Mycobacterium tuberculosis FadD18 Promotes Proinflammatory Cytokine Secretion to Inhibit the Intracellular Survival of Bacillus Calmette–Guérin
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacteria and Cell Culture
2.2. Invasion and Adhesion Deficiency of BCG Mutant Selected via a BCG Transposon Library
2.3. Identification of the Transposon Insertion Site
2.4. Identification and Sequence Analysis of FadD18 In Silico
2.5. Construction of BCG Complementary Strain
2.6. Growth Curve and BCG Morphology
2.7. Intracellular Survival
2.8. Real-Time PCR and Enzyme-Linked Immunosorbent Assay (ELISA)
2.9. Statistical Analysis
3. Results
3.1. Mutant B2909 Reduced the Invasion and Adhesion Abilities of BCG
3.2. Bioinformatics Analysis of fadD18
3.3. B2909 Colonies Had a Smaller Morphology than BCG Colonies
3.4. FadD18 Inhibited the Growth of BCG
3.5. FadD18 Promoted the Expression of Proinflammatory Cytokines
3.6. FadD18 Activated the NF-κB and MAPK Signaling Pathways
4. Discussion
4.1. FadD18 Enhanced the Virulence of Mycobacteria but Inhibited Their Survival
4.2. FadD18 Enhanced the Production of Proinflammatory Cytokines via Activation of the NF-κB and MAPK Signaling Pathways
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- WHO. Global Tuberculosis Report 2023; WHO: Geneva, Switzerland, 2023. [Google Scholar]
- Baran, M.; Grimes, K.D.; Sibbald, P.A.; Fu, P.; Boshoff, H.I.M.; Wilson, D.J.; Aldrich, C.C. Development of small-molecule inhibitors of fatty acyl-AMP and fatty acyl-CoA ligases in Mycobacterium tuberculosis. Eur. J. Med. Chem. 2020, 201, 112408. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Qu, Y. Structural study of medium-long chain fatty acyl-CoA ligase FadD8 from Mycobacterium tuberculosis. Biochem. Biophys. Res. Commun. 2023, 672, 65–71. [Google Scholar] [CrossRef] [PubMed]
- Pech-Canul, Á.C.; Rivera-Hernández, G.; Nogales, J.; Geiger, O.; Soto, M.J.; López-Lara, I.M. Role of Sinorhizobium meliloti and Escherichia coli Long-Chain Acyl-CoA Synthetase FadD in Long-Term Survival. Microorganisms 2020, 8, 470. [Google Scholar] [CrossRef] [PubMed]
- Dunphy, K.Y.; Senaratne, R.H.; Masuzawa, M.; Kendall, L.V.; Riley, L.W. Attenuation of Mycobacterium tuberculosis functionally disrupted in a fatty acyl-coenzyme A synthetase gene fadD5. J. Infect. Dis. 2010, 201, 1232–1239. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Ioerger, T.R.; Wang, F.; Sacchettini, J.C. Structures of Mycobacterium tuberculosis FadD10 protein reveal a new type of adenylate-forming enzyme. J. Biol. Chem. 2013, 288, 18473–18483. [Google Scholar] [CrossRef] [PubMed]
- Siméone, R.; Léger, M.; Constant, P.; Malaga, W.; Marrakchi, H.; Daffé, M.; Guilhot, C.; Chalut, C. Delineation of the roles of FadD22, FadD26 and FadD29 in the biosynthesis of phthiocerol dimycocerosates and related compounds in Mycobacterium tuberculosis. FEBS J. 2010, 277, 2715–2725. [Google Scholar] [CrossRef]
- Zhu, Y.; Shi, H.; Tang, T.; Li, Q.; Peng, Y.; Bermudez, L.E.; Hu, C.; Chen, H.; Guo, A.; Chen, Y. Mycobacterium tuberculosis Fatty Acyl-CoA Synthetase fadD33 Promotes Bacillus Calmette-Guérin Survival in Hostile Extracellular and Intracellular Microenvironments in the Host. Cells 2023, 12, 2610. [Google Scholar] [CrossRef] [PubMed]
- Wilkins, M.R.; Gasteiger, E.; Bairoch, A.; Sanchez, J.C.; Williams, K.L.; Appel, R.D.; Hochstrasser, D.F. Protein identification and analysis tools in the ExPASy server. Methods Mol. Biol. 1999, 112, 531–552. [Google Scholar] [CrossRef] [PubMed]
- Krogh, A.; Larsson, B.; Von Heijne, G.; Sonnhammer, E.L. Predicting transmembrane protein topology with a hidden Markov model: Application to complete genomes. J. Mol. Biol. 2001, 305, 567–580. [Google Scholar] [CrossRef]
- Sievers, F.; Wilm, A.; Dineen, D.; Gibson, T.J.; Karplus, K.; Li, W.; Lopez, R.; McWilliam, H.; Remmert, M.; Söding, J.; et al. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol. Syst. Biol. 2011, 7, 539. [Google Scholar] [CrossRef] [PubMed]
- Robert, X.; Gouet, P. Deciphering key features in protein structures with the new ENDscript server. Nucleic Acids Res. 2014, 42, W320–W324. [Google Scholar] [CrossRef] [PubMed]
- Marchler-Bauer, A.; Derbyshire, M.K.; Gonzales, N.R.; Lu, S.; Chitsaz, F.; Geer, L.Y.; Geer, R.C.; He, J.; Gwadz, M.; Hurwitz, D.I. CDD: NCBI’s conserved domain database. Nucleic Acids Res. 2015, 43, D222–D226. [Google Scholar] [CrossRef] [PubMed]
- Bailey, T.L.; Boden, M.; Buske, F.A.; Frith, M.; Grant, C.E.; Clementi, L.; Ren, J.; Li, W.W.; Noble, W.S. MEME SUITE: Tools for motif discovery and searching. Nucleic Acids Res. 2009, 37, W202–W208. [Google Scholar] [CrossRef] [PubMed]
- Wrońska, N.; Brzostek, A.; Szewczyk, R.; Soboń, A.; Dziadek, J.; Lisowska, K. The role of fadD19 and echA19 in sterol side chain degradation by Mycobacterium smegmatis. Molecules 2016, 21, 598. [Google Scholar] [CrossRef] [PubMed]
- Wilbrink, M.H.; Petrusma, M.; Dijkhuizen, L.; Van Der Geize, R. FadD19 of Rhodococcus rhodochrous DSM43269, a steroid-coenzyme A ligase essential for degradation of C-24 branched sterol side chains. Appl. Environ. Microbiol. 2011, 77, 4455–4464. [Google Scholar] [CrossRef] [PubMed]
- Ashiru, O.T.; Pillay, M.; Sturm, A.W. Mycobacterium tuberculosis isolates grown under oxygen deprivation invade pulmonary epithelial cells. Anaerobe 2012, 18, 471–474. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.H.; Liu, H.; Ge, B. Innate immunity in tuberculosis: Host defense vs. pathogen evasion. Cell. Mol. Immunol. 2017, 14, 963–975. [Google Scholar] [CrossRef] [PubMed]
- Van Crevel, R.; Ottenhoff, T.H.; Van der Meer, J.W. Innate immunity to Mycobacterium tuberculosis. Clin. Microbiol. Rev. 2002, 15, 294–309. [Google Scholar] [CrossRef] [PubMed]
- Ravesloot-Chávez, M.M.; Van Dis, E.; Stanley, S.A. The innate immune response to Mycobacterium tuberculosis infection. Annu. Rev. Immunol. 2021, 39, 611–637. [Google Scholar] [CrossRef] [PubMed]
- Sherman, M.A.; Kalman, D. Initiation and resolution of mucosal inflammation. Immunol. Res. 2004, 29, 241–252. [Google Scholar] [CrossRef] [PubMed]
- Stutz, M.D.; Clark, M.P.; Doerflinger, M.; Pellegrini, M. Mycobacterium tuberculosis: Rewiring host cell signaling to promote infection. J. Leukoc. Biol. 2018, 103, 259–268. [Google Scholar] [CrossRef] [PubMed]
- Poladian, N.; Orujyan, D.; Narinyan, W.; Oganyan, A.K.; Navasardyan, I.; Velpuri, P.; Chorbajian, A.; Venketaraman, V. Role of NF-κB during Mycobacterium tuberculosis Infection. Int. J. Mol. Sci. 2023, 24, 1772. [Google Scholar] [CrossRef]
- Peng, Z.; Yue, Y.; Xiong, S. Mycobacterial PPE36 modulates host inflammation by promoting E3 ligase smurf1-mediated MyD88 degradation. Front. Immunol. 2022, 13, 690667. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Xiong, X.; Zhai, W.; Zhu, T.; Zhu, X.; Zhu, Y.; Peng, Y.; Zhang, Y.; Wang, J.; Chen, H.; et al. Upregulation of Cytokines and Differentiation of Th17 and Treg by Dendritic Cells: Central Role of Prostaglandin E2 Induced by Mycobacterium bovis. Microorganisms 2020, 8, 195. [Google Scholar] [CrossRef] [PubMed]
- Arbués, A.; Brees, D.; Chibout, S.-D.; Fox, T.; Kammüller, M.; Portevin, D. TNF-α antagonists differentially induce TGF-β1-dependent resuscitation of dormant-like Mycobacterium tuberculosis. PloS Pathog. 2020, 16, e1008312. [Google Scholar] [CrossRef]
- Harris, J.; Hope, J.C.; Lavelle, E.C. Autophagy and the immune response to TB. Transbound. Emerg. Dis. 2009, 56, 248–254. [Google Scholar] [CrossRef]
- Flynn, J.L.; Goldstein, M.M.; Chan, J.; Triebold, K.J.; Pfeffer, K.; Lowenstein, C.J.; Schrelber, R.; Mak, T.W.; Bloom, B.R. Tumor necrosis factor-α is required in the protective immune response against Mycobacterium tuberculosis in mice. Immunity 1995, 2, 561–572. [Google Scholar] [CrossRef] [PubMed]
- Leal, I.S.; Smedegård, B.; Andersen, P.; Appelberg, R. Interleukin-6 and interleukin-12 participate in induction of a type 1 protective T-cell response during vaccination with a tuberculosis subunit vaccine. Infect. Immun. 1999, 67, 5747–5754. [Google Scholar] [CrossRef] [PubMed]
- Appelberg, R.; Castro, A.G.; Pedrosa, J.; Minóprio, P. Role of interleukin-6 in the induction of protective T cells during mycobacterial infections in mice. Immunology 1994, 82, 361–364. [Google Scholar] [PubMed]
- Mishra, B.B.; Rathinam, V.A.; Martens, G.W.; Martinot, A.J.; Kornfeld, H.; Fitzgerald, K.A.; Sassetti, C.M. Nitric oxide controls the immunopathology of tuberculosis by inhibiting NLRP3 inflammasome–dependent processing of IL-1β. Nat. Immunol. 2013, 14, 52–60. [Google Scholar] [CrossRef] [PubMed]
- Zhang, G.; Zhou, B.; Li, S.; Yue, J.; Yang, H.; Wen, Y.; Zhan, S.; Wang, W.; Liao, M.; Zhang, M. Allele-specific induction of IL-1β expression by C/EBPβ and PU. 1 contributes to increased tuberculosis susceptibility. PLoS Pathog. 2014, 10, e1004426. [Google Scholar] [CrossRef] [PubMed]
- Mohareer, K.; Asalla, S.; Banerjee, S. Cell death at the cross roads of host-pathogen interaction in Mycobacterium tuberculosis infection. Tuberculosis 2018, 113, 99–121. [Google Scholar] [CrossRef]
- Nisa, A.; Kipper, F.C.; Panigrahy, D.; Tiwari, S.; Kupz, A.; Subbian, S. Different modalities of host cell death and their impact on Mycobacterium tuberculosis infection. Am. J. Physiol.-Cell Physiol. 2022, 323, C1444–C1474. [Google Scholar] [CrossRef] [PubMed]
- Schorey, J.S.; Cooper, A.M. Macrophage signalling upon mycobacterial infection: The MAP kinases lead the way. Cell. Microbiol. 2003, 5, 133–142. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Kaplan, M.H. The p38 mitogen-activated protein kinase is required for IL-12-induced IFN-γ expression. J. Immunol. 2000, 165, 1374–1380. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Zhu, X.; Peng, Y.; Zhu, T.; Liu, H.; Zhu, Y.; Xiong, X.; Chen, X.; Hu, C.; Chen, H. Mycobacterium tuberculosis YrbE3A promotes host innate immune response by targeting NF-κB/JNK signaling. Microorganisms 2020, 8, 584. [Google Scholar] [CrossRef] [PubMed]
- Yao, J.; Du, X.; Chen, S.; Shao, Y.; Deng, K.; Jiang, M.; Liu, J.; Shen, Z.; Chen, X.; Feng, G. Rv2346c enhances mycobacterial survival within macrophages by inhibiting TNF-α and IL-6 production via the p38/miRNA/NF-κB pathway. Emerg. Microbes Infect. 2018, 7, 1–16. [Google Scholar] [CrossRef] [PubMed]
- Peng, Y.; Zhu, X.; Gao, L.; Wang, J.; Liu, H.; Zhu, T.; Zhu, Y.; Tang, X.; Hu, C.; Chen, X. Mycobacterium tuberculosis Rv0309 dampens the inflammatory response and enhances mycobacterial survival. Front. Immunol. 2022, 13, 829410. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Li, B.-X.; Ge, P.-P.; Li, J.; Wang, Q.; Gao, G.F.; Qiu, X.-B.; Liu, C.H. Mycobacterium tuberculosis suppresses innate immunity by coopting the host ubiquitin system. Nat. Immunol. 2015, 16, 237–245. [Google Scholar] [CrossRef] [PubMed]
- Wei, S.; Wang, D.; Li, H.; Bi, L.; Deng, J.; Zhu, G.; Zhang, J.; Li, C.; Li, M.; Fang, Y. Fatty acylCoA synthetase FadD13 regulates proinflammatory cytokine secretion dependent on the NF-κB signalling pathway by binding to eEF1A1. Cell. Microbiol. 2019, 21, e13090. [Google Scholar] [CrossRef] [PubMed]
Primer Name | Sequence (5′-3′) | Products (bp) |
---|---|---|
IL-6 | F: ACTCACCTCTTCAGAACGAA | 149 |
R: CCATCTTTGGAAGGTTCAGG | ||
IL-1β | F: GTGGCAATGAGGATGACTTGTTC | 120 |
R: GGTGGTCGGAGATTCGTAGCT | ||
TNF-α | F: GGAGAAGGGTGACCGACTCA | 70 |
R: CTGCCCAGACTCGGCAA | ||
β-actin | F: CATGTACGTTGCTATCCAGGC | 250 |
R: CTCCTTAATGTCACGCACGAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Peng, Y.; Tang, T.; Li, Q.; Zhou, S.; Sun, Q.; Zhou, X.; Zhu, Y.; Wang, C.; Bermudez, L.E.; Liu, H.; et al. Mycobacterium tuberculosis FadD18 Promotes Proinflammatory Cytokine Secretion to Inhibit the Intracellular Survival of Bacillus Calmette–Guérin. Cells 2024, 13, 1019. https://doi.org/10.3390/cells13121019
Peng Y, Tang T, Li Q, Zhou S, Sun Q, Zhou X, Zhu Y, Wang C, Bermudez LE, Liu H, et al. Mycobacterium tuberculosis FadD18 Promotes Proinflammatory Cytokine Secretion to Inhibit the Intracellular Survival of Bacillus Calmette–Guérin. Cells. 2024; 13(12):1019. https://doi.org/10.3390/cells13121019
Chicago/Turabian StylePeng, Yongchong, Tian Tang, Qianqian Li, Shiying Zhou, Qin Sun, Xinjun Zhou, Yifan Zhu, Chao Wang, Luiz E. Bermudez, Han Liu, and et al. 2024. "Mycobacterium tuberculosis FadD18 Promotes Proinflammatory Cytokine Secretion to Inhibit the Intracellular Survival of Bacillus Calmette–Guérin" Cells 13, no. 12: 1019. https://doi.org/10.3390/cells13121019
APA StylePeng, Y., Tang, T., Li, Q., Zhou, S., Sun, Q., Zhou, X., Zhu, Y., Wang, C., Bermudez, L. E., Liu, H., Chen, H., Guo, A., & Chen, Y. (2024). Mycobacterium tuberculosis FadD18 Promotes Proinflammatory Cytokine Secretion to Inhibit the Intracellular Survival of Bacillus Calmette–Guérin. Cells, 13(12), 1019. https://doi.org/10.3390/cells13121019