Genetic and Pharmacological YAP Activation Induces Proliferation and Improves Survival in Human Induced Pluripotent Stem Cell-Derived Cardiomyocytes
Abstract
:1. Introduction
2. Materials and Methods
2.1. Human Induced Pluripotent Stem Cell Culture and Differentiation
2.2. Generation of Inducible Constitutively Active YAP Expression System
2.3. Activation of YAP
2.4. YAP Luciferase Assay
2.5. Immunocytochemistry
2.6. YAP Nuclear Translocation Assay
2.7. Apoptosis Induction and Analysis
2.8. Western Blotting
2.9. Quantitative Real-Time Polymerase Chain Reaction
2.10. Data Analysis
3. Results
3.1. YAP Activity Is Diminished during iPSC Differentiation to Cardiomyocytes
3.2. Cell Proliferation Is Reduced during iPSC Differentiation to iPSC-CM
3.3. Re-Activation of YAP Activity Using an Inducible Expression System
3.4. Induction of YAP Increases iPSC-CM Proliferation
3.5. YAP Activation Protects iPSC-CMs against Apoptosis
3.6. Expression of Cardiomyocyte Maturation Markers following YAP Activation in iPSC-CMs
3.7. Morphological Analysis of iPSC-CMs after Induction of YAP Activity
3.8. Re-Activation of YAP Activity in iPSC-CMs Using MST1 Inhibitor (XMU-MP-1)
3.9. Treatment with XMU-MP-1 Increases iPSC-CM Proliferation and Improves Survival
3.10. Effects of XMU-MP-1 Treatment on iPSC-CM Maturation and Morphology
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Zhang, Y.; Mignone, J.; MacLellan, W.R. Cardiac Regeneration and Stem Cells. Physiol. Rev. 2015, 95, 1189–1204. [Google Scholar] [CrossRef] [PubMed]
- Tohyama, S.; Fukuda, K. Future Treatment of Heart Failure Using Human iPSC-Derived Cardiomyocytes. In Etiology and Morphogenesis of Congenital Heart Disease: From Gene Function and Cellular Interaction to Morphology; Nakanishi, T., Markwald, R.R., Baldwin, H.S., Keller, B.B., Srivastava, D., Yamagishi, H., Eds.; Springer: Tokyo, Japan, 2016; pp. 25–31. [Google Scholar]
- Takahashi, K.; Tanabe, K.; Ohnuki, M.; Narita, M.; Ichisaka, T.; Tomoda, K.; Yamanaka, S. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 2007, 131, 861–872. [Google Scholar] [CrossRef]
- Mummery, C.L.; Zhang, J.; Ng, E.S.; Elliott, D.A.; Elefanty, A.G.; Kamp, T.J. Differentiation of human embryonic stem cells and induced pluripotent stem cells to cardiomyocytes: A methods overview. Circ. Res. 2012, 111, 344–358. [Google Scholar] [CrossRef]
- Karakikes, I.; Ameen, M.; Termglinchan, V.; Wu, J.C. Human induced pluripotent stem cell-derived cardiomyocytes: Insights into molecular, cellular, and functional phenotypes. Circ. Res. 2015, 117, 80–88. [Google Scholar] [CrossRef]
- Miki, K.; Uenaka, H.; Saito, A.; Miyagawa, S.; Sakaguchi, T.; Higuchi, T.; Shimizu, T.; Okano, T.; Yamanaka, S.; Sawa, Y. Bioengineered myocardium derived from induced pluripotent stem cells improves cardiac function and attenuates cardiac remodeling following chronic myocardial infarction in rats. Stem Cells Transl. Med. 2012, 1, 430–437. [Google Scholar] [CrossRef]
- Shiba, Y.; Gomibuchi, T.; Seto, T.; Wada, Y.; Ichimura, H.; Tanaka, Y.; Ogasawara, T.; Okada, K.; Shiba, N.; Sakamoto, K.; et al. Allogeneic transplantation of iPS cell-derived cardiomyocytes regenerates primate hearts. Nature 2016, 538, 388–391. [Google Scholar] [CrossRef]
- Yoshida, Y.; Yamanaka, S. Induced Pluripotent Stem Cells 10 Years Later: For Cardiac Applications. Circ. Res. 2017, 120, 1958–1968. [Google Scholar] [CrossRef]
- Kawamura, M.; Miyagawa, S.; Fukushima, S.; Saito, A.; Miki, K.; Ito, E.; Sougawa, N.; Kawamura, T.; Daimon, T.; Shimizu, T.; et al. Enhanced survival of transplanted human induced pluripotent stem cell-derived cardiomyocytes by the combination of cell sheets with the pedicled omental flap technique in a porcine heart. Circulation 2013, 128, S87–S94. [Google Scholar] [CrossRef] [PubMed]
- Gao, L.; Gregorich, Z.R.; Zhu, W.; Mattapally, S.; Oduk, Y.; Lou, X.; Kannappan, R.; Borovjagin, A.V.; Walcott, G.P.; Pollard, A.E.; et al. Large Cardiac Muscle Patches Engineered From Human Induced-Pluripotent Stem Cell-Derived Cardiac Cells Improve Recovery From Myocardial Infarction in Swine. Circulation 2018, 137, 1712–1730. [Google Scholar] [CrossRef] [PubMed]
- Yoshida, S.; Miyagawa, S.; Fukushima, S.; Kawamura, T.; Kashiyama, N.; Ohashi, F.; Toyofuku, T.; Toda, K.; Sawa, Y. Maturation of Human Induced Pluripotent Stem Cell-Derived Cardiomyocytes by Soluble Factors from Human Mesenchymal Stem Cells. Mol. Ther. 2018, 26, 2681–2695. [Google Scholar] [CrossRef]
- Ma, R.; Liang, J.; Huang, W.; Guo, L.; Cai, W.; Wang, L.; Paul, C.; Yang, H.T.; Kim, H.W.; Wang, Y. Electrical Stimulation Enhances Cardiac Differentiation of Human Induced Pluripotent Stem Cells for Myocardial Infarction Therapy. Antioxid. Redox Signal. 2018, 28, 371–384. [Google Scholar] [CrossRef]
- Lu, K.; Seidel, T.; Cao-Ehlker, X.; Dorn, T.; Batcha, A.M.N.; Schneider, C.M.; Semmler, M.; Volk, T.; Moretti, A.; Dendorfer, A.; et al. Progressive stretch enhances growth and maturation of 3D stem-cell-derived myocardium. Theranostics 2021, 11, 6138–6153. [Google Scholar] [CrossRef]
- Zhao, M.; Nakada, Y.; Wei, Y.; Bian, W.; Chu, Y.; Borovjagin, A.V.; Xie, M.; Zhu, W.; Nguyen, T.; Zhou, Y.; et al. Cyclin D2 Overexpression Enhances the Efficacy of Human Induced Pluripotent Stem Cell-Derived Cardiomyocytes for Myocardial Repair in a Swine Model of Myocardial Infarction. Circulation 2021, 144, 210–228. [Google Scholar] [CrossRef]
- Uosaki, H.; Magadum, A.; Seo, K.; Fukushima, H.; Takeuchi, A.; Nakagawa, Y.; Moyes, K.W.; Narazaki, G.; Kuwahara, K.; Laflamme, M.; et al. Identification of chemicals inducing cardiomyocyte proliferation in developmental stage-specific manner with pluripotent stem cells. Circ. Cardiovasc. Genet. 2013, 6, 624–633. [Google Scholar] [CrossRef]
- Johnson, R.; Halder, G. The two faces of Hippo: Targeting the Hippo pathway for regenerative medicine and cancer treatment. Nat. Rev. Drug Discov. 2014, 13, 63–79. [Google Scholar] [CrossRef]
- Xin, M.; Kim, Y.; Sutherland, L.B.; Qi, X.; McAnally, J.; Schwartz, R.J.; Richardson, J.A.; Bassel-Duby, R.; Olson, E.N. Regulation of insulin-like growth factor signaling by Yap governs cardiomyocyte proliferation and embryonic heart size. Sci. Signal 2011, 4, ra70. [Google Scholar] [CrossRef] [PubMed]
- von Gise, A.; Lin, Z.; Schlegelmilch, K.; Honor, L.B.; Pan, G.M.; Buck, J.N.; Ma, Q.; Ishiwata, T.; Zhou, B.; Camargo, F.D.; et al. YAP1, the nuclear target of Hippo signaling, stimulates heart growth through cardiomyocyte proliferation but not hypertrophy. Proc. Natl. Acad. Sci. USA 2012, 109, 2394–2399. [Google Scholar] [CrossRef] [PubMed]
- Heallen, T.; Morikawa, Y.; Leach, J.; Tao, G.; Willerson, J.T.; Johnson, R.L.; Martin, J.F. Hippo signaling impedes adult heart regeneration. Development 2013, 140, 4683–4690. [Google Scholar] [CrossRef]
- Leach, J.P.; Heallen, T.; Zhang, M.; Rahmani, M.; Morikawa, Y.; Hill, M.C.; Segura, A.; Willerson, J.T.; Martin, J.F. Hippo pathway deficiency reverses systolic heart failure after infarction. Nature 2017, 550, 260–264. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Li, K.; Wagner Florencio, L.; Tang, L.; Heallen, T.R.; Leach, J.P.; Wang, Y.; Grisanti, F.; Willerson, J.T.; Perin, E.C.; et al. Gene therapy knockdown of Hippo signaling induces cardiomyocyte renewal in pigs after myocardial infarction. Sci. Transl. Med. 2021, 13, eabd6892. [Google Scholar] [CrossRef] [PubMed]
- Xin, M.; Kim, Y.; Sutherland, L.B.; Murakami, M.; Qi, X.; McAnally, J.; Porrello, E.R.; Mahmoud, A.I.; Tan, W.; Shelton, J.M.; et al. Hippo pathway effector Yap promotes cardiac regeneration. Proc. Natl. Acad. Sci. USA 2013, 110, 13839–13844. [Google Scholar] [CrossRef]
- Fan, F.; He, Z.; Kong, L.L.; Chen, Q.; Yuan, Q.; Zhang, S.; Ye, J.; Liu, H.; Sun, X.; Geng, J.; et al. Pharmacological targeting of kinases MST1 and MST2 augments tissue repair and regeneration. Sci. Transl. Med. 2016, 8, 352ra108. [Google Scholar] [CrossRef] [PubMed]
- Burridge, P.W.; Matsa, E.; Shukla, P.; Lin, Z.C.; Churko, J.M.; Ebert, A.D.; Lan, F.; Diecke, S.; Huber, B.; Mordwinkin, N.M.; et al. Chemically defined generation of human cardiomyocytes. Nat. Methods 2014, 11, 855–860. [Google Scholar] [CrossRef]
- Zhao, B.; Wei, X.; Li, W.; Udan, R.S.; Yang, Q.; Kim, J.; Xie, J.; Ikenoue, T.; Yu, J.; Li, L.; et al. Inactivation of YAP oncoprotein by the Hippo pathway is involved in cell contact inhibition and tissue growth control. Genes. Dev. 2007, 21, 2747–2761. [Google Scholar] [CrossRef]
- Alexeyev, M.F.; Fayzulin, R.; Shokolenko, I.N.; Pastukh, V. A retro-lentiviral system for doxycycline-inducible gene expression and gene knockdown in cells with limited proliferative capacity. Mol. Biol. Rep. 2010, 37, 1987–1991. [Google Scholar] [CrossRef] [PubMed]
- Nugroho, A.B.; Stafford, N.; Zi, M.; Prehar, S.; Potter, R.; Kwon, D.; Kohar, Y.S.; Triastuti, E.; Bui, T.A.; Cartwright, E.J.; et al. Micro RNA-411 Expression Improves Cardiac Phenotype Following Myocardial Infarction in Mice. JACC Basic. Transl. Sci. 2022, 7, 859–875. [Google Scholar] [CrossRef]
- Tian, W.; Yu, J.; Tomchick, D.R.; Pan, D.; Luo, X. Structural and functional analysis of the YAP-binding domain of human TEAD2. Proc. Natl. Acad. Sci. USA 2010, 107, 7293–7298. [Google Scholar] [CrossRef] [PubMed]
- Potter, C.J.; Tasic, B.; Russler, E.V.; Liang, L.; Luo, L. The Q system: A repressible binary system for transgene expression, lineage tracing, and mosaic analysis. Cell 2010, 141, 536–548. [Google Scholar] [CrossRef] [PubMed]
- Triastuti, E.; Nugroho, A.B.; Zi, M.; Prehar, S.; Kohar, Y.S.; Bui, T.A.; Stafford, N.; Cartwright, E.J.; Abraham, S.; Oceandy, D. Pharmacological inhibition of Hippo pathway, with the novel kinase inhibitor XMU-MP-1, protects the heart against adverse effects during pressure overload. Br. J. Pharmacol. 2019, 176, 3956–3971. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Lian, X.; Hsiao, C.; Wilson, G.; Zhu, K.; Hazeltine, L.B.; Azarin, S.M.; Raval, K.K.; Zhang, J.; Kamp, T.J.; Palecek, S.P. Robust cardiomyocyte differentiation from human pluripotent stem cells via temporal modulation of canonical Wnt signaling. Proc. Natl. Acad. Sci. USA 2012, 109, E1848–E1857. [Google Scholar] [CrossRef] [PubMed]
- Hara, H.; Takeda, N.; Kondo, M.; Kubota, M.; Saito, T.; Maruyama, J.; Fujiwara, T.; Maemura, S.; Ito, M.; Naito, A.T.; et al. Discovery of a Small Molecule to Increase Cardiomyocytes and Protect the Heart After Ischemic Injury. JACC Basic. Transl. Sci. 2018, 3, 639–653. [Google Scholar] [CrossRef]
- Lalu, M.M.; Mazzarello, S.; Zlepnig, J.; Dong, Y.Y.R.; Montroy, J.; McIntyre, L.; Devereaux, P.J.; Stewart, D.J.; David Mazer, C.; Barron, C.C.; et al. Safety and Efficacy of Adult Stem Cell Therapy for Acute Myocardial Infarction and Ischemic Heart Failure (SafeCell Heart): A Systematic Review and Meta-Analysis. Stem Cells Transl. Med. 2018, 7, 857–866. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, P.K.; Rhee, J.W.; Wu, J.C. Adult Stem Cell Therapy and Heart Failure, 2000 to 2016: A Systematic Review. JAMA Cardiol. 2016, 1, 831–841. [Google Scholar] [CrossRef]
- Gnecchi, M.; He, H.; Liang, O.D.; Melo, L.G.; Morello, F.; Mu, H.; Noiseux, N.; Zhang, L.; Pratt, R.E.; Ingwall, J.S.; et al. Paracrine action accounts for marked protection of ischemic heart by Akt-modified mesenchymal stem cells. Nat. Med. 2005, 11, 367–368. [Google Scholar] [CrossRef] [PubMed]
- Toma, C.; Pittenger, M.F.; Cahill, K.S.; Byrne, B.J.; Kessler, P.D. Human mesenchymal stem cells differentiate to a cardiomyocyte phenotype in the adult murine heart. Circulation 2002, 105, 93–98. [Google Scholar] [CrossRef] [PubMed]
- Hofmann, M.; Wollert, K.C.; Meyer, G.P.; Menke, A.; Arseniev, L.; Hertenstein, B.; Ganser, A.; Knapp, W.H.; Drexler, H. Monitoring of bone marrow cell homing into the infarcted human myocardium. Circulation 2005, 111, 2198–2202. [Google Scholar] [CrossRef] [PubMed]
- Ye, L.; Chang, Y.H.; Xiong, Q.; Zhang, P.; Zhang, L.; Somasundaram, P.; Lepley, M.; Swingen, C.; Su, L.; Wendel, J.S.; et al. Cardiac repair in a porcine model of acute myocardial infarction with human induced pluripotent stem cell-derived cardiovascular cells. Cell Stem Cell 2014, 15, 750–761. [Google Scholar] [CrossRef]
- Yang, X.; Pabon, L.; Murry, C.E. Engineering adolescence: Maturation of human pluripotent stem cell-derived cardiomyocytes. Circ. Res. 2014, 114, 511–523. [Google Scholar] [CrossRef]
- Chong, J.J.; Yang, X.; Don, C.W.; Minami, E.; Liu, Y.W.; Weyers, J.J.; Mahoney, W.M.; Van Biber, B.; Cook, S.M.; Palpant, N.J.; et al. Human embryonic-stem-cell-derived cardiomyocytes regenerate non-human primate hearts. Nature 2014, 510, 273–277. [Google Scholar] [CrossRef] [PubMed]
- Buikema, J.W.; Lee, S.; Goodyer, W.R.; Maas, R.G.; Chirikian, O.; Li, G.; Miao, Y.; Paige, S.L.; Lee, D.; Wu, H.; et al. Wnt Activation and Reduced Cell-Cell Contact Synergistically Induce Massive Expansion of Functional Human iPSC-Derived Cardiomyocytes. Cell Stem Cell 2020, 27, 50–63.e5. [Google Scholar] [CrossRef]
- Liao, S.; Zhang, Y.; Ting, S.; Zhen, Z.; Luo, F.; Zhu, Z.; Jiang, Y.; Sun, S.; Lai, W.H.; Lian, Q.; et al. Potent immunomodulation and angiogenic effects of mesenchymal stem cells versus cardiomyocytes derived from pluripotent stem cells for treatment of heart failure. Stem Cell Res. Ther. 2019, 10, 78. [Google Scholar] [CrossRef]
- Jackson, A.O.; Rahman, G.A.; Yin, K.; Long, S. Enhancing Matured Stem-Cardiac Cell Generation and Transplantation: A Novel Strategy for Heart Failure Therapy. J. Cardiovasc. Transl. Res. 2021, 14, 556–572. [Google Scholar] [CrossRef] [PubMed]
- Duan, Y.; Dhar, A.; Patel, C.; Khimani, M.; Neogi, S.; Sharma, P.; Siva Kumar, N.; Vekariya, R.L. A brief review on solid lipid nanoparticles: Part and parcel of contemporary drug delivery systems. RSC Adv. 2020, 10, 26777–26791. [Google Scholar] [CrossRef] [PubMed]
- Shao, D.; Zhai, P.; Del Re, D.P.; Sciarretta, S.; Yabuta, N.; Nojima, H.; Lim, D.S.; Pan, D.; Sadoshima, J. A functional interaction between Hippo-YAP signalling and FoxO1 mediates the oxidative stress response. Nat. Commun. 2014, 5, 3315. [Google Scholar] [CrossRef] [PubMed]
- Siu, C.W.; Liao, S.Y.; Liu, Y.; Lian, Q.; Tse, H.F. Stem cells for myocardial repair. Thromb. Haemost. 2010, 104, 6–12. [Google Scholar] [CrossRef] [PubMed]
- Heallen, T.; Zhang, M.; Wang, J.; Bonilla-Claudio, M.; Klysik, E.; Johnson, R.L.; Martin, J.F. Hippo pathway inhibits Wnt signaling to restrain cardiomyocyte proliferation and heart size. Science 2011, 332, 458–461. [Google Scholar] [CrossRef]
- Han, Z.; Yu, Y.; Cai, B.; Xu, Z.; Bao, Z.; Zhang, Y.; Bamba, D.; Ma, W.; Gao, X.; Yuan, Y.; et al. YAP/TEAD3 signal mediates cardiac lineage commitment of human-induced pluripotent stem cells. J. Cell Physiol. 2020, 235, 2753–2760. [Google Scholar] [CrossRef] [PubMed]
- Pattschull, G.; Walz, S.; Grundl, M.; Schwab, M.; Ruhl, E.; Baluapuri, A.; Cindric-Vranesic, A.; Kneitz, S.; Wolf, E.; Ade, C.P.; et al. The Myb-MuvB Complex Is Required for YAP-Dependent Transcription of Mitotic Genes. Cell Rep. 2019, 27, 3533–3546.e7. [Google Scholar] [CrossRef]
- Totaro, A.; Panciera, T.; Piccolo, S. YAP/TAZ upstream signals and downstream responses. Nat. Cell Biol. 2018, 20, 888–899. [Google Scholar] [CrossRef]
- Zanconato, F.; Forcato, M.; Battilana, G.; Azzolin, L.; Quaranta, E.; Bodega, B.; Rosato, A.; Bicciato, S.; Cordenonsi, M.; Piccolo, S. Genome-wide association between YAP/TAZ/TEAD and AP-1 at enhancers drives oncogenic growth. Nat. Cell Biol. 2015, 17, 1218–1227. [Google Scholar] [CrossRef]
- Benham-Pyle, B.W.; Pruitt, B.L.; Nelson, W.J. Cell adhesion. Mechanical strain induces E-cadherin-dependent Yap1 and beta-catenin activation to drive cell cycle entry. Science 2015, 348, 1024–1027. [Google Scholar] [CrossRef] [PubMed]
- Panciera, T.; Azzolin, L.; Fujimura, A.; Di Biagio, D.; Frasson, C.; Bresolin, S.; Soligo, S.; Basso, G.; Bicciato, S.; Rosato, A.; et al. Induction of Expandable Tissue-Specific Stem/Progenitor Cells through Transient Expression of YAP/TAZ. Cell Stem Cell 2016, 19, 725–737. [Google Scholar] [CrossRef]
- Totaro, A.; Castellan, M.; Battilana, G.; Zanconato, F.; Azzolin, L.; Giulitti, S.; Cordenonsi, M.; Piccolo, S. YAP/TAZ link cell mechanics to Notch signalling to control epidermal stem cell fate. Nat. Commun. 2017, 8, 15206. [Google Scholar] [CrossRef] [PubMed]
- Kudryashova, T.V.; Dabral, S.; Nayakanti, S.; Ray, A.; Goncharov, D.A.; Avolio, T.; Shen, Y.; Rode, A.; Pena, A.; Jiang, L.; et al. Noncanonical HIPPO/MST Signaling via BUB3 and FOXO Drives Pulmonary Vascular Cell Growth and Survival. Circ. Res. 2022, 130, 760–778. [Google Scholar] [CrossRef] [PubMed]
- Karbassi, E.; Fenix, A.; Marchiano, S.; Muraoka, N.; Nakamura, K.; Yang, X.; Murry, C.E. Cardiomyocyte maturation: Advances in knowledge and implications for regenerative medicine. Nat. Rev. Cardiol. 2020, 17, 341–359. [Google Scholar] [CrossRef]
- Wang, W.; Xiao, Z.D.; Li, X.; Aziz, K.E.; Gan, B.; Johnson, R.L.; Chen, J. AMPK modulates Hippo pathway activity to regulate energy homeostasis. Nat. Cell Biol. 2015, 17, 490–499. [Google Scholar] [CrossRef]
- Zheng, X.; Han, H.; Liu, G.P.; Ma, Y.X.; Pan, R.L.; Sang, L.J.; Li, R.H.; Yang, L.J.; Marks, J.R.; Wang, W.; et al. LncRNA wires up Hippo and Hedgehog signaling to reprogramme glucose metabolism. EMBO J. 2017, 36, 3325–3335. [Google Scholar] [CrossRef] [PubMed]
- Kashihara, T.; Mukai, R.; Oka, S.I.; Zhai, P.; Nakada, Y.; Yang, Z.; Mizushima, W.; Nakahara, T.; Warren, J.S.; Abdellatif, M.; et al. YAP mediates compensatory cardiac hypertrophy through aerobic glycolysis in response to pressure overload. J. Clin. Investig. 2022, 132, e150595. [Google Scholar] [CrossRef]
- Kametani, Y.; Tanaka, S.; Wada, Y.; Suzuki, S.; Umeda, A.; Nishinaka, K.; Okada, Y.; Maeda, M.; Miyagawa, S.; Sawa, Y.; et al. Yes-associated protein activation potentiates glycogen synthase kinase-3 inhibitor-induced proliferation of neonatal cardiomyocytes and iPS cell-derived cardiomyocytes. J. Cell Physiol. 2022, 237, 2539–2549. [Google Scholar] [CrossRef]
- Ito, M.; Hara, H.; Takeda, N.; Naito, A.T.; Nomura, S.; Kondo, M.; Hata, Y.; Uchiyama, M.; Morita, H.; Komuro, I. Characterization of a small molecule that promotes cell cycle activation of human induced pluripotent stem cell-derived cardiomyocytes. J. Mol. Cell Cardiol. 2019, 128, 90–95. [Google Scholar] [CrossRef] [PubMed]
- Berecz, T.; Yiu, A.; Vittay, O.; Orsolits, B.; Mioulane, M.; Dos Remedios, C.G.; Ketteler, R.; Merkely, B.; Apati, A.; Harding, S.E.; et al. Transcriptional co-activators YAP1-TAZ of Hippo signalling in doxorubicin-induced cardiomyopathy. ESC Heart Fail. 2022, 9, 224–235. [Google Scholar] [CrossRef] [PubMed]
- Neininger, A.C.; Dai, X.; Liu, Q.; Burnette, D.T. The Hippo pathway regulates density-dependent proliferation of iPSC-derived cardiac myocytes. Sci. Rep. 2021, 11, 17759. [Google Scholar] [CrossRef] [PubMed]
Gene Symbol | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
hPik3cb | TATTTGGACTTTGCGACAAGACT | TCGAACGTACTGGTCTGGATAG |
hTead1 | ATGGAAAGGATGAGTGACTCTGC | TCCCACATGGTGGATAGATAGC |
hAnkrd1 | AGTAGAGGAACTGGTCACTGG | TGTTTCTCGCTTTTCCACTGTT |
hCyr61 | GGTCAAAGTTACCGGGCAGT | GGAGGCATCGAATCCCAGC |
hBirc5 | AGGACCACCGCATCTCTACAT | AAGTCTGGCTCGTTCTCAGTG |
hFgf2 | AGAAGAGCGACCCTCACATCA | CGGTTAGCACACACACTCCTTTG |
hCtgf | CAGCATGGACGTTCGTCTG | AACCACGGTTTGGTCCTTGG |
hMyh6 | GCCCTTTGACATTCGCACTG | GGTTTCAGCAATGACCTTGCC |
hMyh7 | CTTTGCTGTTATTGCAGCCATT | AGATGCCAACTTTCCTGTTGC |
hMyl2 | TTGGGCGAGTGAACGTGAAAA | CCGAACGTAATCAGCCTTCAG |
hSerca2a | ATGGGGCTCCAACGAGTTAC | TTTCCTGCCATACACCCACAA |
hCx43 | TGGTAAGGTGAAAATGCGAGG | GCACTCAAGCTGAATCCATAGAT |
hRyr2 | GGCAGCCCAAGGGTATCTC | ACACAGCGCCACCTTCATAAT |
hGapdh | GGATTTGGTCGTATTGGG | GGAAGATGGTGATGGGATT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bui, T.A.; Stafford, N.; Oceandy, D. Genetic and Pharmacological YAP Activation Induces Proliferation and Improves Survival in Human Induced Pluripotent Stem Cell-Derived Cardiomyocytes. Cells 2023, 12, 2121. https://doi.org/10.3390/cells12172121
Bui TA, Stafford N, Oceandy D. Genetic and Pharmacological YAP Activation Induces Proliferation and Improves Survival in Human Induced Pluripotent Stem Cell-Derived Cardiomyocytes. Cells. 2023; 12(17):2121. https://doi.org/10.3390/cells12172121
Chicago/Turabian StyleBui, Thuy Anh, Nicholas Stafford, and Delvac Oceandy. 2023. "Genetic and Pharmacological YAP Activation Induces Proliferation and Improves Survival in Human Induced Pluripotent Stem Cell-Derived Cardiomyocytes" Cells 12, no. 17: 2121. https://doi.org/10.3390/cells12172121