Enhanced Osteocyte Differentiation: Cathepsin D and L Secretion by Human Adipose-Derived Mesenchymal Stem Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Preparation of ASCs and ASC-Derived CM under Normoxic or Hypoxic Conditions
2.3. Two-Dimensional Electrophoresis (2-DE) Analysis
2.4. Peptide Mass Fingerprinting (PMF)
2.5. Functional Enrichment and Network Analysis
2.6. Adipokine Array
2.7. Mineralized Matrix Formation Assay
2.8. Alkaline Phosphatase Assay
2.9. RNA Isolation, Reverse Transcription (RT), and Quantitative Real-Time RT-PCR (qRT-PCR)
2.10. Statistical Analysis
3. Results
3.1. Differentially Expressed Proteins in ASCs under Hypoxic Stress
3.2. Differentially Expressed Proteins by Hypoxic Stress in ASC-Derived CM
3.3. Effects of Cathepsin D (CTSD) and Cathepsin L (CTSL) in Osteogenic Lineage Differentiation of BM-MSCs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Zakrzewski, W.; Dobrzynski, M.; Szymonowicz, M.; Rybak, Z. Stem cells: Past, present, and future. Stem Cell Res. Ther. 2019, 10, 68. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bruder, S.P.; Jaiswal, N.; Ricalton, N.S.; Mosca, J.D.; Kraus, K.H.; Kadiyala, S. Mesenchymal stem cells in osteobiology and applied bone regeneration. Clin. Orthop. Relat. Res. 1998, 355, S247–S256. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Frenette, P.S.; Pinho, S.; Lucas, D.; Scheiermann, C. Mesenchymal stem cell: Keystone of the hematopoietic stem cell niche and a stepping-stone for regenerative medicine. Annu. Rev. Immunol. 2013, 31, 285–316. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wan Safwani, W.K.Z.; Choi, J.R.; Yong, K.W.; Ting, I.; Mat Adenan, N.A.; Pingguan-Murphy, B. Hypoxia enhances the viability, growth and chondrogenic potential of cryopreserved human adipose-derived stem cells. Cryobiology 2017, 75, 91–99. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Toma, C.; Pittenger, M.F.; Cahill, K.S.; Byrne, B.J.; Kessler, P.D. Human mesenchymal stem cells differentiate to a cardiomyocyte phenotype in the adult murine heart. Circulation 2002, 105, 93–98. [Google Scholar] [CrossRef] [Scilit]
- Schaffler, A.; Buchler, C. Concise review: Adipose tissue-derived stromal cells--basic and clinical implications for novel cell-based therapies. Stem Cells 2007, 25, 818–827. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Duscher, D.; Luan, A.; Rennert, R.C.; Atashroo, D.; Maan, Z.N.; Brett, E.A.; Whittam, A.J.; Ho, N.; Lin, M.; Hu, M.S.; et al. Suction assisted liposuction does not impair the regenerative potential of adipose derived stem cells. J. Transl. Med. 2016, 14, 126. [Google Scholar] [CrossRef] [Scilit]
- Minteer, D.; Marra, K.G.; Rubin, J.P. Adipose-derived mesenchymal stem cells: Biology and potential applications. Adv. Biochem. Eng. Biotechnol. 2013, 129, 59–71. [Google Scholar]
- Kershaw, E.E.; Flier, J.S. Adipose tissue as an endocrine organ. J. Clin. Endocrinol. Metab. 2004, 89, 2548–2556. [Google Scholar] [CrossRef] [Scilit]
- Tavakoli, S.; Ghaderi Jafarbeigloo, H.R.; Shariati, A.; Jahangiryan, A.; Jadidi, F.; Jadidi Kouhbanani, M.A.; Hassanzadeh, A.; Zamani, M.; Javidi, K.; Naimi, A. Mesenchymal stromal cells; a new horizon in regenerative medicine. J. Cell. Physiol. 2020, 235, 9185–9210. [Google Scholar] [CrossRef] [Scilit]
- Schafer, R.; Spohn, G.; Baer, P.C. Mesenchymal Stem/Stromal Cells in Regenerative Medicine: Can Preconditioning Strategies Improve Therapeutic Efficacy? Transfus. Med. Hemotherapy Off. Organ Der Dtsch. Ges. Fur Transfusionsmedizin Und Immunhamatol. 2016, 43, 256–267. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hu, C.; Li, L. Preconditioning influences mesenchymal stem cell properties in vitro and in vivo. J. Cell. Mol. Med. 2018, 22, 1428–1442. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Danielyan, L.; Schafer, R.; Schulz, A.; Ladewig, T.; Lourhmati, A.; Buadze, M.; Schmitt, A.L.; Verleysdonk, S.; Kabisch, D.; Koeppen, K.; et al. Survival, neuron-like differentiation and functionality of mesenchymal stem cells in neurotoxic environment: The critical role of erythropoietin. Cell Death Differ. 2009, 16, 1599–1614. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kang, S.; Kim, S.M.; Sung, J.H. Cellular and molecular stimulation of adipose-derived stem cells under hypoxia. Cell Biol. Int. 2014, 38, 553–562. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bruno, S.; Grange, C.; Collino, F.; Deregibus, M.C.; Cantaluppi, V.; Biancone, L.; Tetta, C.; Camussi, G. Microvesicles derived from mesenchymal stem cells enhance survival in a lethal model of acute kidney injury. PLoS ONE 2012, 7, e33115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Beegle, J.; Lakatos, K.; Kalomoiris, S.; Stewart, H.; Isseroff, R.R.; Nolta, J.A.; Fierro, F.A. Hypoxic preconditioning of mesenchymal stromal cells induces metabolic changes, enhances survival, and promotes cell retention in vivo. Stem Cells 2015, 33, 1818–1828. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Choi, J.R.; Yong, K.W.; Wan Safwani, W.K.Z. Effect of hypoxia on human adipose-derived mesenchymal stem cells and its potential clinical applications. Cell. Mol. Life Sci. CMLS 2017, 74, 2587–2600. [Google Scholar] [CrossRef] [Scilit]
- Bunnell, B.A.; Flaat, M.; Gagliardi, C.; Patel, B.; Ripoll, C. Adipose-derived stem cells: Isolation, expansion and differentiation. Methods 2008, 45, 115–120. [Google Scholar] [CrossRef] [Scilit]
- Valorani, M.G.; Montelatici, E.; Germani, A.; Biddle, A.; D'Alessandro, D.; Strollo, R.; Patrizi, M.P.; Lazzari, L.; Nye, E.; Otto, W.R.; et al. Pre-culturing human adipose tissue mesenchymal stem cells under hypoxia increases their adipogenic and osteogenic differentiation potentials. Cell Prolif. 2012, 45, 225–238. [Google Scholar] [CrossRef] [Scilit]
- Jurgens, W.J.; Lu, Z.; Zandieh-Doulabi, B.; Kuik, D.J.; Ritt, M.J.; Helder, M.N. Hyperosmolarity and hypoxia induce chondrogenesis of adipose-derived stem cells in a collagen type 2 hydrogel. J. Tissue Eng. Regen. Med. 2012, 6, 570–578. [Google Scholar] [CrossRef] [Scilit]
- Merceron, C.; Vinatier, C.; Portron, S.; Masson, M.; Amiaud, J.; Guigand, L.; Cherel, Y.; Weiss, P.; Guicheux, J. Differential effects of hypoxia on osteochondrogenic potential of human adipose-derived stem cells. Am. J. Physiol. Cell Physiol. 2010, 298, C355–C364. [Google Scholar] [CrossRef] [Scilit]
- Ponzetti, M.; Rucci, N. Osteoblast Differentiation and Signaling: Established Concepts and Emerging Topics. Int. J. Mol. Sci. 2021, 22, 6651. [Google Scholar] [CrossRef] [Scilit]
- Horie, M.; Choi, H.; Lee, R.H.; Reger, R.L.; Ylostalo, J.; Muneta, T.; Sekiya, I.; Prockop, D.J. Intra-articular injection of human mesenchymal stem cells (MSCs) promote rat meniscal regeneration by being activated to express Indian hedgehog that enhances expression of type II collagen. Osteoarthr. Cartil. 2012, 20, 1197–1207. [Google Scholar] [CrossRef] [Scilit]
- Hocking, A.M.; Gibran, N.S. Mesenchymal stem cells: Paracrine signaling and differentiation during cutaneous wound repair. Exp. Cell Res. 2010, 316, 2213–2219. [Google Scholar] [CrossRef] [Scilit]
- Mirotsou, M.; Jayawardena, T.M.; Schmeckpeper, J.; Gnecchi, M.; Dzau, V.J. Paracrine mechanisms of stem cell reparative and regenerative actions in the heart. J. Mol. Cell. Cardiol. 2011, 50, 280–289. [Google Scholar] [CrossRef] [Scilit]
- Walter, M.N.; Wright, K.T.; Fuller, H.R.; MacNeil, S.; Johnson, W.E. Mesenchymal stem cell-conditioned medium accelerates skin wound healing: An in vitro study of fibroblast and keratinocyte scratch assays. Exp. Cell Res. 2010, 316, 1271–1281. [Google Scholar] [CrossRef] [Scilit]
- Lee, S.C.; Jeong, H.J.; Lee, S.K.; Kim, S.J. Hypoxic Conditioned Medium From Human Adipose-Derived Stem Cells Promotes Mouse Liver Regeneration Through JAK/STAT3 Signaling. Stem Cells Transl. Med. 2016, 5, 816–825. [Google Scholar] [CrossRef] [Scilit]
- Osugi, M.; Katagiri, W.; Yoshimi, R.; Inukai, T.; Hibi, H.; Ueda, M. Conditioned media from mesenchymal stem cells enhanced bone regeneration in rat calvarial bone defects. Tissue Eng. Part A 2012, 18, 1479–1489. [Google Scholar] [CrossRef] [Scilit]
- Huang, D.W.; Sherman, B.T.; Lempicki, R.A. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat. Protoc. 2009, 4, 44–57. [Google Scholar] [CrossRef] [Scilit]
- Chang, L.; Zhou, G.; Soufan, O.; Xia, J. miRNet 2.0: Network-based visual analytics for miRNA functional analysis and systems biology. Nucleic Acids Res. 2020, 48, W244–W251. [Google Scholar] [CrossRef] [Scilit]
- Fotia, C.; Massa, A.; Boriani, F.; Baldini, N.; Granchi, D. Prolonged exposure to hypoxic milieu improves the osteogenic potential of adipose derived stem cells. J. Cell. Biochem. 2015, 116, 1442–1453. [Google Scholar] [CrossRef] [Scilit]
- Kim, J.H.; Yoon, S.M.; Song, S.U.; Park, S.G.; Kim, W.S.; Park, I.G.; Lee, J.; Sung, J.H. Hypoxia Suppresses Spontaneous Mineralization and Osteogenic Differentiation of Mesenchymal Stem Cells via IGFBP3 Up-Regulation. Int. J. Mol. Sci. 2016, 17, 1389. [Google Scholar] [CrossRef] [Scilit]
- Turk, V.; Stoka, V.; Vasiljeva, O.; Renko, M.; Sun, T.; Turk, B.; Turk, D. Cysteine cathepsins: From structure, function and regulation to new frontiers. Biochim. Et Biophys. Acta 2012, 1824, 68–88. [Google Scholar] [CrossRef] [Scilit]
- Goto, T.; Yamaza, T.; Tanaka, T. Cathepsins in the osteoclast. J. Electron Microsc. 2003, 52, 551–558. [Google Scholar] [CrossRef] [Scilit]
- Oksjoki, S.; Soderstrom, M.; Vuorio, E.; Anttila, L. Differential expression patterns of cathepsins B, H, K, L and S in the mouse ovary. Mol. Hum. Reprod. 2001, 7, 27–34. [Google Scholar] [CrossRef] [Scilit]
- Mandelin, J.; Hukkanen, M.; Li, T.F.; Korhonen, M.; Liljestrom, M.; Sillat, T.; Hanemaaijer, R.; Salo, J.; Santavirta, S.; Konttinen, Y.T. Human osteoblasts produce cathepsin K. Bone 2006, 38, 769–777. [Google Scholar] [CrossRef] [Scilit]
- Horner, A.; Bord, S.; Kelsall, A.W.; Coleman, N.; Compston, J.E. Tie2 ligands angiopoietin-1 and angiopoietin-2 are coexpressed with vascular endothelial cell growth factor in growing human bone. Bone 2001, 28, 65–71. [Google Scholar] [CrossRef] [Scilit]
- Kasama, T.; Isozaki, T.; Odai, T.; Matsunawa, M.; Wakabayashi, K.; Takeuchi, H.T.; Matsukura, S.; Adachi, M.; Tezuka, M.; Kobayashi, K. Expression of angiopoietin-1 in osteoblasts and its inhibition by tumor necrosis factor-alpha and interferon-gamma. Transl. Res. J. Lab. Clin. Med. 2007, 149, 265–273. [Google Scholar] [CrossRef] [Scilit]
- Suzuki, T.; Miyamoto, T.; Fujita, N.; Ninomiya, K.; Iwasaki, R.; Toyama, Y.; Suda, T. Osteoblast-specific Angiopoietin 1 overexpression increases bone mass. Biochem. Biophys. Res. Commun. 2007, 362, 1019–1025. [Google Scholar] [CrossRef] [Scilit]
- Liao, H.T.; Chen, C.T. Osteogenic potential: Comparison between bone marrow and adipose-derived mesenchymal stem cells. World J. Stem Cells 2014, 6, 288–295. [Google Scholar] [CrossRef] [Scilit]
- Masson, O.; Prebois, C.; Derocq, D.; Meulle, A.; Dray, C.; Daviaud, D.; Quilliot, D.; Valet, P.; Muller, C.; Liaudet-Coopman, E. Cathepsin-D, a key protease in breast cancer, is up-regulated in obese mouse and human adipose tissue, and controls adipogenesis. PLoS ONE 2011, 6, e16452. [Google Scholar] [CrossRef] [Scilit]
- Moazed, B.; Desautels, M. Differentiation-dependent expression of cathepsin D and importance of lysosomal proteolysis in the degradation of UCP1 in brown adipocytes. Can. J. Physiol. Pharmacol. 2002, 80, 515–525. [Google Scholar] [CrossRef] [Scilit]
- Yang, M.; Zhang, Y.; Pan, J.; Sun, J.; Liu, J.; Libby, P.; Sukhova, G.K.; Doria, A.; Katunuma, N.; Peroni, O.D.; et al. Cathepsin L activity controls adipogenesis and glucose tolerance. Nat. Cell Biol. 2007, 9, 970–977. [Google Scholar] [CrossRef] [Scilit]
- Nagata, M.; Iwasaki, K.; Akazawa, K.; Komaki, M.; Yokoyama, N.; Izumi, Y.; Morita, I. Conditioned Medium from Periodontal Ligament Stem Cells Enhances Periodontal Regeneration. Tissue Eng. Part A 2017, 23, 367–377. [Google Scholar] [CrossRef] [Scilit]
- Linero, I.; Chaparro, O. Paracrine effect of mesenchymal stem cells derived from human adipose tissue in bone regeneration. PLoS ONE 2014, 9, e107001. [Google Scholar] [CrossRef] [Scilit]




| Genes | Primer Sequence (5′-3′) | |
| ALP | F (a) R (b) | GACCCTTGACCCCCACAAT CGCCTCGTACTGCATGTCCCCT |
| COL1A1 | F R | CCGGAAACAGACAAGCAACCCAAA AAAGGAGCAGAAAGGGCAGCATTG |
| RUNX2 | F R | AAGGGTCCACTCTGGCTTTG CTAGGCGCATTTCAGGTGCT |
| OCN | F R | TCACACTCCTCGCCCTATT TGAAAGCCGATGTGGTCAG |
| OPN | F R | CATATGATGGCCGAGGTGAT CATCCAGCTGACTCGTTTCA |
| GAPDH | F R | CATGGGTGTGAACCATGAGA GGTCATGAGTCCTTCCACGA |
| Spot ID (a) | Gene Name | Description | Acc. No. (b) | Nominal Mass (Mr) (c) | Calculated PI | Score (d) | Fold Change | ||
|---|---|---|---|---|---|---|---|---|---|
| HPX6/NMX (e) | HPX12/NMX | HPX24/NMX | |||||||
| 102 | PDCD6IP | Programmed cell death 6-interacting protein isoform 1 | gi|22027538 | 96,590 | 6.13 | 139 | −1.46 | −1.74 | −1.12 |
| 104 | EEF2 | Elongation factor 2 | gi|4503483 | 95,277 | 6.41 | 136 | 1.97 | 1.73 | 1.44 |
| 136 | XRCC5 | X-ray repair cross-complementing protein 5 | gi|10863945 | 83,222 | 5.55 | 128 | −1.92 | −1.70 | −1.84 |
| 191 | XRCC6 | X-ray repair cross-complementing protein 6 isoform 3 | gi|573014819 | 64,528 | 9.32 | 157 | 2.00 | 1.32 | 1.32 |
| 155 | PLOD1 | Procollagen-lysine 1,2-oxoglutarate 5-dioxygenase 1 | gi|16741721 | 84,114 | 6.47 | 138 | 1.93 | 1.22 | 1.49 |
| 165 | LMNA | Lamin A/C transcript variant 1 | gi|57014043 | 74,322 | 6.73 | 206 | 1.57 | −1.00 | −1.18 |
| 171 | MSN | Moesin | gi|4505257 | 67,892 | 6.08 | 216 | 1.60 | −1.03 | −1.15 |
| 210 | HSPA1A | HSP70-2 | gi|4529892 | 70,267 | 5.48 | 181 | 1.90 | 1.11 | −1.25 |
| 216 | WDR1 | WD repeat-containing protein 1 isoform 1 variant, partial | gi|62897087 | 66,870 | 6.17 | 254 | 1.65 | 1.05 | 1.64 |
| 240 | LMNA | Lamin isoform E | gi|544063464 | 55,843 | 6.55 | 153 | 1.47 | 1.17 | 1.36 |
| 265 | PKM2 | Pyruvate kinase, muscle | gi|31416989 | 58,512 | 7.96 | 214 | −4.38 | −3.89 | −5.13 |
| 275 | 213 | −1.59 | 1.34 | −1.36 | |||||
| 267 | PKM2 | Chain A, Structure Of Human Muscle Pyruvate Kinase | gi|67464392 | 60,277 | 8.22 | 212 | 1.46 | 1.16 | 1.35 |
| 270 | CCT5 | T-complex protein 1 subunit epsilon isoform e | gi|807066366 | 55,770 | 5.33 | 116 | 2.22 | 1.38 | 1.85 |
| 288 | CCT5 | T-complex protein 1 subunit theta isoform 1 | gi|48762932 | 60,153 | 5.42 | 133 | 1.73 | 1.21 | 1.37 |
| 324 | G6PD | Glucose-6-phosphate dehydrogenase, isoform CRA_b | gi|119593089 | 59,467 | 8.27 | 166 | 1.71 | 1.51 | 1.37 |
| 325 | 74 | −2.17 | −2.50 | −1.72 | |||||
| 326 | 78 | −1.68 | −3.02 | −2.23 | |||||
| 388 | PDIA5 | Protein disulfide isomerase-related protein 5, partial | gi|1710248 | 46,512 | 4.95 | 136 | −2.10 | −1.36 | −1.07 |
| 404 | SERPINH1 | Serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1) | gi|47124471 | 46,559 | 8.75 | 106 | 2.25 | 1.11 | 1.37 |
| 405 | 111 | 3.08 | 1.08 | 1.68 | |||||
| 408 | 112 | 5.17 | 1.25 | 2.42 | |||||
| 505 | PSAT1 | Phosphoserine aminotransferase isoform 1 | gi|17402893 | 40,796 | 7.56 | 181 | −1.90 | −1.06 | −1.96 |
| 536 | GAPDH/G3P | Glyceraldehyde-3-phosphate dehydrogenase isoform 2 | gi|378404908 | 31,699 | 7.15 | 158 | 1.89 | 1.45 | 1.69 |
| 897 | GAPDH/G3P | Glyceraldehyde-3-phosphate dehydrogenase | gi|31645 | 36,202 | 8.26 | 87 | 28.48 | 10.49 | 28.05 |
| 738 | TAGLN | Transgelin, isoform CRA_c | gi|119587704 | 23,748 | 8.54 | 173 | 5.74 | 2.73 | 3.80 |
| 902 | TAGLN | Transgelin | gi|48255905 | 22,653 | 8.87 | 153 | 1.76 | 1.35 | 1.61 |
| 750 | TAGLN2 | Transgelin-2 isoform a | gi|469608410 | 24,609 | 8.41 | 121 | 2.36 | 2.24 | 2.25 |
| 873 | P4HB | Protein disulfide-isomerase precursor | gi|20070125 | 57,480 | 4.76 | 214 | −1.51 | −2.37 | −1.22 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Choi, J.-W.; Lim, S.; Jung, S.E.; Jeong, S.; Moon, H.; Song, B.-W.; Kim, I.-K.; Lee, S.; Hwang, K.-C.; Kim, S.W. Enhanced Osteocyte Differentiation: Cathepsin D and L Secretion by Human Adipose-Derived Mesenchymal Stem Cells. Cells 2023, 12, 2852. https://doi.org/10.3390/cells12242852
Choi J-W, Lim S, Jung SE, Jeong S, Moon H, Song B-W, Kim I-K, Lee S, Hwang K-C, Kim SW. Enhanced Osteocyte Differentiation: Cathepsin D and L Secretion by Human Adipose-Derived Mesenchymal Stem Cells. Cells. 2023; 12(24):2852. https://doi.org/10.3390/cells12242852
Chicago/Turabian StyleChoi, Jung-Won, Soyeon Lim, Seung Eun Jung, Seongtae Jeong, Hanbyeol Moon, Byeong-Wook Song, Il-Kwon Kim, Seahyoung Lee, Ki-Chul Hwang, and Sang Woo Kim. 2023. "Enhanced Osteocyte Differentiation: Cathepsin D and L Secretion by Human Adipose-Derived Mesenchymal Stem Cells" Cells 12, no. 24: 2852. https://doi.org/10.3390/cells12242852
APA StyleChoi, J.-W., Lim, S., Jung, S. E., Jeong, S., Moon, H., Song, B.-W., Kim, I.-K., Lee, S., Hwang, K.-C., & Kim, S. W. (2023). Enhanced Osteocyte Differentiation: Cathepsin D and L Secretion by Human Adipose-Derived Mesenchymal Stem Cells. Cells, 12(24), 2852. https://doi.org/10.3390/cells12242852

