyleDong, D.-L., & Jin, G.-Z. (2024). YAP and ECM Stiffness: Key Drivers of Adipocyte Differentiation and Lipid Accumulation. Cells, 13(22), 1905. https://doi.org/10.3390/cells13221905

