Adult Human Brain Tissue Cultures to Study NeuroHIV
Abstract
1. Introduction
2. Materials and Methods
2.1. Patient Recruitment
2.2. Collection of Brain Tissue, Blood, and Cerebrospinal Fluid
2.3. Human Brain Slice Culture
2.4. Tissue Clearing and Staining
2.5. Cell Culture
2.6. PBMC Isolation, CD4+ T-Cell Purification, and MDM Differentiation
2.7. Mechanical and Enzymatic Dissociation of Tissue Slices
2.8. Dendritic Spine Staining and Analysis
2.9. Multielectrode Array (MEA) Electrophysiology
2.10. Cloning and Plasmids
2.11. Preparation of Virus Stocks
2.12. Infection of Producer Cells and Inoculation of Tissue Slices
2.13. Quantification of Spreading Infection by p24 AlphaLISA
2.14. RNA Extraction, cDNA Synthesis, and qPCR from Tissue Slices
| HIV-1 gag (0.8μM final): | 5′ GGTGCGAGAGCGTCAGTATTAAG 3′ |
| 5′ AGCTCCCTGCTTGCCCATA 3′ | |
| GAPDH (0.4μM final): | 5′ GCTCACTGGCATGGCCTTCCGTGT 3′ |
| 5′ TGGAGGAGTGGGTGTCGCTGTTGA 3′ |
2.15. Flow Cytometry
2.16. Gating Strategy and Population Calculations
2.17. Experimental Design and Statistical Analysis
3. Results
3.1. Screening of Tissue Donors and Exclusion Criteria
3.2. Preparing Human Brain Organotypic Slice Cultures
3.3. Adult Human Brain Tissue Slices Are Viable Ex Vivo for at Least Four Weeks in Culture
3.4. Slice Cultures Maintain High Dendritic Spine Density with Mature Spine Morphologies
3.5. Multi-Electrode Array Recordings of Acute Brain Slices
3.6. Cell-Associated HIV-1 Infection of Ex Vivo Human Brain Slice Cultures
3.7. Human Brain Slices Inoculated with Infected MDMs and T-Cells Can Support an HIV-1 Spreading Infection Ex Vivo
3.8. Infected Brain Slice Cultures Contain Viral RNA and Can Be Suppressed by ARVs
3.9. HIV-1-Infected Slices Are Viable in Culture up to Nine Days Post-Infection
3.10. HIV-1-Infected, GFP+ Astrocytes and Myeloid Cells Are Present in Human Brain Tissue Inoculated with Infected MDMs and T-Cells
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- van Schalkwyk, C.; Mahy, M.; Johnson, L.F.; Imai-Eaton, J.W. Updated Data and Methods for the 2023 UNAIDS HIV Estimates. J. Acquir. Immune Defic. Syndr. 2024, 95, e1–e4. [Google Scholar] [CrossRef] [PubMed]
- Ellis, R.J.; Marquine, M.J.; Kaul, M.; Fields, J.A.; Schlachetzki, J.C.M. Mechanisms underlying HIV-associated cognitive impairment and emerging therapies for its management. Nat. Rev. Neurol. 2023, 19, 668–687. [Google Scholar] [CrossRef] [PubMed]
- Chan, P.; Brew, B.J. HIV associated neurocognitive disorders in the modern antiviral treatment era: Prevalence, characteristics, biomarkers, and effects of treatment. Curr. HIV/AIDS Rep. 2014, 11, 317–324. [Google Scholar] [CrossRef] [PubMed]
- Rosenthal, J.; Tyor, W. Aging, comorbidities, and the importance of finding biomarkers for HIV-associated neurocognitive disorders. J. Neurovirol. 2019, 25, 673–685. [Google Scholar] [CrossRef] [PubMed]
- Chan, P.; Valcour, V. Neurocognition and the Aging Brain in People with HIV: Implications for Screening. Top. Antivir. Med. 2022, 29, 423–429. [Google Scholar] [PubMed]
- Nickoloff-Bybel, E.A.; Festa, L.; Meucci, O.; Gaskill, P.J. Co-receptor signaling in the pathogenesis of neuroHIV. Retrovirology 2021, 18, 24. [Google Scholar] [CrossRef] [PubMed]
- Sreeram, S.; Ye, F.; Garcia-Mesa, Y.; Nguyen, K.; El Sayed, A.; Leskov, K.; Karn, J. The potential role of HIV-1 latency in promoting neuroinflammation and HIV-1-associated neurocognitive disorder. Trends Immunol. 2022, 43, 630–639. [Google Scholar] [CrossRef]
- Marino, J.; Wigdahl, B.; Nonnemacher, M.R. Extracellular HIV-1 Tat Mediates Increased Glutamate in the CNS Leading to Onset of Senescence and Progression of HAND. Front. Aging Neurosci. 2020, 12, 168. [Google Scholar] [CrossRef]
- Sviridov, D.; Bukrinsky, M. Neuro-HIV-New insights into pathogenesis and emerging therapeutic targets. FASEB J. 2023, 37, e23301. [Google Scholar] [CrossRef]
- Gabuzda, D.; Yin, J.; Misra, V.; Chettimada, S.; Gelman, B.B. Intact Proviral DNA Analysis of the Brain Viral Reservoir and Relationship to Neuroinflammation in People with HIV on Suppressive Antiretroviral Therapy. Viruses 2023, 15, 1009. [Google Scholar] [CrossRef]
- Cochrane, C.R.; Angelovich, T.A.; Byrnes, S.J.; Waring, E.; Guanizo, A.C.; Trollope, G.S.; Zhou, J.; Vue, J.; Senior, L.; Wanicek, E.; et al. Intact HIV Proviruses Persist in the Brain Despite Viral Suppression with ART. Ann. Neurol. 2022, 92, 532–544. [Google Scholar] [CrossRef] [PubMed]
- Rudd, H.; Toborek, M. Pitfalls of Antiretroviral Therapy: Current Status and Long-Term CNS Toxicity. Biomolecules 2022, 12, 894. [Google Scholar] [CrossRef] [PubMed]
- Yuan, N.Y.; Kaul, M. Beneficial and Adverse Effects of cART Affect Neurocognitive Function in HIV-1 Infection: Balancing Viral Suppression against Neuronal Stress and Injury. J. Neuroimmune Pharmacol. 2021, 16, 90–112. [Google Scholar] [CrossRef] [PubMed]
- Roth, L.M.; Zidane, B.; Festa, L.; Putatunda, R.; Romer, M.; Monnerie, H.; Jordan-Sciutto, K.L.; Grinspan, J.B. Differential effects of integrase strand transfer inhibitors, elvitegravir and raltegravir, on oligodendrocyte maturation: A role for the integrated stress response. Glia 2021, 69, 362–376. [Google Scholar] [CrossRef] [PubMed]
- Namba, M.D.; Xie, Q.; Barker, J.M. Advancing the preclinical study of comorbid neuroHIV and substance use disorders: Current perspectives and future directions. Brain Behav. Immun. 2023, 113, 453–475. [Google Scholar] [CrossRef] [PubMed]
- Murphy, A.; Barbaro, J.; Martinez-Aguado, P.; Chilunda, V.; Jaureguiberry-Bravo, M.; Berman, J.W. The Effects of Opioids on HIV Neuropathogenesis. Front. Immunol. 2019, 10, 2445. [Google Scholar] [CrossRef] [PubMed]
- Nash, B.; Festa, L.; Lin, C.; Meucci, O. Opioid and chemokine regulation of cortical synaptodendritic damage in HIV-associated neurocognitive disorders. Brain Res. 2019, 1723, 146409. [Google Scholar] [CrossRef] [PubMed]
- Fitting, S.; McRae, M.; Hauser, K.F. Opioid and neuroHIV Comorbidity—Current and Future Perspectives. J. Neuroimmune Pharmacol. 2020, 15, 584–627. [Google Scholar] [CrossRef]
- Vines, L.; Sotelo, D.; Giddens, N.; Manza, P.; Volkow, N.D.; Wang, G.J. Neurological, Behavioral, and Pathophysiological Characterization of the Co-Occurrence of Substance Use and HIV: A Narrative Review. Brain Sci. 2023, 13, 1480. [Google Scholar] [CrossRef]
- Soontornniyomkij, V.; Kesby, J.P.; Morgan, E.E.; Bischoff-Grethe, A.; Minassian, A.; Brown, G.G.; Grant, I.; Translational Methamphetamine, A.R.C.G. Effects of HIV and Methamphetamine on Brain and Behavior: Evidence from Human Studies and Animal Models. J. Neuroimmune Pharmacol. 2016, 11, 495–510. [Google Scholar] [CrossRef]
- Hartzler, B.; Dombrowski, J.C.; Crane, H.M.; Eron, J.J.; Geng, E.H.; Christopher Mathews, W.; Mayer, K.H.; Moore, R.D.; Mugavero, M.J.; Napravnik, S.; et al. Prevalence and Predictors of Substance Use Disorders Among HIV Care Enrollees in the United States. AIDS Behav. 2017, 21, 1138–1148. [Google Scholar] [CrossRef] [PubMed]
- Garner, B.R.; Gotham, H.J.; Knudsen, H.K.; Zulkiewicz, B.A.; Tueller, S.J.; Berzofsky, M.; Donohoe, T.; Martin, E.G.; Brown, L.L.; Gordon, T. The Prevalence and Negative Impacts of Substance Use Disorders among People with HIV in the United States: A Real-Time Delphi Survey of Key Stakeholders. AIDS Behav. 2022, 26, 1183–1196. [Google Scholar] [CrossRef] [PubMed]
- Irollo, E.; Luchetta, J.; Ho, C.; Nash, B.; Meucci, O. Mechanisms of neuronal dysfunction in HIV-associated neurocognitive disorders. Cell. Mol. Life Sci. 2021, 78, 4283–4303. [Google Scholar] [CrossRef] [PubMed]
- Gelman, B.B.; Endsley, J.; Kolson, D. When do models of NeuroAIDS faithfully imitate “the real thing”? J. Neurovirol. 2018, 24, 146–155. [Google Scholar] [CrossRef] [PubMed]
- McGuire, J.L.; Barrett, J.S.; Vezina, H.E.; Spitsin, S.; Douglas, S.D. Adjuvant therapies for HIV-associated neurocognitive disorders. Ann. Clin. Transl. Neurol. 2014, 1, 938–952. [Google Scholar] [CrossRef] [PubMed]
- Omeragic, A.; Kayode, O.; Hoque, M.T.; Bendayan, R. Potential pharmacological approaches for the treatment of HIV-1 associated neurocognitive disorders. Fluids Barriers CNS 2020, 17, 42. [Google Scholar] [CrossRef] [PubMed]
- Gonzalez-Scarano, F.; Martin-Garcia, J. The neuropathogenesis of AIDS. Nat. Rev. Immunol. 2005, 5, 69–81. [Google Scholar] [CrossRef]
- Peluso, R.; Haase, A.; Stowring, L.; Edwards, M.; Ventura, P. A Trojan Horse mechanism for the spread of visna virus in monocytes. Virology 1985, 147, 231–236. [Google Scholar] [CrossRef]
- Hsu, C.W.; Cerda, J., 3rd; Kirk, J.M.; Turner, W.D.; Rasmussen, T.L.; Flores Suarez, C.P.; Dickinson, M.E.; Wythe, J.D. EZ Clear for simple, rapid, and robust mouse whole organ clearing. eLife 2022, 11, e77419. [Google Scholar] [CrossRef]
- Seabold, G.K.; Daunais, J.B.; Rau, A.; Grant, K.A.; Alvarez, V.A. DiOLISTIC labeling of neurons from rodent and non-human primate brain slices. J. Vis. Exp. 2010, 6, 2081. [Google Scholar] [CrossRef]
- Rodriguez, A.; Ehlenberger, D.B.; Dickstein, D.L.; Hof, P.R.; Wearne, S.L. Automated three-dimensional detection and shape classification of dendritic spines from fluorescence microscopy images. PLoS ONE 2008, 3, e1997. [Google Scholar] [CrossRef]
- Schindler, M.; Munch, J.; Kirchhoff, F. Human immunodeficiency virus type 1 inhibits DNA damage-triggered apoptosis by a Nef-independent mechanism. J. Virol. 2005, 79, 5489–5498. [Google Scholar] [CrossRef]
- Schindler, M.; Wurfl, S.; Benaroch, P.; Greenough, T.C.; Daniels, R.; Easterbrook, P.; Brenner, M.; Munch, J.; Kirchhoff, F. Down-modulation of mature major histocompatibility complex class II and up-regulation of invariant chain cell surface expression are well-conserved functions of human and simian immunodeficiency virus nef alleles. J. Virol. 2003, 77, 10548–10556. [Google Scholar] [CrossRef] [PubMed]
- Chesebro, B.; Nishio, J.; Perryman, S.; Cann, A.; O’Brien, W.; Chen, I.S.; Wehrly, K. Identification of human immunodeficiency virus envelope gene sequences influencing viral entry into CD4-positive HeLa cells, T-leukemia cells, and macrophages. J. Virol. 1991, 65, 5782–5789. [Google Scholar] [CrossRef] [PubMed]
- Toohey, K.; Wehrly, K.; Nishio, J.; Perryman, S.; Chesebro, B. Human immunodeficiency virus envelope V1 and V2 regions influence replication efficiency in macrophages by affecting virus spread. Virology 1995, 213, 70–79. [Google Scholar] [CrossRef] [PubMed]
- Walter, B.L.; Wehrly, K.; Swanstrom, R.; Platt, E.; Kabat, D.; Chesebro, B. Role of low CD4 levels in the influence of human immunodeficiency virus type 1 envelope V1 and V2 regions on entry and spread in macrophages. J. Virol. 2005, 79, 4828–4837. [Google Scholar] [CrossRef] [PubMed]
- Chesebro, B.; Wehrly, K.; Nishio, J.; Perryman, S. Macrophage-tropic human immunodeficiency virus isolates from different patients exhibit unusual V3 envelope sequence homogeneity in comparison with T-cell-tropic isolates: Definition of critical amino acids involved in cell tropism. J. Virol. 1992, 66, 6547–6554. [Google Scholar] [CrossRef]
- Januszka, J.E.; Drwiega, E.N.; Badowski, M.E. Bictegravir/Emtricitabine/Tenofovir Alafenamide for HIV-1: What is the Hidden Potential of This Emerging Treatment? HIV AIDS (Auckl.) 2023, 15, 705–711. [Google Scholar] [CrossRef]
- Tsiang, M.; Jones, G.S.; Goldsmith, J.; Mulato, A.; Hansen, D.; Kan, E.; Tsai, L.; Bam, R.A.; Stepan, G.; Stray, K.M.; et al. Antiviral Activity of Bictegravir (GS-9883), a Novel Potent HIV-1 Integrase Strand Transfer Inhibitor with an Improved Resistance Profile. Antimicrob. Agents Chemother. 2016, 60, 7086–7097. [Google Scholar] [CrossRef]
- Cottrell, M.L.; Yang, K.H.; Prince, H.M.; Sykes, C.; White, N.; Malone, S.; Dellon, E.S.; Madanick, R.D.; Shaheen, N.J.; Hudgens, M.G.; et al. A Translational Pharmacology Approach to Predicting Outcomes of Preexposure Prophylaxis Against HIV in Men and Women Using Tenofovir Disoproxil Fumarate with or without Emtricitabine. J. Infect. Dis. 2016, 214, 55–64. [Google Scholar] [CrossRef]
- Schwarz, N.; Uysal, B.; Welzer, M.; Bahr, J.C.; Layer, N.; Loffler, H.; Stanaitis, K.; Pa, H.; Weber, Y.G.; Hedrich, U.B.; et al. Long-term adult human brain slice cultures as a model system to study human CNS circuitry and disease. eLife 2019, 8, e48417. [Google Scholar] [CrossRef] [PubMed]
- Bak, A.; Koch, H.; van Loo, K.M.J.; Schmied, K.; Gittel, B.; Weber, Y.; Ort, J.; Schwarz, N.; Tauber, S.C.; Wuttke, T.V.; et al. Human organotypic brain slice cultures: A detailed and improved protocol for preparation and long-term maintenance. J. Neurosci. Methods 2024, 404, 110055. [Google Scholar] [CrossRef]
- Martin, E.; El-Behi, M.; Fontaine, B.; Delarasse, C. Analysis of Microglia and Monocyte-derived Macrophages from the Central Nervous System by Flow Cytometry. J. Vis. Exp. 2017, 124, 55781. [Google Scholar] [CrossRef]
- Jurga, A.M.; Paleczna, M.; Kuter, K.Z. Overview of General and Discriminating Markers of Differential Microglia Phenotypes. Front. Cell. Neurosci. 2020, 14, 198. [Google Scholar] [CrossRef]
- Runge, K.; Cardoso, C.; de Chevigny, A. Dendritic Spine Plasticity: Function and Mechanisms. Front. Synaptic Neurosci. 2020, 12, 36. [Google Scholar] [CrossRef] [PubMed]
- Everall, I.P.; Heaton, R.K.; Marcotte, T.D.; Ellis, R.J.; McCutchan, J.A.; Atkinson, J.H.; Grant, I.; Mallory, M.; Masliah, E. Cortical synaptic density is reduced in mild to moderate human immunodeficiency virus neurocognitive disorder. HNRC Group. HIV Neurobehavioral Research Center. Brain Pathol. 1999, 9, 209–217. [Google Scholar] [CrossRef] [PubMed]
- Masliah, E.; Heaton, R.K.; Marcotte, T.D.; Ellis, R.J.; Wiley, C.A.; Mallory, M.; Achim, C.L.; McCutchan, J.A.; Nelson, J.A.; Atkinson, J.H.; et al. Dendritic injury is a pathological substrate for human immunodeficiency virus-related cognitive disorders. HNRC Group. The HIV Neurobehavioral Research Center. Ann. Neurol. 1997, 42, 963–972. [Google Scholar] [CrossRef]
- Landovitz, R.J.; Li, S.; Eron, J.J., Jr.; Grinsztejn, B.; Dawood, H.; Liu, A.Y.; Magnus, M.; Hosseinipour, M.C.; Panchia, R.; Cottle, L.; et al. Tail-phase safety, tolerability, and pharmacokinetics of long-acting injectable cabotegravir in HIV-uninfected adults: A secondary analysis of the HPTN 077 trial. Lancet HIV 2020, 7, e472–e481. [Google Scholar] [CrossRef]
- Letendre, S.L.; Mills, A.; Hagins, D.; Swindells, S.; Felizarta, F.; Devente, J.; Bettacchi, C.; Lou, Y.; Ford, S.; Sutton, K.; et al. Pharmacokinetics and antiviral activity of cabotegravir and rilpivirine in cerebrospinal fluid following long-acting injectable administration in HIV-infected adults. J. Antimicrob. Chemother. 2020, 75, 648–655. [Google Scholar] [CrossRef]
- Schwarz, N.; Hedrich, U.B.S.; Schwarz, H.; P, A.H.; Dammeier, N.; Auffenberg, E.; Bedogni, F.; Honegger, J.B.; Lerche, H.; Wuttke, T.V.; et al. Human Cerebrospinal fluid promotes long-term neuronal viability and network function in human neocortical organotypic brain slice cultures. Sci. Rep. 2017, 7, 12249. [Google Scholar] [CrossRef]
- Akkina, R.; Barber, D.L.; Bility, M.T.; Bissig, K.D.; Burwitz, B.J.; Eichelberg, K.; Endsley, J.J.; Garcia, J.V.; Hafner, R.; Karakousis, P.C.; et al. Small Animal Models for Human Immunodeficiency Virus (HIV), Hepatitis B, and Tuberculosis: Proceedings of an NIAID Workshop. Curr. HIV Res. 2020, 18, 19–28. [Google Scholar] [CrossRef] [PubMed]
- Beck, S.E.; Queen, S.E.; Metcalf Pate, K.A.; Mangus, L.M.; Abreu, C.M.; Gama, L.; Witwer, K.W.; Adams, R.J.; Zink, M.C.; Clements, J.E.; et al. An SIV/macaque model targeted to study HIV-associated neurocognitive disorders. J. Neurovirol. 2018, 24, 204–212. [Google Scholar] [CrossRef] [PubMed]
- Mallard, J.; Williams, K. An SIV macaque model of SIV and HAND: The need for adjunctive therapies in HIV that target activated monocytes and macrophages. J. Neurovirol. 2018, 24, 213–219. [Google Scholar] [CrossRef] [PubMed]
- Vigorito, M.; Connaghan, K.P.; Chang, S.L. The HIV-1 transgenic rat model of neuroHIV. Brain Behav. Immun. 2015, 48, 336–349. [Google Scholar] [CrossRef] [PubMed]
- Dos Reis, R.S.; Sant, S.; Keeney, H.; Wagner, M.C.E.; Ayyavoo, V. Modeling HIV-1 neuropathogenesis using three-dimensional human brain organoids (hBORGs) with HIV-1 infected microglia. Sci. Rep. 2020, 10, 15209. [Google Scholar] [CrossRef] [PubMed]
- Gumbs, S.B.H.; Berdenis van Berlekom, A.; Kubler, R.; Schipper, P.J.; Gharu, L.; Boks, M.P.; Ormel, P.R.; Wensing, A.M.J.; de Witte, L.D.; Nijhuis, M. Characterization of HIV-1 Infection in Microglia-Containing Human Cerebral Organoids. Viruses 2022, 14, 829. [Google Scholar] [CrossRef] [PubMed]
- Bodnar, B.; Zhang, Y.; Liu, J.; Lin, Y.; Wang, P.; Wei, Z.; Saribas, S.; Zhu, Y.; Li, F.; Wang, X.; et al. Novel Scalable and Simplified System to Generate Microglia-Containing Cerebral Organoids From Human Induced Pluripotent Stem Cells. Front. Cell Neurosci. 2021, 15, 682272. [Google Scholar] [CrossRef] [PubMed]
- Zhao, H.H.; Haddad, G. Brain organoid protocols and limitations. Front. Cell Neurosci. 2024, 18, 1351734. [Google Scholar] [CrossRef]
- Wei, Z.; Bodnar, B.; Zhao, R.T.; Xiao, Q.; Saribas, S.; Wang, X.; Ho, W.Z.; Hu, W. Human iPSC-derived brain organoids: A 3D mini-brain model for studying HIV infection. Exp. Neurol. 2023, 364, 114386. [Google Scholar] [CrossRef]
- Tang, Y.; Chaillon, A.; Gianella, S.; Wong, L.M.; Li, D.; Simermeyer, T.L.; Porrachia, M.; Ignacio, C.; Woodworth, B.; Zhong, D.; et al. Brain microglia serve as a persistent HIV reservoir despite durable antiretroviral therapy. J. Clin. Investig. 2023, 133, e167417. [Google Scholar] [CrossRef] [PubMed]
- Williams, M.E.; Naude, P.J.W. The relationship between HIV-1 neuroinflammation, neurocognitive impairment and encephalitis pathology: A systematic review of studies investigating post-mortem brain tissue. Rev. Med. Virol. 2024, 34, e2519. [Google Scholar] [CrossRef] [PubMed]
- Boerwinkle, A.H.; Meeker, K.L.; Luckett, P.; Ances, B.M. Neuroimaging the Neuropathogenesis of HIV. Curr. HIV/AIDS Rep. 2021, 18, 221–228. [Google Scholar] [CrossRef] [PubMed]
- Martinez, R.; Eraso, D.; Geffin, R.; McCarthy, M. A two-culture method for exposure of human brain organotypic slice cultures to replicating human immunodeficiency virus type 1. J. Neurosci. Methods 2011, 200, 74–79. [Google Scholar] [CrossRef] [PubMed]
- Almeida, G.M.; Souza, J.P.; Mendes, N.D.; Pontelli, M.C.; Pinheiro, N.R.; Nogueira, G.O.; Cardoso, R.S.; Paiva, I.M.; Ferrari, G.D.; Veras, F.P.; et al. Neural Infection by Oropouche Virus in Adult Human Brain Slices Induces an Inflammatory and Toxic Response. Front. Neurosci. 2021, 15, 674576. [Google Scholar] [CrossRef] [PubMed]
- Partiot, E.; Gorda, B.; Lutz, W.; Lebrun, S.; Khalfi, P.; Mora, S.; Charlot, B.; Majzoub, K.; Desagher, S.; Ganesh, G.; et al. Organotypic culture of human brain explants as a preclinical model for AI-driven antiviral studies. EMBO Mol. Med. 2024, 16, 1004–1026. [Google Scholar] [CrossRef]
- Kramvis, I.; Mansvelder, H.D.; Meredith, R.M. Neuronal life after death: Electrophysiologic recordings from neurons in adult human brain tissue obtained through surgical resection or postmortem. Handb. Clin. Neurol. 2018, 150, 319–333. [Google Scholar] [CrossRef]
- Qi, X.R.; Verwer, R.W.H.; Bao, A.M.; Balesar, R.A.; Luchetti, S.; Zhou, J.N.; Swaab, D.F. Human Brain Slice Culture: A Useful Tool to Study Brain Disorders and Potential Therapeutic Compounds. Neurosci. Bull. 2019, 35, 244–252. [Google Scholar] [CrossRef]









| Age | N = 18 Cases |
| Mean (SD) | 57.6 (14.2) |
| Median | 58 |
| Range | 33, 82 |
| Sex, n (%) | |
| Female | 11 (61.1) |
| Male | 7 (38.9) |
| Tissue collected, n (%) | |
| Supratentorial neocortical parenchyma | 18 (100) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Van Duyne, R.; Irollo, E.; Lin, A.; Johnson, J.A.; Guillem, A.M.; O’Brien, E.V.; Merja, L.; Nash, B.; Jackson, J.G.; Sarkar, A.; et al. Adult Human Brain Tissue Cultures to Study NeuroHIV. Cells 2024, 13, 1127. https://doi.org/10.3390/cells13131127
Van Duyne R, Irollo E, Lin A, Johnson JA, Guillem AM, O’Brien EV, Merja L, Nash B, Jackson JG, Sarkar A, et al. Adult Human Brain Tissue Cultures to Study NeuroHIV. Cells. 2024; 13(13):1127. https://doi.org/10.3390/cells13131127
Chicago/Turabian StyleVan Duyne, Rachel, Elena Irollo, Angel Lin, James A. Johnson, Alain M. Guillem, Erick V. O’Brien, Laura Merja, Bradley Nash, Joshua G. Jackson, Atom Sarkar, and et al. 2024. "Adult Human Brain Tissue Cultures to Study NeuroHIV" Cells 13, no. 13: 1127. https://doi.org/10.3390/cells13131127
APA StyleVan Duyne, R., Irollo, E., Lin, A., Johnson, J. A., Guillem, A. M., O’Brien, E. V., Merja, L., Nash, B., Jackson, J. G., Sarkar, A., Klase, Z. A., & Meucci, O. (2024). Adult Human Brain Tissue Cultures to Study NeuroHIV. Cells, 13(13), 1127. https://doi.org/10.3390/cells13131127

