LKB1 Regulates Inflammation of Fibroblast-like Synoviocytes from Patients with Rheumatoid Arthritis via AMPK-Dependent SLC7A11-NOX4-ROS Signaling
Abstract
:1. Introduction
2. Materials and Methods
2.1. Human Subjects and Ethics Statement
2.2. Reverse Transcription (RT)-PCR and Quantitative (q)RT-PCR
2.3. Western Blot Analysis
2.4. siRNA Transfection
2.5. Flow Cytometric Analysis
2.6. Enzyme-Linked Immunosorbent Assay (ELISA)
2.7. Transwell Migration Assay
2.8. Statistical Analysis
3. Results
3.1. LKB1 Knockdown Increased ROS Levels via Increased NOX4 Expression in RA FLS
3.2. LKB1 Regulated Inflammatory Cytokine Production and Cell Migration in RA FLS
3.3. LKB1-Deficient RA FLS Were Highly Sensitive to ROS-Mediated Inflammation
3.4. SLC7A11 Regulated LKB1-Mediated Cell Migration through NOX4 Signaling
3.5. The Effects of LKB1 Deficiency Were Overcome in RA FLS by Treatment with an AMPK Activator
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Arnett, F.C.; Edworthy, S.M.; Bloch, D.A.; McShane, D.J.; Fries, J.F.; Cooper, N.S.; Healey, L.A.; Kaplan, S.R.; Liang, M.H.; Luthra, H.S.; et al. The American Rheumatism Association 1987 revised criteria for the classification of rheumatoid arthritis. Arthritis Rheum. 1988, 31, 315–324. [Google Scholar] [CrossRef] [PubMed]
- Klareskog, L.; Catrina, A.I.; Paget, S. Rheumatoid arthritis. Lancet 2009, 373, 659–672. [Google Scholar] [CrossRef] [PubMed]
- Bartok, B.; Firestein, G.S. Fibroblast-like synoviocytes: Key effector cells in rheumatoid arthritis. Immunol. Rev. 2010, 233, 233–255. [Google Scholar] [CrossRef] [PubMed]
- Bottini, N.; Firestein, G.S. Duality of fibroblast-like synoviocytes in RA: Passive responders and imprinted aggressors. Nat. Rev. Rheumatol. 2013, 9, 24–33. [Google Scholar] [CrossRef]
- Yoshitomi, H. Regulation of Immune Responses and Chronic Inflammation by Fibroblast-Like Synoviocytes. Front. Immunol. 2019, 10, 1395. [Google Scholar] [CrossRef]
- Sena, L.A.; Chandel, N.S. Physiological roles of mitochondrial reactive oxygen species. Mol. Cell 2012, 48, 158–167. [Google Scholar] [CrossRef]
- Droge, W. Free radicals in the physiological control of cell function. Physiol. Rev. 2002, 82, 47–95. [Google Scholar] [CrossRef]
- Stevens, C.R.; Williams, R.B.; Farrell, A.J.; Blake, D.R. Hypoxia and inflammatory synovitis: Observations and speculation. Ann. Rheum. Dis. 1991, 50, 124–132. [Google Scholar] [CrossRef]
- Pucino, V.; Certo, M.; Varricchi, G.; Marone, G.; Ursini, F.; Rossi, F.W.; De Paulis, A.; Mauro, C.; Raza, K.; Buckley, C.D. Metabolic Checkpoints in Rheumatoid Arthritis. Front. Physiol. 2020, 11, 347. [Google Scholar] [CrossRef]
- Lee, H.R.; Yoo, S.J.; Kim, J.; Yoo, I.S.; Park, C.K.; Kang, S.W. The effect of nicotinamide adenine dinucleotide phosphate oxidase 4 on migration and invasion of fibroblast-like synoviocytes in rheumatoid arthritis. Arthritis Res. Ther. 2020, 22, 116. [Google Scholar] [CrossRef]
- Lee, H.R.; Yoo, S.J.; Kim, J.; Park, C.K.; Kang, S.W. Reduction of Oxidative Stress in Peripheral Blood Mononuclear Cells Attenuates the Inflammatory Response of Fibroblast-like Synoviocytes in Rheumatoid Arthritis. Int. J. Mol. Sci. 2021, 22, 12411. [Google Scholar] [CrossRef] [PubMed]
- Phull, A.R.; Nasir, B.; Haq, I.U.; Kim, S.J. Oxidative stress, consequences and ROS mediated cellular signaling in rheumatoid arthritis. Chem. Biol. Interact. 2018, 281, 121–136. [Google Scholar] [CrossRef] [PubMed]
- Hemminki, A.; Markie, D.; Tomlinson, I.; Avizienyte, E.; Roth, S.; Loukola, A.; Bignell, G.; Warren, W.; Aminoff, M.; Hoglund, P.; et al. A serine/threonine kinase gene defective in Peutz-Jeghers syndrome. Nature 1998, 391, 184–187. [Google Scholar] [CrossRef] [PubMed]
- Alessi, D.R.; Sakamoto, K.; Bayascas, J.R. LKB1-dependent signaling pathways. Annu. Rev. Biochem. 2006, 75, 137–163. [Google Scholar] [CrossRef] [PubMed]
- Garrido-Maraver, J.; Paz, M.V.; Cordero, M.D.; Bautista-Lorite, J.; Oropesa-Avila, M.; de la Mata, M.; Pavon, A.D.; de Lavera, I.; Alcocer-Gomez, E.; Galan, F.; et al. Critical role of AMP-activated protein kinase in the balance between mitophagy and mitochondrial biogenesis in MELAS disease. Biochim. Biophys. Acta 2015, 1852, 2535–2553. [Google Scholar] [CrossRef] [PubMed]
- Shackelford, D.B.; Shaw, R.J. The LKB1-AMPK pathway: Metabolism and growth control in tumour suppression. Nat. Rev. Cancer 2009, 9, 563–575. [Google Scholar] [CrossRef]
- Aletaha, D.; Neogi, T.; Silman, A.J.; Funovits, J.; Felson, D.T.; Bingham, C.O., 3rd; Birnbaum, N.S.; Burmester, G.R.; Bykerk, V.P.; Cohen, M.D.; et al. 2010 Rheumatoid arthritis classification criteria: An American College of Rheumatology/European League Against Rheumatism collaborative initiative. Arthritis Rheum. 2010, 62, 2569–2581. [Google Scholar] [CrossRef]
- Altman, R.; Asch, E.; Bloch, D.; Bole, G.; Borenstein, D.; Brandt, K.; Christy, W.; Cooke, T.D.; Greenwald, R.; Hochberg, M.; et al. Development of criteria for the classification and reporting of osteoarthritis. Classification of osteoarthritis of the knee. Diagnostic and Therapeutic Criteria Committee of the American Rheumatism Association. Arthritis Rheum. 1986, 29, 1039–1049. [Google Scholar] [CrossRef]
- Xu, H.G.; Zhai, Y.X.; Chen, J.; Lu, Y.; Wang, J.W.; Quan, C.S.; Zhao, R.X.; Xiao, X.; He, Q.; Werle, K.D.; et al. LKB1 reduces ROS-mediated cell damage via activation of p38. Oncogene 2015, 34, 3848–3859. [Google Scholar] [CrossRef]
- Gorlach, A.; Brandes, R.P.; Nguyen, K.; Amidi, M.; Dehghani, F.; Busse, R. A gp91phox containing NADPH oxidase selectively expressed in endothelial cells is a major source of oxygen radical generation in the arterial wall. Circ. Res. 2000, 87, 26–32. [Google Scholar] [CrossRef]
- Zhou, R.; Yazdi, A.S.; Menu, P.; Tschopp, J. A role for mitochondria in NLRP3 inflammasome activation. Nature 2011, 469, 221–225. [Google Scholar] [CrossRef] [PubMed]
- Meng, S.; Jing, L.; Zhang, W.; Wang, F.; Dong, Y.; Dong, D. Research progress on serological indices and their clinical application in rheumatoid arthritis. J. Clin. Lab. Anal. 2022, 36, e24576. [Google Scholar] [CrossRef] [PubMed]
- Xiang, J.; Wan, C.; Guo, R.; Guo, D. Is Hydrogen Peroxide a Suitable Apoptosis Inducer for All Cell Types? Biomed. Res. Int. 2016, 2016, 7343965. [Google Scholar] [CrossRef] [PubMed]
- Nisimoto, Y.; Diebold, B.A.; Cosentino-Gomes, D.; Lambeth, J.D. Nox4: A hydrogen peroxide-generating oxygen sensor. Biochemistry 2014, 53, 5111–5120. [Google Scholar] [CrossRef]
- Ginnan, R.; Jourd’heuil, F.L.; Guikema, B.; Simons, M.; Singer, H.A.; Jourd’heuil, D. NADPH oxidase 4 is required for interleukin-1beta-mediated activation of protein kinase Cdelta and downstream activation of c-jun N-terminal kinase signaling in smooth muscle. Free Radic. Biol. Med. 2013, 54, 125–134. [Google Scholar] [CrossRef]
- Lee, Y.; Itahana, Y.; Ong, C.C.; Itahana, K. Redox-dependent AMPK inactivation disrupts metabolic adaptation to glucose starvation in xCT-overexpressing cancer cells. J. Cell Sci. 2022, 135, jcs259090. [Google Scholar] [CrossRef]
- Woods, A.; Johnstone, S.R.; Dickerson, K.; Leiper, F.C.; Fryer, L.G.; Neumann, D.; Schlattner, U.; Wallimann, T.; Carlson, M.; Carling, D. LKB1 is the upstream kinase in the AMP-activated protein kinase cascade. Curr. Biol. 2003, 13, 2004–2008. [Google Scholar] [CrossRef]
- Buckland, J. Rheumatoid arthritis: Anti-TNF and anti-IL-17 antibodies—Better together! Nat. Rev. Rheumatol. 2014, 10, 699. [Google Scholar] [CrossRef]
- Ducommun, S.; Ford, R.J.; Bultot, L.; Deak, M.; Bertrand, L.; Kemp, B.E.; Steinberg, G.R.; Sakamoto, K. Enhanced activation of cellular AMPK by dual-small molecule treatment: AICAR and A769662. Am. J. Physiol. Endocrinol. Metab. 2014, 306, E688–E696. [Google Scholar] [CrossRef]
- Bonanno, L.; Zulato, E.; Pavan, A.; Attili, I.; Pasello, G.; Conte, P.; Indraccolo, S. LKB1 and Tumor Metabolism: The Interplay of Immune and Angiogenic Microenvironment in Lung Cancer. Int. J. Mol. Sci. 2019, 20, 1874. [Google Scholar] [CrossRef]
- Yue, Y.; Zong, L.; Chen, Y.; Feng, N.; Tang, J.; Xu, H.; Zhao, M. Liver kinase B1 (LKB1) reduced inflammation and oxidative stress by regulating the AMPK/NLRP3 signaling pathway in LPS-induced lung injury. Mol. Cell. Toxicol. 2021, 17, 385–395. [Google Scholar] [CrossRef]
- Zhuang, Z.G.; Di, G.H.; Shen, Z.Z.; Ding, J.; Shao, Z.M. Enhanced expression of LKB1 in breast cancer cells attenuates angiogenesis, invasion, and metastatic potential. Mol. Cancer Res. 2006, 4, 843–849. [Google Scholar] [CrossRef] [PubMed]
- Ciccarese, F.; Zulato, E.; Indraccolo, S. LKB1/AMPK Pathway and Drug Response in Cancer: A Therapeutic Perspective. Oxid. Med. Cell Longev. 2019, 2019, 8730816. [Google Scholar] [CrossRef] [PubMed]
- Clayton, S.A.; MacDonald, L.; Kurowska-Stolarska, M.; Clark, A.R. Mitochondria as Key Players in the Pathogenesis and Treatment of Rheumatoid Arthritis. Front. Immunol. 2021, 12, 673916. [Google Scholar] [CrossRef] [PubMed]
- Joo, M.S.; Kim, W.D.; Lee, K.Y.; Kim, J.H.; Koo, J.H.; Kim, S.G. AMPK Facilitates Nuclear Accumulation of Nrf2 by Phosphorylating at Serine 550. Mol. Cell Biol. 2016, 36, 1931–1942. [Google Scholar] [CrossRef] [PubMed]
- Gurumurthy, S.; Xie, S.Z.; Alagesan, B.; Kim, J.; Yusuf, R.Z.; Saez, B.; Tzatsos, A.; Ozsolak, F.; Milos, P.; Ferrari, F.; et al. The Lkb1 metabolic sensor maintains haematopoietic stem cell survival. Nature 2010, 468, 659–663. [Google Scholar] [CrossRef]
- Zhao, Q.; Han, Y.M.; Song, P.; Liu, Z.; Yuan, Z.; Zou, M.H. Endothelial cell-specific expression of serine/threonine kinase 11 modulates dendritic cell differentiation. Nat. Commun. 2022, 13, 648. [Google Scholar] [CrossRef]
- Lewerenz, J.; Hewett, S.J.; Huang, Y.; Lambros, M.; Gout, P.W.; Kalivas, P.W.; Massie, A.; Smolders, I.; Methner, A.; Pergande, M.; et al. The cystine/glutamate antiporter system xc− in health and disease: From molecular mechanisms to novel therapeutic opportunities. Antioxid. Redox Signal. 2013, 18, 522–555. [Google Scholar] [CrossRef]
- Mbah, N.E.; Lyssiotis, C.A. Metabolic regulation of ferroptosis in the tumor microenvironment. J. Biol. Chem. 2022, 298, 101617. [Google Scholar] [CrossRef]
- Zhang, L.; Liu, W.; Liu, F.; Wang, Q.; Song, M.; Yu, Q.; Tang, K.; Teng, T.; Wu, D.; Wang, X.; et al. IMCA Induces Ferroptosis Mediated by SLC7A11 through the AMPK/mTOR Pathway in Colorectal Cancer. Oxid. Med. Cell Longev. 2020, 2020, 1675613. [Google Scholar] [CrossRef]
- Lin, W.; Wang, C.; Liu, G.; Bi, C.; Wang, X.; Zhou, Q.; Jin, H. SLC7A11/xCT in cancer: Biological functions and therapeutic implications. Am. J. Cancer Res. 2020, 10, 3106–3126. [Google Scholar] [PubMed]
- Li, J.; Zhang, B.; Liu, W.X.; Lu, K.; Pan, H.; Wang, T.; Oh, C.D.; Yi, D.; Huang, J.; Zhao, L.; et al. Metformin limits osteoarthritis development and progression through activation of AMPK signalling. Ann. Rheum. Dis. 2020, 79, 635–645. [Google Scholar] [CrossRef] [PubMed]
- Gharib, M.; Elbaz, W.; Darweesh, E.; Sabri, N.A.; Shawki, M.A. Efficacy and Safety of Metformin Use in Rheumatoid Arthritis: A Randomized Controlled Study. Front. Pharmacol. 2021, 12, 726490. [Google Scholar] [CrossRef] [PubMed]
- Kang, K.Y.; Kim, Y.K.; Yi, H.; Kim, J.; Jung, H.R.; Kim, I.J.; Cho, J.H.; Park, S.H.; Kim, H.Y.; Ju, J.H. Metformin downregulates Th17 cells differentiation and attenuates murine autoimmune arthritis. Int. Immunopharmacol. 2013, 16, 85–92. [Google Scholar] [CrossRef]
- Wei, J.; Huang, X.; Zhang, X.; Chen, G.; Zhang, C.; Zhou, X.; Qi, J.; Zhang, Y.; Li, X. Elevated fatty acid beta-oxidation by leptin contributes to the proinflammatory characteristics of fibroblast-like synoviocytes from RA patients via LKB1-AMPK pathway. Cell Death Dis 2023, 14, 97. [Google Scholar] [CrossRef]
Variable | Subjects with Knee RA (n = 10) | Subjects with Knee OA (n = 10) | |
---|---|---|---|
Female (n, %) | 7 (70) | 7 (70) | |
Age (year, mean ± SD) | 55.2 ± 9.3 (35–62) | 68.2 ± 9.8 (50-84) | |
Duration of disease (month, mean ± SD) | 130.6 ± 88.7 (40–348) | NA | |
Rheumatoid factor–positive, n (%) | 9/9 (100) | NA | |
Anti-CCP antibody–positive, n (%) | 5/7 (71.4) | NA | |
DAS28 (ESR, mean ± SD) | 2.86 ± 1.31 (1.64–5.81) | NA | |
Duration of treatment (month, mean ± SD) | 118.5 ± 94.2 (28–336) | NA | |
Treatment (n, %) | Naïve | 0 | NA |
Steroid | 10 (100) | ||
Methotrexate | 8 (80) | ||
Hydroxychloroquine | 5 (50) | ||
Sulfasalazine | 3 (30) | ||
Leflunomide | 6 (60) | ||
Tacrolimus | 1 (10) | ||
Biologic DMARD | 1 (10), Golimumab | ||
Kellgren–Lawrence score (grade, mean ± SD) | NA | 3.3 ± 0.48 (3–4) |
Sense Primer | Antisense Primer | |
---|---|---|
LKB1 | CTGAGTACGAACCGGCCAA | CTACGGCACCACAGTCATG |
NOX4 | CTCAGCGGAATCAATCAGCTGTG | AGAGGAACACGACAATCAGCCTTAG |
IL-1β | GGATATGGAGCAACAAGTGG | ATGTACCAGTTGGGGAACTG |
IL-6 | AACCTGAACCTTCCAAAGATGG | TCTGGCTTGTTCCTCACTACT |
IL-8 | CATACTCCAAACCTTTCCACCCC | TCAGCCCTCTTCAAAAACTTCTCCA |
TNF-α | CCCGAGTGACAAGCCTGTAG | GATGGCAGAGAGGAGGTTGAC |
MMP-3 | GATGCCCACTTTGATGATGATGAA | AGTGTTGGCTGAGTGAAAGAGACC |
GAPDH | CACATGGCCTCCAAGGAGTAA | TGAGGGTCTCTCTCTTCCTCTTGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, H.-R.; Yoo, S.-J.; Kim, J.; Kang, S.W. LKB1 Regulates Inflammation of Fibroblast-like Synoviocytes from Patients with Rheumatoid Arthritis via AMPK-Dependent SLC7A11-NOX4-ROS Signaling. Cells 2023, 12, 1263. https://doi.org/10.3390/cells12091263
Lee H-R, Yoo S-J, Kim J, Kang SW. LKB1 Regulates Inflammation of Fibroblast-like Synoviocytes from Patients with Rheumatoid Arthritis via AMPK-Dependent SLC7A11-NOX4-ROS Signaling. Cells. 2023; 12(9):1263. https://doi.org/10.3390/cells12091263
Chicago/Turabian StyleLee, Ha-Reum, Su-Jin Yoo, Jinhyun Kim, and Seong Wook Kang. 2023. "LKB1 Regulates Inflammation of Fibroblast-like Synoviocytes from Patients with Rheumatoid Arthritis via AMPK-Dependent SLC7A11-NOX4-ROS Signaling" Cells 12, no. 9: 1263. https://doi.org/10.3390/cells12091263
APA StyleLee, H.-R., Yoo, S.-J., Kim, J., & Kang, S. W. (2023). LKB1 Regulates Inflammation of Fibroblast-like Synoviocytes from Patients with Rheumatoid Arthritis via AMPK-Dependent SLC7A11-NOX4-ROS Signaling. Cells, 12(9), 1263. https://doi.org/10.3390/cells12091263