Towards Understanding the Development of Breast Cancer: The Role of RhoJ in the Obesity Microenvironment
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemicals
2.2. Cell Lines and Cell Culture
2.3. Cell Lysis and Protein Quantification
2.4. Western Blot Analysis
2.5. Gene Expression Analysis Using qRT-PCR
2.5.1. RNA Extraction
2.5.2. Reverse Transcription
2.5.3. qRT-PCR
2.6. RNA Sequencing
2.6.1. RNA Library Prep Protocol
2.6.2. Sequencing Protocol
2.7. Invasion Assay
2.8. Annexin V-FITC/PI Staining
2.9. Soft Agar Colony Formation
2.10. Cell Viability and Proliferation
2.11. Immunofluorescence
2.12. Animals and Diet
2.13. Protein Extraction from Mammary Gland
2.14. Statistical Analysis
3. Results
3.1. Obesity Micro-Environment Promotes Cellular Morphology Changes, Epithelial-to-Mesenchymal Transition, and Invasion
3.2. Obesity Micro-Environment Induces DNA Damage Accumulation in Cultured Epithelial Cells
3.3. In the Obesity Micro-Environment, Cells Become Resistant to Conventional Chemotherapy
3.4. Obesity Micro-Environment Promotes Cellular Proliferation and Anchorage-Independent Cell Growth
3.5. Gene Expression Analysis Uncovered a New Pathway Involved in Breast Cancer Development in Obese Individuals
3.5.1. CCR5 and CCL7
3.5.2. RhoJ and PAK1
3.6. Breast Cancer Cell Line Screening
4. Discussion and Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Collaboration NCDRF. Trends in adult body-mass index in 200 countries from 1975 to 2014: A pooled analysis of 1698 population-based measurement studies with 19.2 million participants. Lancet 2016, 387, 1377–1396. [Google Scholar] [CrossRef] [PubMed]
- Stone, T.W.; McPherson, M.; Gail Darlington, L. Obesity and Cancer: Existing and New Hypotheses for a Causal Connection. EBioMedicine 2018, 30, 14–28. [Google Scholar] [CrossRef] [PubMed]
- Swinburn, B.; Sacks, G.; Ravussin, E. Increased food energy supply is more than sufficient to explain the US epidemic of obesity. Am. J. Clin. Nutr. 2009, 90, 1453–1456. [Google Scholar] [CrossRef]
- Cameron, A.J.; Welborn, T.A.; Zimmet, P.Z.; Dunstan, D.W.; Owen, N.; Salmon, J.; Dalton, M.; Jolley, D.; Shaw, J.E. Overweight and obesity in Australia: The 1999-2000 Australian Diabetes, Obesity and Lifestyle Study (AusDiab). Med. J. Aust. 2003, 178, 427–432. [Google Scholar] [CrossRef]
- Bhaskaran, K.; Douglas, I.; Forbes, H.; dos-Santos-Silva, I.; Leon, D.A.; Smeeth, L. Body-mass index and risk of 22 specific cancers: A population-based cohort study of 5.24 million UK adults. Lancet 2014, 384, 755–765. [Google Scholar] [CrossRef]
- Renehan, A.G.; Tyson, M.; Egger, M.; Heller, R.F.; Zwahlen, M. Body-mass index and incidence of cancer: A systematic review and meta-analysis of prospective observational studies. Lancet 2008, 371, 569–578. [Google Scholar] [CrossRef] [PubMed]
- Bray, F.; Ferlay, J.; Soerjomataram, I.; Siegel, R.L.; Torre, L.A.; Jemal, A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2018, 68, 394–424. [Google Scholar] [CrossRef]
- Wu, J.; Bostrom, P.; Sparks, L.M.; Ye, L.; Choi, J.H.; Giang, A.H.; Khandekar, M.; Virtanen, K.A.; Nuutila, P.; Schaart, G.; et al. Beige adipocytes are a distinct type of thermogenic fat cell in mouse and human. Cell 2012, 150, 366–376. [Google Scholar] [CrossRef]
- Longo, M.; Zatterale, F.; Naderi, J.; Parrillo, L.; Formisano, P.; Raciti, G.A.; Beguinot, F.; Miele, C. Adipose Tissue Dysfunction as Determinant of Obesity-Associated Metabolic Complications. Int. J. Mol. Sci. 2019, 20, 2358. [Google Scholar] [CrossRef]
- Kolb, R.; Zhang, W. Obesity and Breast Cancer: A Case of Inflamed Adipose Tissue. Cancers 2020, 12, 1686. [Google Scholar] [CrossRef]
- Bou Malhab, L.J.; Abdel-Rahman, W.M. Obesity and inflammation: Colorectal cancer engines. Curr. Mol. Pharmacol. 2021, 15, 620–646. [Google Scholar] [CrossRef]
- De Pergola, G.; Silvestris, F. Obesity as a major risk factor for cancer. J. Obes. 2013, 2013, 291546. [Google Scholar] [CrossRef] [PubMed]
- Cao, H. Adipocytokines in obesity and metabolic disease. J. Endocrinol. 2014, 220, T47–T59. [Google Scholar] [CrossRef]
- Romacho, T.; Valencia, I.; Ramos-Gonzalez, M.; Vallejo, S.; Lopez-Esteban, M.; Lorenzo, O.; Cannata, P.; Romero, A.; San Hipolito-Luengo, A.; Gomez-Cerezo, J.F.; et al. Visfatin/eNampt induces endothelial dysfunction in vivo: A role for Toll-Like Receptor 4 and NLRP3 inflammasome. Sci. Rep. 2020, 10, 5386. [Google Scholar] [CrossRef] [PubMed]
- Abdalla, M.M.I. Role of visfatin in obesity-induced insulin resistance. World J. Clin. Cases 2022, 10, 10840–10851. [Google Scholar] [CrossRef] [PubMed]
- Dec, P.; Poniewierska-Baran, A.; Modrzejewski, A.; Pawlik, A. The Role of Omentin-1 in Cancers Development and Progression. Cancers 2023, 15, 3797. [Google Scholar] [CrossRef]
- Lorincz, A.M.; Sukumar, S. Molecular links between obesity and breast cancer. Endocr. Relat. Cancer 2006, 13, 279–292. [Google Scholar] [CrossRef] [PubMed]
- Iyengar, P.; Combs, T.P.; Shah, S.J.; Gouon-Evans, V.; Pollard, J.W.; Albanese, C.; Flanagan, L.; Tenniswood, M.P.; Guha, C.; Lisanti, M.P.; et al. Adipocyte-secreted factors synergistically promote mammary tumorigenesis through induction of anti-apoptotic transcriptional programs and proto-oncogene stabilization. Oncogene 2003, 22, 6408–6423. [Google Scholar] [CrossRef]
- Ishikawa, M.; Kitayama, J.; Nagawa, H. Enhanced expression of leptin and leptin receptor (OB-R) in human breast cancer. Clin. Cancer Res. 2004, 10, 4325–4331. [Google Scholar] [CrossRef]
- Hotamisligil, G.S.; Shargill, N.S.; Spiegelman, B.M. Adipose expression of tumor necrosis factor-alpha: Direct role in obesity-linked insulin resistance. Science 1993, 259, 87–91. [Google Scholar] [CrossRef]
- do Nascimento, C.O.; Hunter, L.; Trayhurn, P. Regulation of haptoglobin gene expression in 3T3-L1 adipocytes by cytokines, catecholamines, and PPARgamma. Biochem. Biophys. Res. Commun. 2004, 313, 702–708. [Google Scholar] [CrossRef] [PubMed]
- Sindhu, S.; Thomas, R.; Shihab, P.; Sriraman, D.; Behbehani, K.; Ahmad, R. Obesity Is a Positive Modulator of IL-6R and IL-6 Expression in the Subcutaneous Adipose Tissue: Significance for Metabolic Inflammation. PLoS ONE 2015, 10, e0133494. [Google Scholar] [CrossRef] [PubMed]
- Carter, J.C.; Church, F.C. Obesity and breast cancer: The roles of peroxisome proliferator-activated receptor-gamma and plasminogen activator inhibitor-1. PPAR Res. 2009, 2009, 345320. [Google Scholar] [CrossRef]
- Wrzeszcz, K.; Rhone, P.; Kwiatkowska, K.; Ruszkowska-Ciastek, B. Hypercoagulability State Combined with Post-Treatment Hypofibrinolysis in Invasive Breast Cancer: A Seven-Year Follow-Up Evaluating Disease-Free and Overall Survival. Life 2023, 13, 1106. [Google Scholar] [CrossRef] [PubMed]
- Wrzeszcz, K.; Slomka, A.; Zarychta, E.; Rhone, P.; Ruszkowska-Ciastek, B. Tissue Plasminogen Activator as a Possible Indicator of Breast Cancer Relapse: A Preliminary, Prospective Study. J. Clin. Med. 2022, 11, 2398. [Google Scholar] [CrossRef] [PubMed]
- Bhardwaj, P.; Brown, K.A. Obese Adipose Tissue as a Driver of Breast Cancer Growth and Development: Update and Emerging Evidence. Front. Oncol. 2021, 11, 638918. [Google Scholar] [CrossRef] [PubMed]
- Larsson, S.C.; Wolk, A. Overweight, obesity and risk of liver cancer: A meta-analysis of cohort studies. Br. J. Cancer 2007, 97, 1005–1008. [Google Scholar] [CrossRef] [PubMed]
- Vona-Davis, L.; Rose, D.P. Adipokines as endocrine, paracrine, and autocrine factors in breast cancer risk and progression. Endocr. Relat. Cancer 2007, 14, 189–206. [Google Scholar] [CrossRef]
- Marino, N.; German, R.; Rao, X.; Simpson, E.; Liu, S.; Wan, J.; Liu, Y.; Sandusky, G.; Jacobsen, M.; Stoval, M.; et al. Upregulation of lipid metabolism genes in the breast prior to cancer diagnosis. NPJ Breast Cancer 2020, 6, 50. [Google Scholar] [CrossRef]
- Macis, D.; Guerrieri-Gonzaga, A.; Gandini, S. Circulating adiponectin and breast cancer risk: A systematic review and meta-analysis. Int. J. Epidemiol. 2014, 43, 1226–1236. [Google Scholar] [CrossRef]
- Bielawski, K.; Rhone, P.; Bulsa, M.; Ruszkowska-Ciastek, B. Pre-Operative Combination of Normal BMI with Elevated YKL-40 and Leptin but Lower Adiponectin Level Is Linked to a Higher Risk of Breast Cancer Relapse: A Report of Four-Year Follow-Up Study. J. Clin. Med. 2020, 9, 1742. [Google Scholar] [CrossRef] [PubMed]
- Aindelis, G.; Tiptiri-Kourpeti, A.; Lampri, E.; Spyridopoulou, K.; Lamprianidou, E.; Kotsianidis, I.; Ypsilantis, P.; Pappa, A.; Chlichlia, K. Immune Responses Raised in an Experimental Colon Carcinoma Model Following Oral Administration of Lactobacillus casei. Cancers 2020, 12, 368. [Google Scholar] [CrossRef]
- Aaronson, S.A. Growth factors and cancer. Science 1991, 254, 1146–1153. [Google Scholar] [CrossRef]
- Ackermann, K.L.; Florke, R.R.; Reyes, S.S.; Tader, B.R.; Hamann, M.J. TCL/RhoJ Plasma Membrane Localization and Nucleotide Exchange Is Coordinately Regulated by Amino Acids within the N Terminus and a Distal Loop Region. J. Biol. Chem. 2016, 291, 23604–23617. [Google Scholar] [CrossRef] [PubMed]
- Ho, H.; Soto Hopkin, A.; Kapadia, R.; Vasudeva, P.; Schilling, J.; Ganesan, A.K. RhoJ modulates melanoma invasion by altering actin cytoskeletal dynamics. Pigment. Cell Melanoma Res. 2013, 26, 218–225. [Google Scholar] [CrossRef] [PubMed]
- Nishizuka, M.; Arimoto, E.; Tsuchiya, T.; Nishihara, T.; Imagawa, M. Crucial role of TCL/TC10beta L, a subfamily of Rho GTPase, in adipocyte differentiation. J. Biol. Chem. 2003, 278, 15279–15284. [Google Scholar] [CrossRef]
- Xiao, L.; Wang, J.; Li, J.; Chen, X.; Xu, P.; Sun, S.; He, D.; Cong, Y.; Zhai, Y. RORalpha inhibits adipocyte-conditioned medium-induced colorectal cancer cell proliferation and migration and chick embryo chorioallantoic membrane angiopoiesis. Am. J. Physiol. Cell Physiol. 2015, 308, C385–C396. [Google Scholar] [CrossRef][Green Version]
- Dai, X.; Cheng, H.; Bai, Z.; Li, J. Breast Cancer Cell Line Classification and Its Relevance with Breast Tumor Subtyping. J. Cancer 2017, 8, 3131–3141. [Google Scholar] [CrossRef]
- Gelsomino, L.; Giordano, C.; Camera, G.; Sisci, D.; Marsico, S.; Campana, A.; Tarallo, R.; Rinaldi, A.; Fuqua, S.; Leggio, A.; et al. Leptin Signaling Contributes to Aromatase Inhibitor Resistant Breast Cancer Cell Growth and Activation of Macrophages. Biomolecules 2020, 10, 543. [Google Scholar] [CrossRef]
- Rojas, A.; Liu, G.; Coleman, I.; Nelson, P.S.; Zhang, M.; Dash, R.; Fisher, P.B.; Plymate, S.R.; Wu, J.D. IL-6 promotes prostate tumorigenesis and progression through autocrine cross-activation of IGF-IR. Oncogene 2011, 30, 2345–2355. [Google Scholar] [CrossRef]
- Liu, W.; Wang, H.; Bai, F.; Ding, L.; Huang, Y.; Lu, C.; Chen, S.; Li, C.; Yue, X.; Liang, X.; et al. IL-6 promotes metastasis of non-small-cell lung cancer by up-regulating TIM-4 via NF-kappaB. Cell Prolif. 2020, 53, e12776. [Google Scholar] [CrossRef] [PubMed]
- Lyu, Y.; Xu, X.; Yun, J.; Yi, J.; Li, X.; Liu, X.; Ling, R.; Wang, L.; Fan, J. [TNF-alpha regulates the proliferation of human breast cancer cells via regulation of ceramide content]. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi 2017, 33, 1303–1309. [Google Scholar]
- Teliga-Czajkowska, J.; Sienko, J.; Jalinik, K.; Derlatka, P.; Danska-Bidzinska, A.; Czajkowski, K. Plasminogen Activator Inhibitor Type 1 in Blood at Onset of Chemotherapy Unfavorably Affects Survival in Primary Ovarian Cancer. Adv. Exp. Med. Biol. 2019, 1153, 47–54. [Google Scholar] [CrossRef] [PubMed]
- Kuri-Harcuch, W.; Green, H. Adipose conversion of 3T3 cells depends on a serum factor. Proc. Natl. Acad. Sci. USA 1978, 75, 6107–6109. [Google Scholar] [CrossRef] [PubMed]
- Bhaskaran, S.; Unnikrishnan, A.; Ranjit, R.; Qaisar, R.; Pharaoh, G.; Matyi, S.; Kinter, M.; Deepa, S.S. A fish oil diet induces mitochondrial uncoupling and mitochondrial unfolded protein response in epididymal white adipose tissue of mice. Free Radic. Biol. Med. 2017, 108, 704–714. [Google Scholar] [CrossRef] [PubMed]
- Gurley, J.M.; Ilkayeva, O.; Jackson, R.M.; Griesel, B.A.; White, P.; Matsuzaki, S.; Qaisar, R.; Van Remmen, H.; Humphries, K.M.; Newgard, C.B.; et al. Enhanced GLUT4-Dependent Glucose Transport Relieves Nutrient Stress in Obese Mice Through Changes in Lipid and Amino Acid Metabolism. Diabetes 2016, 65, 3585–3597. [Google Scholar] [CrossRef]
- Holland, W.L.; Miller, R.A.; Wang, Z.V.; Sun, K.; Barth, B.M.; Bui, H.H.; Davis, K.E.; Bikman, B.T.; Halberg, N.; Rutkowski, J.M.; et al. Receptor-mediated activation of ceramidase activity initiates the pleiotropic actions of adiponectin. Nat. Med. 2011, 17, 55–63. [Google Scholar] [CrossRef] [PubMed]
- Hoda, M.R.; Keely, S.J.; Bertelsen, L.S.; Junger, W.G.; Dharmasena, D.; Barrett, K.E. Leptin acts as a mitogenic and antiapoptotic factor for colonic cancer cells. Br. J. Surg. 2007, 94, 346–354. [Google Scholar] [CrossRef]
- Dubois, V.; Delort, L.; Billard, H.; Vasson, M.P.; Caldefie-Chezet, F. Breast cancer and obesity: In vitro interferences between adipokines and proangiogenic features and/or antitumor therapies? PLoS ONE 2013, 8, e58541. [Google Scholar] [CrossRef]
- Nair, V.A.; Valo, S.; Peltomaki, P.; Bajbouj, K.; Abdel-Rahman, W.M. Oncogenic Potential of Bisphenol A and Common Environmental Contaminants in Human Mammary Epithelial Cells. Int. J. Mol. Sci. 2020, 21, 3735. [Google Scholar] [CrossRef]
- Smalley, K.S.; Brafford, P.; Haass, N.K.; Brandner, J.M.; Brown, E.; Herlyn, M. Up-regulated expression of zonula occludens protein-1 in human melanoma associates with N-cadherin and contributes to invasion and adhesion. Am. J. Pathol. 2005, 166, 1541–1554. [Google Scholar] [CrossRef] [PubMed]
- Gerashchenko, T.S.; Novikov, N.M.; Krakhmal, N.V.; Zolotaryova, S.Y.; Zavyalova, M.V.; Cherdyntseva, N.V.; Denisov, E.V.; Perelmuter, V.M. Markers of Cancer Cell Invasion: Are They Good Enough? J. Clin. Med. 2019, 8, 1092. [Google Scholar] [CrossRef] [PubMed]
- Gialeli, C.; Theocharis, A.D.; Karamanos, N.K. Roles of matrix metalloproteinases in cancer progression and their pharmacological targeting. FEBS J. 2011, 278, 16–27. [Google Scholar] [CrossRef]
- Mehner, C.; Hockla, A.; Miller, E.; Ran, S.; Radisky, D.C.; Radisky, E.S. Tumor cell-produced matrix metalloproteinase 9 (MMP-9) drives malignant progression and metastasis of basal-like triple negative breast cancer. Oncotarget 2014, 5, 2736–2749. [Google Scholar] [CrossRef] [PubMed]
- Awasthi, P.; Foiani, M.; Kumar, A. ATM and ATR signaling at a glance. J. Cell Sci. 2016, 129, 1285. [Google Scholar] [CrossRef]
- Loughery, J.; Cox, M.; Smith, L.M.; Meek, D.W. Critical role for p53-serine 15 phosphorylation in stimulating transactivation at p53-responsive promoters. Nucleic Acids Res. 2014, 42, 7666–7680. [Google Scholar] [CrossRef]
- Choi, M.; Kipps, T.; Kurzrock, R. ATM Mutations in Cancer: Therapeutic Implications. Mol. Cancer Ther. 2016, 15, 1781–1791. [Google Scholar] [CrossRef]
- Mansoori, B.; Mohammadi, A.; Davudian, S.; Shirjang, S.; Baradaran, B. The Different Mechanisms of Cancer Drug Resistance: A Brief Review. Adv. Pharm. Bull. 2017, 7, 339–348. [Google Scholar] [CrossRef]
- Chaitanya, G.V.; Steven, A.J.; Babu, P.P. PARP-1 cleavage fragments: Signatures of cell-death proteases in neurodegeneration. Cell Commun. Signal 2010, 8, 31. [Google Scholar] [CrossRef]
- Prokhorova, E.A.; Kopeina, G.S.; Lavrik, I.N.; Zhivotovsky, B. Apoptosis regulation by subcellular relocation of caspases. Sci. Rep. 2018, 8, 12199. [Google Scholar] [CrossRef]
- Kamada, S.; Kikkawa, U.; Tsujimoto, Y.; Hunter, T. Nuclear translocation of caspase-3 is dependent on its proteolytic activation and recognition of a substrate-like protein(s). J. Biol. Chem. 2005, 280, 857–860. [Google Scholar] [CrossRef] [PubMed]
- Menyhart, O.; Harami-Papp, H.; Sukumar, S.; Schafer, R.; Magnani, L.; de Barrios, O.; Gyorffy, B. Guidelines for the selection of functional assays to evaluate the hallmarks of cancer. Biochim. Biophys. Acta 2016, 1866, 300–319. [Google Scholar] [CrossRef]
- Achari, A.E.; Jain, S.K. Adiponectin, a Therapeutic Target for Obesity, Diabetes, and Endothelial Dysfunction. Int. J. Mol. Sci. 2017, 18, 1321. [Google Scholar] [CrossRef]
- Ahirwar, A.K.; Jain, A.; Goswami, B.; Bhatnagar, M.K.; Bhatacharjee, J. Imbalance between protective (adiponectin) and prothrombotic (Plasminogen Activator Inhibitor-1) adipokines in metabolic syndrome. Diabetes Metab. Syndr. 2014, 8, 152–155. [Google Scholar] [CrossRef] [PubMed]
- Alexandre, M.; Uduman, A.K.; Minervini, S.; Raoof, A.; Shugrue, C.A.; Akinbiyi, E.O.; Patel, V.; Shitia, M.; Kolodecik, T.R.; Patton, R.; et al. Tobacco carcinogen 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone initiates and enhances pancreatitis responses. Am. J. Physiol. Gastrointest. Liver Physiol. 2012, 303, G696–G704. [Google Scholar] [CrossRef]
- Aldinucci, D.; Lorenzon, D.; Cattaruzza, L.; Pinto, A.; Gloghini, A.; Carbone, A.; Colombatti, A. Expression of CCR5 receptors on Reed-Sternberg cells and Hodgkin lymphoma cell lines: Involvement of CCL5/Rantes in tumor cell growth and microenvironmental interactions. Int. J. Cancer 2008, 122, 769–776. [Google Scholar] [CrossRef] [PubMed]
- Abdouh, M.; Zhou, S.; Arena, V.; Arena, M.; Lazaris, A.; Onerheim, R.; Metrakos, P.; Arena, G.O. Transfer of malignant trait to immortalized human cells following exposure to human cancer serum. J. Exp. Clin. Cancer Res. 2014, 33, 86. [Google Scholar] [CrossRef]
- Adam, L.; Vadlamudi, R.; Mandal, M.; Chernoff, J.; Kumar, R. Regulation of microfilament reorganization and invasiveness of breast cancer cells by kinase dead p21-activated kinase-1. J. Biol. Chem. 2000, 275, 12041–12050. [Google Scholar] [CrossRef]
- Al-Shibli, S.M.; Harun, N.; Ashour, A.E.; Mohd Kasmuri, M.H.B.; Mizan, S. Expression of leptin and leptin receptors in colorectal cancer-an immunohistochemical study. PeerJ 2019, 7, e7624. [Google Scholar] [CrossRef]
- Abdulkhaleq, L.A.; Assi, M.A.; Abdullah, R.; Zamri-Saad, M.; Taufiq-Yap, Y.H.; Hezmee, M.N.M. The crucial roles of inflammatory mediators in inflammation: A review. Vet. World 2018, 11, 627–635. [Google Scholar] [CrossRef]
- Liu, Y.; Cai, Y.; Liu, L.; Wu, Y.; Xiong, X. Crucial biological functions of CCL7 in cancer. PeerJ 2018, 6, e4928. [Google Scholar] [CrossRef] [PubMed]
- de Oliveira, C.E.; Oda, J.M.; Losi Guembarovski, R.; de Oliveira, K.B.; Ariza, C.B.; Neto, J.S.; Banin Hirata, B.K.; Watanabe, M.A. CC chemokine receptor 5: The interface of host immunity and cancer. Dis. Markers 2014, 2014, 126954. [Google Scholar] [CrossRef] [PubMed]
- Fox, J.M.; Kasprowicz, R.; Hartley, O.; Signoret, N. CCR5 susceptibility to ligand-mediated down-modulation differs between human T lymphocytes and myeloid cells. J. Leukoc. Biol. 2015, 98, 59–71. [Google Scholar] [CrossRef] [PubMed]
- Barmania, F.; Pepper, M.S. C-C chemokine receptor type five (CCR5): An emerging target for the control of HIV infection. Appl. Transl. Genom. 2013, 2, 3–16. [Google Scholar] [CrossRef] [PubMed]
- Lin, T.C.; Hsiao, M. Leptin and Cancer: Updated Functional Roles in Carcinogenesis, Therapeutic Niches, and Developments. Int. J. Mol. Sci. 2021, 22, 2870. [Google Scholar] [CrossRef]
- Park, K.B.; Kim, E.Y.; Chin, H.; Yoon, D.J.; Jun, K.H. Leptin stimulates migration and invasion and maintains cancer stem--like properties in gastric cancer cells. Oncol. Rep. 2022, 48, 162. [Google Scholar] [CrossRef] [PubMed]
- Sanchez-Jimenez, F.; Perez-Perez, A.; de la Cruz-Merino, L.; Sanchez-Margalet, V. Obesity and Breast Cancer: Role of Leptin. Front. Oncol. 2019, 9, 596. [Google Scholar] [CrossRef]
- Kumari, N.; Dwarakanath, B.S.; Das, A.; Bhatt, A.N. Role of interleukin-6 in cancer progression and therapeutic resistance. Tumour Biol. 2016, 37, 11553–11572. [Google Scholar] [CrossRef]
- Raskova, M.; Lacina, L.; Kejik, Z.; Venhauerova, A.; Skalickova, M.; Kolar, M.; Jakubek, M.; Rosel, D.; Smetana, K., Jr.; Brabek, J. The Role of IL-6 in Cancer Cell Invasiveness and Metastasis-Overview and Therapeutic Opportunities. Cells 2022, 11, 3698. [Google Scholar] [CrossRef]
- Shrestha, R.; Bridle, K.R.; Crawford, D.H.G.; Jayachandran, A. TNF--alpha--mediated epithelial--to--mesenchymal transition regulates expression of immune checkpoint molecules in hepatocellular carcinoma. Mol. Med. Rep. 2020, 21, 1849–1860. [Google Scholar] [CrossRef]
- Yu, L.; Mu, Y.; Sa, N.; Wang, H.; Xu, W. Tumor necrosis factor alpha induces epithelial-mesenchymal transition and promotes metastasis via NF-kappaB signaling pathway-mediated TWIST expression in hypopharyngeal cancer. Oncol. Rep. 2014, 31, 321–327. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.; Zhang, W.; Tang, L.; Chen, W.; Guan, X. Epithelial-mesenchymal transition induced PAI-1 is associated with prognosis of triple-negative breast cancer patients. Gene 2018, 670, 7–14. [Google Scholar] [CrossRef] [PubMed]
- Bocian-Jastrzebska, A.; Malczewska-Herman, A.; Kos-Kudla, B. Role of Leptin and Adiponectin in Carcinogenesis. Cancers 2023, 15, 4250. [Google Scholar] [CrossRef] [PubMed]
- Parida, S.; Siddharth, S.; Sharma, D. Adiponectin, Obesity, and Cancer: Clash of the Bigwigs in Health and Disease. Int. J. Mol. Sci. 2019, 20, 2519. [Google Scholar] [CrossRef] [PubMed]
- Hanahan, D.; Weinberg, R.A. Hallmarks of cancer: The next generation. Cell 2011, 144, 646–674. [Google Scholar] [CrossRef] [PubMed]
- Mashimo, M.; Onishi, M.; Uno, A.; Tanimichi, A.; Nobeyama, A.; Mori, M.; Yamada, S.; Negi, S.; Bu, X.; Kato, J.; et al. The 89-kDa PARP1 cleavage fragment serves as a cytoplasmic PAR carrier to induce AIF-mediated apoptosis. J. Biol. Chem. 2021, 296, 100046. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.; Zeng, Y.; Huang, L.; Zhang, X.; Bi, L.; Fan, W.; Wu, G. RHOJ as a novel mechanosensitive modulator of endothelial inflammation. Biochem. Biophys. Res. Commun. 2023, 670, 36–46. [Google Scholar] [CrossRef]
- Kalpana, G.; Figy, C.; Yeung, M.; Yeung, K.C. Reduced RhoA expression enhances breast cancer metastasis with a concomitant increase in CCR5 and CXCR4 chemokines signaling. Sci. Rep. 2019, 9, 16351. [Google Scholar] [CrossRef]
- Sordella, R.; Classon, M.; Hu, K.Q.; Matheson, S.F.; Brouns, M.R.; Fine, B.; Zhang, L.; Takami, H.; Yamada, Y.; Settleman, J. Modulation of CREB activity by the Rho GTPase regulates cell and organism size during mouse embryonic development. Dev. Cell 2002, 2, 553–565. [Google Scholar] [CrossRef]
- Banerjee, A.; Pirrone, V.; Wigdahl, B.; Nonnemacher, M.R. Transcriptional regulation of the chemokine co-receptor CCR5 by the cAMP/PKA/CREB pathway. Biomed. Pharmacother. 2011, 65, 293–297. [Google Scholar] [CrossRef]
- Ho, H.; Aruri, J.; Kapadia, R.; Mehr, H.; White, M.A.; Ganesan, A.K. RhoJ regulates melanoma chemoresistance by suppressing pathways that sense DNA damage. Cancer Res. 2012, 72, 5516–5528. [Google Scholar] [CrossRef] [PubMed]
- Balasenthil, S.; Sahin, A.A.; Barnes, C.J.; Wang, R.A.; Pestell, R.G.; Vadlamudi, R.K.; Kumar, R. p21-activated kinase-1 signaling mediates cyclin D1 expression in mammary epithelial and cancer cells. J. Biol. Chem. 2004, 279, 1422–1428. [Google Scholar] [CrossRef] [PubMed]
- Salh, B.; Marotta, A.; Wagey, R.; Sayed, M.; Pelech, S. Dysregulation of phosphatidylinositol 3-kinase and downstream effectors in human breast cancer. Int. J. Cancer 2002, 98, 148–154. [Google Scholar] [CrossRef] [PubMed]
- Shi, T.T.; Li, G.; Xiao, H.T. The Role of RhoJ in Endothelial Cell Biology and Tumor Pathology. Biomed. Res. Int. 2016, 2016, 6386412. [Google Scholar] [CrossRef]
- Rider, L.; Oladimeji, P.; Diakonova, M. PAK1 regulates breast cancer cell invasion through secretion of matrix metalloproteinases in response to prolactin and three-dimensional collagen IV. Mol. Endocrinol. 2013, 27, 1048–1064. [Google Scholar] [CrossRef]
Primary Antibodies | Dilutions | Species | References | Catalog Number |
---|---|---|---|---|
E-cadherin | 1:1000 | Rabbit | Cell signaling, Danvers, MA, USA | 3195 |
N-cadherin | 1:1000 | Rabbit | Cell signaling, Danvers, MA, USA | 13116 |
ZO-1 | 1:1000 | Rabbit | Cell signaling, Danvers, MA, USA | 8193 |
ß-catenin | 1:1000 | Rabbit | Cell signaling, Danvers, MA, USA | 8480 |
Check1 | 1:1000 | Rabbit | Cell signaling, Danvers, MA, USA | 2360s |
Phospho-check1 | 1:1000 | Rabbit | Cell signaling, Danvers, MA, USA | 2348s |
Check 2 | 1:1000 | Rabbit | Cell signaling, Danvers, MA, USA | 6334s |
Phospho-check2 | 1:1000 | Rabbit | Cell signaling, Danvers, MA, USA | 2197s |
H2A X | 1:1000 | Rabbit | Cell signaling, Danvers, MA, USA | 7631s |
Phospho-H2A x | 1:1000 | Rabbit | Cell signaling, Danvers, MA, USA | 9718s |
Phospho-ATM | 1:1000 | Rabbit | Cell signaling, Danvers, MA, USA | 5883p |
Phospho-ATR | 1:1000 | Rabbit | Cell signaling, Danvers, MA, USA | 2853p |
p53 | 1:1000 | Mouse | Cell signaling, Danvers, MA, USA | 48818s |
Phospho-p53 (S15) | 1:1000 | Rabbit | Cell signaling, Danvers, MA, USA | 9286s |
CCR5 | 1:1000 | Rabbit | Abcam, Cambridge, UK | Ab65850 |
CCL7 | 1:1000 | Mouse | Biolegend, San Diego, CA, USA | AF-456-SP |
RhoJ | 1:250 | Mouse | Abnova, Taipei, Taiwan | H00057381-M01 |
ß-Actin | 1:1000 | Rabbit | Cell signaling, Danvers, MA, USA | 4970s |
Primers Sequences (Homo Sapiens) | |
---|---|
Wnt10A forward | GTGCTCCTHTTCTTCCTACTGC |
Wnt10A reverse | CCTGGCAATGTTAGGCACACTG |
RhoJ forward | TTGCTCGGACTGTATGACACCG |
RhoJ reverse | CCTGGACATTGTGGTAAGAGGC |
CCR5 forward | TCTCTTCTGGGCTCCCTACAAC |
CCR5 reverse | CCAAGAGTCTCTGTCACCTGCA |
MMP9 forward | GCCACTACTGTGCCTTTGAGTC |
MMP9 reverse | CCCTCAGAGAATCGCCAGTACT |
CCL7 forward | ACAGAAGGACCACCAGTAGCCA |
CCL7 reverse | GGTGCTTCATAAAGTCCTGGACC |
GAPDH forward | GTCTCCTCTGACTTCAACAGCG |
GAPDH reverse | ACCACCCTGTTGCTGTAGCCAA |
RPL18 forward | GCAGAATCCACGCCAGTACAAG |
RPL18 reverse | GCTTGTTGTCCAGACCATTGGC |
Antibodies | Dilutions | Species | References | Catalog Number |
---|---|---|---|---|
Active Caspase-3 | 1:500 | Rabbit | BD Biosciences, San Jose, CA, USA | 559565 |
Alexa fluorTM 594 goat anti-rabbit IgG (H + L) | 1:250 | Rabbit | Invitrogen, Waltham, MA, USA | A32740 |
Alexa fluorTM 488goat anti-mouse IgG (H + L) | 1:250 | Mouse | Invitrogen, Waltham, MA, USA | A32723 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bou Malhab, L.J.; Nair, V.A.; Qaisar, R.; Pintus, G.; Abdel-Rahman, W.M. Towards Understanding the Development of Breast Cancer: The Role of RhoJ in the Obesity Microenvironment. Cells 2024, 13, 174. https://doi.org/10.3390/cells13020174
Bou Malhab LJ, Nair VA, Qaisar R, Pintus G, Abdel-Rahman WM. Towards Understanding the Development of Breast Cancer: The Role of RhoJ in the Obesity Microenvironment. Cells. 2024; 13(2):174. https://doi.org/10.3390/cells13020174
Chicago/Turabian StyleBou Malhab, Lara J., Vidhya A. Nair, Rizwan Qaisar, Gianfranco Pintus, and Wael M. Abdel-Rahman. 2024. "Towards Understanding the Development of Breast Cancer: The Role of RhoJ in the Obesity Microenvironment" Cells 13, no. 2: 174. https://doi.org/10.3390/cells13020174
APA StyleBou Malhab, L. J., Nair, V. A., Qaisar, R., Pintus, G., & Abdel-Rahman, W. M. (2024). Towards Understanding the Development of Breast Cancer: The Role of RhoJ in the Obesity Microenvironment. Cells, 13(2), 174. https://doi.org/10.3390/cells13020174