Flaxseed Oil Alleviates Trimethyltin-Induced Cell Injury and Inhibits the Pro-Inflammatory Activation of Astrocytes in the Hippocampus of Female Rats
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Treatments
2.2. Primary Astrocyte Cultures and Treatments
2.3. MTT Assay
2.4. Histology, Immunohistochemistry, and Immunofluorescence
2.5. Gene Expression Analysis by RT-qPCR
2.6. Preparation of Membrane Fraction
2.7. SDS-PAGE and Immunoblotting
2.8. Hippocampal Fatty Acid Analysis
2.9. Data Analysis
3. Results
3.1. FSO Attenuated TMT-Induced Cell Death
3.2. FSO Affects Signaling Molecules Involved in Cell Survival
3.3. FSO Alters Components of Glutamatergic Transmission
3.4. FSO Attenuated Gliosis at the Late Stage of TMT Intoxication
3.5. FSO Alters Hippocampal Fatty Acid Composition
3.6. ALA Attenuated TMT-Induced Inflammatory Astrocyte Phenotype In Vitro
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lamptey, R.N.L.; Chaulagain, B.; Trivedi, R.; Gothwal, A.; Layek, B.; Singh, J. A Review of the Common Neurodegenerative Disorders: Current Therapeutic Approaches and the Potential Role of Nanotherapeutics. Int. J. Mol. Sci. 2022, 23, 1851. [Google Scholar] [CrossRef] [PubMed]
- Breijyeh, Z.; Karaman, R. Comprehensive Review on Alzheimer’s Disease: Causes and Treatment. Molecules 2020, 25, 5789. [Google Scholar] [CrossRef]
- Delamarre, A.; Meissner, W.G. Epidemiology, Environmental Risk Factors and Genetics of Parkinson’s Disease. Presse Med. 2017, 46, 175–181. [Google Scholar] [CrossRef] [PubMed]
- Ferraz da Silva, I.; Freitas-Lima, L.C.; Graceli, J.B.; Rodrigues, L.C.d.M. Organotins in Neuronal Damage, Brain Function, and Behavior: A Short Review. Front. Endocrinol. 2017, 8, 366. [Google Scholar] [CrossRef] [PubMed]
- Trabucco, A.; Di Pietro, P.; Nori, S.L.; Fulceri, F.; Fumagalli, L.; Paparelli, A.; Fornai, F. Methylated Tin Toxicity a Reappraisal Using Rodents Models. Arch. Ital. Biol. 2009, 147, 141–153. [Google Scholar] [PubMed]
- Pompili, E.; Fabrizi, C.; Fumagalli, L.; Fornai, F. Autophagy in Trimethyltin-Induced Neurodegeneration. J. Neural Transm. 2020, 127, 987–998. [Google Scholar] [CrossRef] [PubMed]
- Geloso, M.C.; Corvino, V.; Michetti, F. Trimethyltin-Induced Hippocampal Degeneration as a Tool to Investigate Neurodegenerative Processes. Neurochem. Int. 2011, 58, 729–738. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.; Yang, M.; Kim, J.; Kang, S.; Kim, J.; Kim, J.C.; Jung, C.; Shin, T.; Kim, S.H.; Moon, C. Trimethyltin-Induced Hippocampal Neurodegeneration: A Mechanism-Based Review. Brain Res. Bull. 2016, 125, 187–199. [Google Scholar] [CrossRef]
- Dragić, M.; Mitrović, N.; Adžić, M.; Nedeljković, N.; Grković, I. Microglial- and Astrocyte-Specific Expression of Purinergic Signaling Components and Inflammatory Mediators in the Rat Hippocampus During Trimethyltin-Induced Neurodegeneration. ASN Neuro 2021, 13, 17590914211044882. [Google Scholar] [CrossRef]
- Dragić, M.; Zarić, M.; Mitrović, N.; Nedeljković, N.; Grković, I. Two Distinct Hippocampal Astrocyte Morphotypes Reveal Subfield-Different Fate during Neurodegeneration Induced by Trimethyltin Intoxication. Neuroscience 2019, 423, 38–54. [Google Scholar] [CrossRef]
- Röhl, C.; Grell, M.; Maser, E. The Organotin Compounds Trimethyltin (TMT) and Triethyltin (TET) but Not Tributyltin (TBT) Induce Activation of Microglia Co-Cultivated with Astrocytes. Toxicol. Vitr. Int. J. Publ. Assoc. BIBRA 2009, 23, 1541–1547. [Google Scholar] [CrossRef] [PubMed]
- Dragić, M.; Milićević, K.; Adžić, M.; Stevanović, I.; Ninković, M.; Grković, I.; Andjus, P.; Nedeljković, N. Trimethyltin Increases Intracellular Ca2+ Via L-Type Voltage-Gated Calcium Channels and Promotes Inflammatory Phenotype in Rat Astrocytes In Vitro. Mol. Neurobiol. 2021, 58, 1792–1805. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Imai, H.; Sadamatsu, M.; Tsunashima, K.; Kato, N. Cytokines Participate in Neuronal Death Induced by Trimethyltin in the Rat Hippocampus via Type II Glucocorticoid Receptors. Neurosci. Res. 2005, 51, 319–327. [Google Scholar] [CrossRef] [PubMed]
- Piacentini, R.; Gangitano, C.; Ceccariglia, S.; Fà, A.D.; Azzena, G.B.; Michetti, F.; Grassi, C. Dysregulation of Intracellular Calcium Homeostasis Is Responsible for Neuronal Death in an Experimental Model of Selective Hippocampal Degeneration Induced by Trimethyltin. J. Neurochem. 2008, 105, 2109–2121. [Google Scholar] [CrossRef] [PubMed]
- O’Callaghan, J.P.; Kelly, K.A.; VanGilder, R.L.; Sofroniew, M.V.; Miller, D.B. Early Activation of STAT3 Regulates Reactive Astrogliosis Induced by Diverse Forms of Neurotoxicity. PLoS ONE 2014, 9, e102003. [Google Scholar] [CrossRef]
- Zamanian, J.L.; Xu, L.; Foo, L.C.; Nouri, N.; Zhou, L.; Giffard, R.G.; Barres, B.A. Genomic Analysis of Reactive Astrogliosis. J. Neurosci. Off. J. Soc. Neurosci. 2012, 32, 6391–6410. [Google Scholar] [CrossRef] [PubMed]
- Parikh, M.; Maddaford, T.G.; Austria, J.A.; Aliani, M.; Netticadan, T.; Pierce, G.N. Dietary Flaxseed as a Strategy for Improving Human Health. Nutrients 2019, 11, 1171. [Google Scholar] [CrossRef]
- Shayan, M.; Kamalian, S.; Sahebkar, A.; Tayarani-Najaran, Z. Flaxseed for Health and Disease: Review of Clinical Trials. Comb. Chem. High Throughput Screen. 2020, 23, 699–722. [Google Scholar] [CrossRef]
- Sun, X.; Yu, J.; Wang, Y.; Luo, J.; Zhang, G.; Peng, X. Flaxseed Oil Ameliorates Aging in D-Galactose Induced Rats via Altering Gut Microbiota and Mitigating Oxidative Damage. J. Sci. Food Agric. 2022, 102, 6432–6442. [Google Scholar] [CrossRef]
- Han, Y.; Deng, X.; Zhang, Y.; Wang, X.; Zhu, X.; Mei, S.; Chen, A. Antidepressant-like Effect of Flaxseed in Rats Exposed to Chronic Unpredictable Stress. Brain Behav. 2020, 10, e01626. [Google Scholar] [CrossRef]
- El Tanbouly, N.; El Sayed, A.M.; Ali, Z.Y.; Abdel Wahab, S.; El Gayed, S.H.; Ezzat, S.M.; El Senousy, A.S.; Choucry, M.A.; Abdel-Sattar, E. Antidepressant-Like Effect of Selected Egyptian Cultivars of Flaxseed Oil on a Rodent Model of Postpartum Depression. Evidence-Based Complement. Altern. Med. 2017, 2017, 6405789. [Google Scholar] [CrossRef]
- Poorbaferani, F.; Rouhani, M.H.; Heidari, Z.; Poorbaferani, M.; Safavi, S.M. Flaxseed Oil Supplementation on Severity of Depression and Brain-Derived Neurotrophic Factor: A Randomized, Double Blind Placebo Controlled Clinical Trial. Int. J. Food Prop. 2020, 23, 1518–1526. [Google Scholar] [CrossRef]
- Fan, R.; Hua, Y.; Shen, J.; Xiao, R.; Ma, W. Dietary Fatty Acids Affect Learning and Memory Ability via Regulating Inflammatory Factors in Obese Mice. J. Nutr. Biochem. 2022, 103, 108959. [Google Scholar] [CrossRef] [PubMed]
- Bagheri, A.; Talei, S.; Hassanzadeh, N.; Mokhtari, T.; Akbari, M.; Malek, F.; Jameie, S.B.; Sadeghi, Y.; Hassanzadeh, G. The Neuroprotective Effects of Flaxseed Oil Supplementation on Functional Motor Recovery in a Model of Ischemic Brain Stroke: Upregulation of BDNF and GDNF. Acta Med. Iran. 2017, 55, 785–792. [Google Scholar] [PubMed]
- Abdel Moneim, A.E. Flaxseed Oil as a Neuroprotective Agent on Lead Acetate-Induced Monoamineric Alterations and Neurotoxicity in Rats. Biol. Trace Elem. Res. 2012, 148, 363–370. [Google Scholar] [CrossRef] [PubMed]
- Lounis, W.; Kessas, K.; Chouari, Z.; Benyettou, I.; Boumechhour, A.; Chaib, F.; Aoul, S.H.; Lizard, G.; Kharoubi, O. Evaluating the Role of Flaxseed Oil in Improving Neurological Impairments in Rat Pups Intoxicated by Aluminum. J. Biol. Regul. Homeost. Agents 2023, 37, 4345–4359. [Google Scholar] [CrossRef]
- Ismail, A.F.M.; Salem, A.A.M.; Eassawy, M.M.T. Modulation of Gamma-Irradiation and Carbon Tetrachloride Induced Oxidative Stress in the Brain of Female Rats by Flaxseed Oil. J. Photochem. Photobiol. B Biol. 2016, 161, 91–99. [Google Scholar] [CrossRef]
- Badawy, E.A.; Rasheed, W.I.; Elias, T.R.; Hussein, J.; Harvi, M.; Morsy, S.; El-Latif Mahmoud, Y.A. Flaxseed Oil Reduces Oxidative Stress and Enhances Brain Monoamines Release in Streptozotocin-Induced Diabetic Rats. Hum. Exp. Toxicol. 2015, 34, 1133–1138. [Google Scholar] [CrossRef] [PubMed]
- Avallone, R.; Vitale, G.; Bertolotti, M. Omega-3 Fatty Acids and Neurodegenerative Diseases: New Evidence in Clinical Trials. Int. J. Mol. Sci. 2019, 20, 4256. [Google Scholar] [CrossRef]
- Blondeau, N. The Nutraceutical Potential of Omega-3 Alpha-Linolenic Acid in Reducing the Consequences of Stroke. Biochimie 2016, 120, 49–55. [Google Scholar] [CrossRef]
- Blondeau, N.; Nguemeni, C.; Debruyne, D.N.; Piens, M.; Wu, X.; Pan, H.; Hu, X.; Gandin, C.; Lipsky, R.H.; Plumier, J.-C.; et al. Subchronic Alpha-Linolenic Acid Treatment Enhances Brain Plasticity and Exerts an Antidepressant Effect: A Versatile Potential Therapy for Stroke. Neuropsychopharmacol. Off. Publ. Am. Coll. Neuropsychopharmacol. 2009, 34, 2548–2559. [Google Scholar] [CrossRef] [PubMed]
- Piermartiri, T.; Pan, H.; Figueiredo, T.H.; Marini, A.M. α-Linolenic Acid, A Nutraceutical with Pleiotropic Properties That Targets Endogenous Neuroprotective Pathways to Protect against Organophosphate Nerve Agent-Induced Neuropathology. Molecules 2015, 20, 20355–20380. [Google Scholar] [CrossRef] [PubMed]
- Lee, A.Y.; Lee, M.H.; Lee, S.; Cho, E.J. Neuroprotective Effect of Alpha-Linolenic Acid against Aβ-Mediated Inflammatory Responses in C6 Glial Cell. J. Agric. Food Chem. 2018, 66, 4853–4861. [Google Scholar] [CrossRef] [PubMed]
- Lee, A.Y.; Choi, J.M.; Lee, M.H.; Lee, J.; Lee, S.; Cho, E.J. Protective Effects of Perilla Oil and Alpha Linolenic Acid on SH-SY5Y Neuronal Cell Death Induced by Hydrogen Peroxide. Nutr. Res. Pract. 2018, 12, 93–100. [Google Scholar] [CrossRef] [PubMed]
- Litwiniuk, A.; Domańska, A.; Chmielowska, M.; Martyńska, L.; Bik, W.; Kalisz, M. The Effects of Alpha-Linolenic Acid on the Secretory Activity of Astrocytes and β Amyloid-Associated Neurodegeneration in Differentiated SH-SY5Y Cells: Alpha-Linolenic Acid Protects the SH-SY5Y Cells against β Amyloid Toxicity. Oxid. Med. Cell. Longev. 2020, 2020, 8908901. [Google Scholar] [CrossRef] [PubMed]
- El Makawy, A.; Eissa, F.; EL-Bamby, M.; Elhamalawy, O. Flaxseed Oil as a Protective Agent against Bisphenol-A Deleterious Effects in Male Mice. Bull. Natl. Res. Cent. 2018, 42, 5. [Google Scholar] [CrossRef]
- Kaithwas, G.; Majumdar, D.K. In Vitro Antioxidant and in Vivo Antidiabetic, Antihyperlipidemic Activity of Linseed Oil against Streptozotocin-Induced Toxicity in Albino Rats. Eur. J. Lipid Sci. Technol. 2012, 114, 1237–1245. [Google Scholar] [CrossRef]
- Youness, E.R.; Hussein, J.S.; Ibrahim, A.M.M.; Agha, F.E. Flaxseed Oil Attenuates Monosodium Glutamate-Induced Brain Injury via Improvement of Fatty Acids Contents. Biomed. Pharmacol. J. 2019, 12, 527–532. [Google Scholar] [CrossRef]
- Singh, S.; Nair, V.; Gupta, Y.K. Linseed Oil: An Investigation of Its Antiarthritic Activity in Experimental Models. Phytother. Res. 2012, 26, 246–252. [Google Scholar] [CrossRef]
- Singh, S.; Nair, V.; Jain, S.; Gupta, Y.K. Evaluation of Anti-Inflammatory Activity of Plant Lipids Containing Alpha-Linolenic Acid. Indian J. Exp. Biol. 2008, 46, 453–456. [Google Scholar]
- Adzic, M.; Stevanovic, I.; Josipovic, N.; Laketa, D.; Lavrnja, I.; Bjelobaba, I.M.; Bozic, I.; Jovanovic, M.; Milosevic, M.; Nedeljkovic, N. Extracellular ATP Induces Graded Reactive Response of Astrocytes and Strengthens Their Antioxidative Defense in Vitro. J. Neurosci. Res. 2017, 95, 1053–1066. [Google Scholar] [CrossRef]
- Grković, I.; Mitrović, N.; Dragić, M.; Adžić, M.; Drakulić, D.; Nedeljković, N. Spatial Distribution and Expression of Ectonucleotidases in Rat Hippocampus After Removal of Ovaries and Estradiol Replacement. Mol. Neurobiol. 2019, 56, 1933–1945. [Google Scholar] [CrossRef] [PubMed]
- Mitrović, N.; Zarić, M.; Drakulić, D.; Martinović, J.; Sévigny, J.; Stanojlović, M.; Nedeljković, N.; Grković, I. 17β-Estradiol-Induced Synaptic Rearrangements Are Accompanied by Altered Ectonucleotidase Activities in Male Rat Hippocampal Synaptosomes. J. Mol. Neurosci. 2017, 61, 412–422. [Google Scholar] [CrossRef] [PubMed]
- Petrović, S.; Arsić, A.; Debeljak-Martačić, J.; Đurendić-Brenesel, M.; Pilija, V.; Milić, N.; Popović, T. Effects of Dietary Supplementation with a Mixture of Buckwheat Leaf and Flower on Fatty Acid Composition of Rat Brain Phospholipids. Acta Vet. Brno. 2015, 65, 390–403. [Google Scholar]
- Ceccariglia, S.; Alvino, A.; Del Fà, A.; Parolini, O.; Michetti, F.; Gangitano, C. Autophagy Is Activated In Vivo during Trimethyltin-Induced Apoptotic Neurodegeneration: A Study in the Rat Hippocampus. Int. J. Mol. Sci. 2019, 21, 175. [Google Scholar] [CrossRef] [PubMed]
- Singh, S.; Singh, T.G. Role of Nuclear Factor Kappa B (NF-ΚB) Signalling in Neurodegenerative Diseases: An Mechanistic Approach. Curr. Neuropharmacol. 2020, 18, 918–935. [Google Scholar] [CrossRef]
- Bozyczko-Coyne, D.; O’Kane, T.M.; Wu, Z.L.; Dobrzanski, P.; Murthy, S.; Vaught, J.L.; Scott, R.W. CEP-1347/KT-7515, an Inhibitor of SAPK/JNK Pathway Activation, Promotes Survival and Blocks Multiple Events Associated with Abeta-Induced Cortical Neuron Apoptosis. J. Neurochem. 2001, 77, 849–863. [Google Scholar] [CrossRef]
- Kimura, A.; Namekata, K.; Guo, X.; Harada, C.; Harada, T. Neuroprotection, Growth Factors and BDNF-TrkB Signalling in Retinal Degeneration. Int. J. Mol. Sci. 2016, 17, 1584. [Google Scholar] [CrossRef]
- Holmseth, S.; Scott, H.A.; Real, K.; Lehre, K.P.; Leergaard, T.B.; Bjaalie, J.G.; Danbolt, N.C. The Concentrations and Distributions of Three C-Terminal Variants of the GLT1 (EAAT2; Slc1a2) Glutamate Transporter Protein in Rat Brain Tissue Suggest Differential Regulation. Neuroscience 2009, 162, 1055–1071. [Google Scholar] [CrossRef]
- Healy-Stoffel, M.; Levant, B. N-3 (Omega-3) Fatty Acids: Effects on Brain Dopamine Systems and Potential Role in the Etiology and Treatment of Neuropsychiatric Disorders. CNS Neurol. Disord. Drug Targets 2018, 17, 216–232. [Google Scholar] [CrossRef]
- Buskila, Y.; Farkash, S.; Hershfinkel, M.; Amitai, Y. Rapid and Reactive Nitric Oxide Production by Astrocytes in Mouse Neocortical Slices. Glia 2005, 52, 169–176. [Google Scholar] [CrossRef]
- Kuramoto, N.; Seko, K.; Sugiyama, C.; Shuto, M.; Ogita, K. Trimethyltin Initially Activates the Caspase 8/Caspase 3 Pathway for Damaging the Primary Cultured Cortical Neurons Derived from Embryonic Mice. J. Neurosci. Res. 2011, 89, 552–561. [Google Scholar] [CrossRef]
- Zhang, L.; Li, L.; Prabhakaran, K.; Borowitz, J.L.; Isom, G.E. Trimethyltin-Induced Apoptosis Is Associated with Upregulation of Inducible Nitric Oxide Synthase and Bax in a Hippocampal Cell Line. Toxicol. Appl. Pharmacol. 2006, 216, 34–43. [Google Scholar] [CrossRef] [PubMed]
- Gasparova, Z.; Janega, P.; Stara, V.; Ujhazy, E. Early and Late Stage of Neurodegeneration Induced by Trimethyltin in Hippocampus and Cortex of Male Wistar Rats. Neuro Endocrinol. Lett. 2012, 33, 689–696. [Google Scholar] [PubMed]
- Hou, J.; Xue, J.; Wang, Z.; Li, W. Ginsenoside Rg3 and Rh2 Protect Trimethyltin-Induced Neurotoxicity via Prevention on Neuronal Apoptosis and Neuroinflammation. Phytother. Res. 2018, 32, 2531–2540. [Google Scholar] [CrossRef]
- Stekic, A.; Zeljkovic, M.; Zaric Kontic, M.; Mihajlovic, K.; Adzic, M.; Stevanovic, I.; Ninkovic, M.; Grkovic, I.; Ilic, T.V.; Nedeljkovic, N.; et al. Intermittent Theta Burst Stimulation Ameliorates Cognitive Deficit and Attenuates Neuroinflammation via PI3K/Akt/MTOR Signaling Pathway in Alzheimer’s-Like Disease Model. Front. Aging Neurosci. 2022, 14, 889983. [Google Scholar] [CrossRef]
- Lee, S.; Yang, M.; Kim, J.; Son, Y.; Kim, J.; Kang, S.; Ahn, W.; Kim, S.-H.; Kim, J.-C.; Shin, T.; et al. Involvement of BDNF/ERK Signaling in Spontaneous Recovery from Trimethyltin-Induced Hippocampal Neurotoxicity in Mice. Brain Res. Bull. 2016, 121, 48–58. [Google Scholar] [CrossRef]
- Albert-Gascó, H.; Ros-Bernal, F.; Castillo-Gómez, E.; Olucha-Bordonau, F.E. MAP/ERK Signaling in Developing Cognitive and Emotional Function and Its Effect on Pathological and Neurodegenerative Processes. Int. J. Mol. Sci. 2020, 21, 4471. [Google Scholar] [CrossRef] [PubMed]
- Choi, Y.-S.; Cho, H.-Y.; Hoyt, K.R.; Naegele, J.R.; Obrietan, K. IGF-1 Receptor-Mediated ERK/MAPK Signaling Couples Status Epilepticus to Progenitor Cell Proliferation in the Subgranular Layer of the Dentate Gyrus. Glia 2008, 56, 791–800. [Google Scholar] [CrossRef]
- Sathanoori, M.; Dias, B.G.; Nair, A.R.; Banerjee, S.B.; Tole, S.; Vaidya, V.A. Differential Regulation of Multiple Brain-Derived Neurotrophic Factor Transcripts in the Postnatal and Adult Rat Hippocampus during Development, and in Response to Kainate Administration. Brain Res. Mol. Brain Res. 2004, 130, 170–177. [Google Scholar] [CrossRef]
- Tongiorgi, E.; Baj, G. Functions and Mechanisms of BDNF MRNA Trafficking. Novartis Found. Symp. 2008, 289, 136–151, 193–195. [Google Scholar] [CrossRef] [PubMed]
- Xi, Y.; Li, W.; Wang, J.; Yu, M.; Zeng, X.; Li, H.; Li, J. Cyanidin-3-O-Glucoside Alleviates Trimethyltin Chloride-Induced Neurodegeneration by Maintaining Glutamate Homeostasis through Modulation of the Gut Microbiota. Food Sci. Hum. Wellness 2024, 13, 1093–1107. [Google Scholar] [CrossRef]
- Shi, Z.; Zhu, L.; Li, T.; Tang, X.; Xiang, Y.; Han, X.; Xia, L.; Zeng, L.; Nie, J.; Huang, Y.; et al. Neuroprotective Mechanisms of Lycium Barbarum Polysaccharides Against Ischemic Insults by Regulating NR2B and NR2A Containing NMDA Receptor Signaling Pathways. Front. Cell. Neurosci. 2017, 11, 288. [Google Scholar] [CrossRef]
- Gylys, K.H.; Fein, J.A.; Yang, F.; Wiley, D.J.; Miller, C.A.; Cole, G.M. Synaptic Changes in Alzheimer’s Disease: Increased Amyloid-Beta and Gliosis in Surviving Terminals Is Accompanied by Decreased PSD-95 Fluorescence. Am. J. Pathol. 2004, 165, 1809–1817. [Google Scholar] [CrossRef] [PubMed]
- Shao, C.Y.; Mirra, S.S.; Sait, H.B.R.; Sacktor, T.C.; Sigurdsson, E.M. Postsynaptic Degeneration as Revealed by PSD-95 Reduction Occurs after Advanced Aβ and Tau Pathology in Transgenic Mouse Models of Alzheimer’s Disease. Acta Neuropathol. 2011, 122, 285–292. [Google Scholar] [CrossRef] [PubMed]
- Escartin, C.; Galea, E.; Lakatos, A.; O’Callaghan, J.P.; Petzold, G.C.; Serrano-Pozo, A.; Steinhäuser, C.; Volterra, A.; Carmignoto, G.; Agarwal, A.; et al. Reactive Astrocyte Nomenclature, Definitions, and Future Directions. Nat. Neurosci. 2021, 24, 312–325. [Google Scholar] [CrossRef] [PubMed]
- Hwang, Y.; Kim, H.-C.; Shin, E.-J. Effect of Rottlerin on Astrocyte Phenotype Polarization after Trimethyltin Insult in the Dentate Gyrus of Mice. J. Neuroinflamm. 2022, 19, 142. [Google Scholar] [CrossRef] [PubMed]
- Liddelow, S.A.; Guttenplan, K.A.; Clarke, L.E.; Bennett, F.C.; Bohlen, C.J.; Schirmer, L.; Bennett, M.L.; Münch, A.E.; Chung, W.-S.; Peterson, T.C.; et al. Neurotoxic Reactive Astrocytes Are Induced by Activated Microglia. Nature 2017, 541, 481–487. [Google Scholar] [CrossRef] [PubMed]
- Jayaraman, A.; Htike, T.T.; James, R.; Picon, C.; Reynolds, R. TNF-Mediated Neuroinflammation Is Linked to Neuronal Necroptosis in Alzheimer’s Disease Hippocampus. Acta Neuropathol. Commun. 2021, 9, 159. [Google Scholar] [CrossRef]
- Demers, G.; Roy, J.; Machuca-Parra, A.I.; Dashtehei Pour, Z.; Bairamian, D.; Daneault, C.; Rosiers, C.D.; Ferreira, G.; Alquier, T.; Fulton, S.; et al. Fish Oil Supplementation Alleviates Metabolic and Anxiodepressive Effects of Diet-Induced Obesity and Associated Changes in Brain Lipid Composition in Mice. Int. J. Obes. 2020, 44, 1936–1945. [Google Scholar] [CrossRef]
- Kim, H.-Y.; Huang, B.X.; Spector, A.A. Molecular and Signaling Mechanisms for Docosahexaenoic Acid-Derived Neurodevelopment and Neuroprotection. Int. J. Mol. Sci. 2022, 23, 4635. [Google Scholar] [CrossRef]
- Dyall, S.C. Long-Chain Omega-3 Fatty Acids and the Brain: A Review of the Independent and Shared Effects of EPA, DPA and DHA. Front. Aging Neurosci. 2015, 7, 52. [Google Scholar] [CrossRef]
- Desale, S.E.; Dubey, T.; Chinnathambi, S. α-Linolenic Acid Inhibits Tau Aggregation and Modulates Tau Conformation. Int. J. Biol. Macromol. 2021, 166, 687–693. [Google Scholar] [CrossRef]
- Blondeau, N.; Widmann, C.; Lazdunski, M.; Heurteaux, C. Polyunsaturated Fatty Acids Induce Ischemic and Epileptic Tolerance. Neuroscience 2002, 109, 231–241. [Google Scholar] [CrossRef]
- Alam, S.-I.; Kim, M.-W.; Shah, F.A.; Saeed, K.; Ullah, R.; Kim, M.-O. Alpha-Linolenic Acid Impedes Cadmium-Induced Oxidative Stress, Neuroinflammation, and Neurodegeneration in Mouse Brain. Cells 2021, 10, 2274. [Google Scholar] [CrossRef]
- Williard, D.E.; Harmon, S.D.; Kaduce, T.L.; Preuss, M.; Moore, S.A.; Robbins, M.E.; Spector, A.A. Docosahexaenoic Acid Synthesis from N-3 Polyunsaturated Fatty Acids in Differentiated Rat Brain Astrocytes. J. Lipid Res. 2001, 42, 1368–1376. [Google Scholar] [CrossRef]






| Fatty Acids | % |
|---|---|
| Saturated fatty acids (SFA) | |
| C16:0 | 7.96 ± 0.52 |
| C18:0 | 4.29 ± 0.26 |
| ΣSFA | 12.25 ± 0.77 |
| Monounsaturated fatty acids (MUFA) | |
| C16:1 | 0.18 ± 0.04 |
| C18:1(n-9) | 22.52 ± 0.88 |
| C18:1(n-7) | 0.00 ± 0.00 |
| ΣMUFA | 22.71 ± 0.84 |
| Polyunsaturated fatty acids (PUFA) | |
| C18:3(n-6) | 0.32 ± 0.09 |
| C18:3(n-3) | 39.16 ± 1.32 |
| C20:3 | 0.22 ± 0.08 |
| C20:4 | 0.00 ± 0.00 |
| C20:5 | 0.00 ± 0.00 |
| C22:4 | 0.00 ± 0.00 |
| C22:5 | 0.00 ± 0.00 |
| C22:6 | 0.00 ± 0.00 |
| C18:2 | 25.34 ± 3.10 |
| ΣPUFA | 65.04 ± 1.61 |
| Target Gene | Sequence (5′– –3′) |
|---|---|
| CycA (Ppia) | CAAAGTTCCAAAGACAGCAGAAAA CCACCCTGGCACATGAAT |
| Caspase-3 (Casp3) | GATGTCGATGCAGCTAACC TGTCTCAATACCGCAGTCC |
| Bax (Bax) | TGCTACAGGGTTTCATCCAG CCAGTTCATCGCCAATTCG |
| Bcl-2 (Bcl2) | TGGAAAGCGTAGACAAGGAGATGC CAAGGCTCTAGGTGGTCATTCAGG |
| TNF-α (Tnf) | CCCCCATTACTCTGACCCCT CCCAGAGCCACAATTCCCTT |
| IL-10 (Il10) | GCTCAGCACTGCTATGTTGC GTCTGGCTGACTGGGAAGTG |
| IL-6 (Il6) | CCGGAGAGGAGACTTCACAG ACAGTGCATCATCGCTGTTC |
| IL-1β (Il1b) | CACCTCTCAAGCAGAGCACAG GGGTTCCATGGTGAAGTCAAC |
| BDNF (Bdnf) | GGGACCAGGAGCGTGACAA GTCCGTGGACGTTTGCTTCT |
| C3 (C3) | GCGGTACTACCAGACCATCG CTTCTGGCACGACCTTCAGT |
| S100a10 (S100a10) | GTACCCACACCTTGATGCGT CGAAAGCTCCTCTGTCATTGG |
| Lcn2 (Lcn2) | GGATCAGAACATTCGTTCCA ATGGCAAACTGGTCGTAGTC |
| NF-kB (Rela) | AGCATGTACAGATTCTGGGGAG AGAGCCGACTATCGTACAGGG |
| Jak2 (Jak2) | TGGATCAAATCCGGGACAGT TCTTGAGCAGACAGCATCACAT |
| Stat3 (Stat3) | TGTGACACCAACGACCTGC ACACTCCGAGGTCAGATCCA |
| Antibody Specificity | Source, Host Species | Dilution (in TBST or PBST) |
|---|---|---|
| Anti-Bax | Santa Cruz Biotechnology (Dallas, Texas, USA), mouse monoclonal | 1:500 |
| Anti-Bcl-2 | Santa Cruz Biotechnology (USA), rabbit polyclonal | 1:500 |
| Anti-Casp3 | Santa Cruz Biotechnology (USA), rabbit polyclonal | 1:500 |
| Anti-phospho-SAPK/JNK (Thr183/Tyr185) | Cell Signaling Technology (Danvers, Massachusetts, USA), rabbit polyclonal | 1:500 |
| Anti-JNK | Santa Cruz Biotechnology (USA), rabbit polyclonal | 1:500 |
| Anti-phospho-Akt (Ser473) | Cell Signaling Technology (USA), rabbit polyclonal | 1:1000 |
| Anti-total Akt | Cell Signaling Technology (USA), rabbit polyclonal | 1:1000 |
| Anti-phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) | Cell Signaling Technology (USA), rabbit polyclonal | 1:1000 |
| Anti-p44/42 MAPK (Erk1/2) | Cell Signaling Technology (USA), rabbit polyclonal | 1:1000 |
| Anti- NF-kB p65 | Cell Signaling Technology (USA), rabbit polyclonal | 1:2000 |
| Anti-BDNF | Santa Cruz Biotechnology (USA), rabbit polyclonal | 1:500 |
| Anti- NMDA Receptor 1 (GluN1) | Cell Signaling Technology (USA), rabbit monoclonal | 1:1000 |
| Anti- NMDA Receptor 2A (GluN2A) | Merck Millipore (Burlington, Massachusetts, USA), rabbit monoclonal | 1:1000 |
| Anti-NMDA Receptor 2B | Abcam (Cambridge, UK), mouse polyclonal | 1:4000 |
| Anti-EAAT2 (GLT-1) | Abcam (UK), rabbit monoclonal | 1:1000 |
| Anti-PSD95, clone 7E3-1B8 | Merck Millipore (USA), mouse monoclonal | 1:2000 |
| Anti-β-actin | Abcam (UK), mouse monoclonal- conjugated to HRP | 1:10,000 |
| Anti-β-tubulin | Santa Cruz Biotechnology (USA), mouse monoclonal | 1:1000 |
| Hippocampal Fatty Acid Content (%) | ||||
|---|---|---|---|---|
| Fatty Acids | Ctrl | FSO | TMT | FSO+TMT |
| C16:0 | 5.72 ± 0.96 | 9.26 ± 2.25 * | 7.83 ± 4.48 | 5.66 ± 0.98 a |
| C16:1 | 0.23 ± 0 | 0.18 ± 0.04 * | 0.29 ± 0.03 * | 0.17 ± 0.02 b |
| C18:0 | 29.14 ± 0.66 | 29.61 ± 1.68 | 29.19 ± 3.84 | 28.86 ± 0.55 |
| C18:1(n-9) | 23.89 ± 0.75 | 20.12 ± 1.34 * | 23.41 ± 1.27 | 24.11 ± 0.83 a |
| C18:1(n-7) | 4.64 ± 0.17 | 6.43 ± 0.33 * | 4.65 ± 0.41 | 4.54 ± 0.15 a |
| C18:2 | 2.08 ± 1.06 | 0.84 ± 0.03 * | 1.53 ± 0.25 | 1.62 ± 0.76 |
| C18:3(n-6) | 0.61 ± 0.04 | 0.6 ± 0.06 | 0.65 ± 0.06 | 0.6 ± 0.09 |
| C18:3(n-3) | 0.08 ± 0 | 0.14 ± 0.07 * | 0.09 ± 0.02 | 0.09 ± 0.01 |
| C20:3 | 1.1 ± 0.11 | 0.97 ± 0.13 | 1.17 ± 0.15 | 1.11 ± 0.15 |
| C20:4 | 15.2 ± 0.61 | 13.63 ± 0.23 * | 14.63 ± 0.99 | 14.99 ± 1.04 a |
| C20:5 | 0.08 ± 0.01 | 0.06 ± 0.01 * | 0.09 ± 0.02 | 0.1 ± 0.01 |
| C22:4 | 2.29 ± 0.35 | 3.07 ± 1.92 | 2.31 ± 0.31 | 2.22 ± 0.47 |
| C22:5 | 0.16 ± 0.02 | 0.2 ± 0.02 * | 0.17 ± 0.02 | 0.25 ± 0.03 *b |
| C22:6 | 14.79 ± 0.39 | 14.9 ± 1.10 | 14 ± 1.31 | 15.59 ± 0.71 *b |
| ΣSFA | 34.86 ± 1.63 | 38.87 ± 3.93 * | 37.01 ± 8.32 | 34.52 ± 1.07 a |
| ΣMUFA | 28.76 ± 0.92 | 26.72 ± 1.70 * | 28.35 ± 1.71 | 28.92 ± 0.95 a |
| ΣPUFA | 36.38 ± 2.6 | 34.4 ± 3.57 | 34.64 ± 3.13 | 36.57 ± 0.54 b |
| Σn-6 | 21.27 ± 2.17 | 19.1 ± 2.38 * | 20.28 ± 1.77 | 20.54 ± 0.55 |
| Σn-3 | 15.11 ± 0.43 | 15.3 ± 1.19 | 14.36 ± 1.36 | 16.03 ± 0.68 b |
| n-6/n-3 | 1.41 ± 5.07 | 1.25 ± 2.00 * | 1.41 ± 1.3 | 1.28 ± 0.08 b |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mitrović, N.; Adžić Bukvić, M.; Zarić Kontić, M.; Dragić, M.; Petrović, S.; Paunović, M.; Vučić, V.; Grković, I. Flaxseed Oil Alleviates Trimethyltin-Induced Cell Injury and Inhibits the Pro-Inflammatory Activation of Astrocytes in the Hippocampus of Female Rats. Cells 2024, 13, 1184. https://doi.org/10.3390/cells13141184
Mitrović N, Adžić Bukvić M, Zarić Kontić M, Dragić M, Petrović S, Paunović M, Vučić V, Grković I. Flaxseed Oil Alleviates Trimethyltin-Induced Cell Injury and Inhibits the Pro-Inflammatory Activation of Astrocytes in the Hippocampus of Female Rats. Cells. 2024; 13(14):1184. https://doi.org/10.3390/cells13141184
Chicago/Turabian StyleMitrović, Nataša, Marija Adžić Bukvić, Marina Zarić Kontić, Milorad Dragić, Snježana Petrović, Marija Paunović, Vesna Vučić, and Ivana Grković. 2024. "Flaxseed Oil Alleviates Trimethyltin-Induced Cell Injury and Inhibits the Pro-Inflammatory Activation of Astrocytes in the Hippocampus of Female Rats" Cells 13, no. 14: 1184. https://doi.org/10.3390/cells13141184
APA StyleMitrović, N., Adžić Bukvić, M., Zarić Kontić, M., Dragić, M., Petrović, S., Paunović, M., Vučić, V., & Grković, I. (2024). Flaxseed Oil Alleviates Trimethyltin-Induced Cell Injury and Inhibits the Pro-Inflammatory Activation of Astrocytes in the Hippocampus of Female Rats. Cells, 13(14), 1184. https://doi.org/10.3390/cells13141184

