Advanced Maternal Age Differentially Affects Embryonic Tissues with the Most Severe Impact on the Developing Brain
Abstract
1. Introduction
2. Materials and Methods
2.1. Mouse Tissues
2.2. RNA Isolation
2.3. RNA Sequencing Analysis (RNA-seq)
2.4. Immunofluorescence (IF)
2.5. Ki67 Staining Quantification
2.6. TSC Culture
2.7. Stromal Cell Conditioned Media Effect on Trophoblast Stem Cells
2.8. Reverse Transcription and PCR (RT-qPCR) Analysis
2.9. Primer Sequences
Cdx2-F | AGTGAGCTGGCTGCCACACT |
Cdx2-R | GCTGCTGCTGCTTTCTTCTTGA |
Esrrb-F | AGTACAAGCGACGGCTGG |
Esrrb-R | CCTAGTAGATTCGAGACGATCTTAGTCA |
Eomes-F | TCGCTGTGACGGCCTACCAA |
Eomes-R | AGGGGAATCCGTGGGAGATGGA |
Gcm1-F | ACTTCTGGAGGCACGACGGA |
Gcm1-R | TCGGGATTTCAGCAGGAAGCG |
Hand1-F | GAACTCAAAAAGACGGATGGTGG |
Hand1-R | CGCCCAGACTTGCTGAGG |
Mct1/Slc16a1-F | CTCCAGTGCTGTGGGCTTGG |
Mct1/Slc16a1-R | GCGATGATGAGGATCACGCCA |
Pl1/Prl3d1-F | TTATCTTGGCCGCAGATGTGT |
Pl1/Prl3d1-R | GGAGTATGGATGGAAGCAGTATGAC |
Plf/Prl2c2-F | AACGCAGTCCGGAACGGGG |
Plf/Prl2c2-R | TGTCTAGGCAGCTGATCATGCCA |
Syna-F | CCTCACCTCCCAGGCCCCTC |
Syna-R | GGCAGGGAGTTTGCCCACGA |
Synb-F | TCCGGAAAGGGACCTGCCCA |
Synb-R | CAGCAGTAGTGCGGGGTGCC |
Tpbpa-F | ACTGGAGTGCCCAGCACAGC |
Tpbpa-R | GCAGTTCAGCATCCAACTGCG |
3. Results
3.1. Transcriptomic Analysis of Embryonic Tissues from Young and Aged Females
3.2. Maternal Age Increases the Transcriptional Variability in Embryonic Tissues
3.3. Maternal Age Has a Differential Impact on Brain, Face, Heart, and Placenta
3.4. AMA Preferentially Affects Embryonic Brain Development
3.5. Neurodevelopmental Genes Are Profoundly Affected by AMA
3.6. AMA Perturbs the Trophoblast Compartment of the Placenta
3.7. Aged Uterine Stromal-Cell Conditioned Media Accelerates Differentiation of Trophoblast Stem Cells
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Jolly, M.; Sebire, N.; Harris, J.; Robinson, S.; Regan, L. The risks associated with pregnancy in women aged 35 years or older. Hum. Reprod. 2000, 15, 2433–2437. [Google Scholar] [CrossRef] [PubMed]
- Londero, A.P.; Rossetti, E.; Pittini, C.; Cagnacci, A.; Driul, L. Maternal age and the risk of adverse pregnancy outcomes: A retrospective cohort study. BMC Pregnancy Childbirth 2019, 19, 261. [Google Scholar] [CrossRef] [PubMed]
- Fuchs, F.; Monet, B.; Ducruet, T.; Chaillet, N.; Audibert, F. Effect of maternal age on the risk of preterm birth: A large cohort study. PLoS ONE 2018, 13, e0191002. [Google Scholar] [CrossRef] [PubMed]
- Weng, Y.H.; Yang, C.Y.; Chiu, Y.W. Risk Assessment of Adverse Birth Outcomes in Relation to Maternal Age. PLoS ONE 2014, 9, e114843. [Google Scholar] [CrossRef] [PubMed]
- Duncan, F.E.; Hornick, J.E.; Lampson, M.A.; Schultz, R.M.; Shea, L.D.; Woodruff, T.K. Chromosome cohesion decreases in human eggs with advanced maternal age. Aging Cell 2012, 11, 1121–1124. [Google Scholar] [CrossRef]
- Cimadomo, D.; Fabozzi, G.; Vaiarelli, A.; Ubaldi, N.; Ubaldi, F.M.; Rienzi, L. Impact of Maternal Age on Oocyte and Embryo Competence. Front. Endocrinol. 2018, 9, 327. [Google Scholar] [CrossRef]
- Reefhuis, J.; Honein, M.A. Maternal age and non-chromosomal birth defects, Atlanta--1968–2000: Teenager or thirty-something, who is at risk? Birth Defects Res. A Clin. Mol. Teratol. 2004, 70, 572–579. [Google Scholar] [CrossRef]
- Attali, E.; Yogev, Y. The impact of advanced maternal age on pregnancy outcome. Best Pract. Res. Clin. Obstet. Gynaecol. 2021, 70, 2–9. [Google Scholar] [CrossRef]
- Lamminpaa, R.; Vehvilainen-Julkunen, K.; Gissler, M.; Heinonen, S. Preeclampsia complicated by advanced maternal age: A registry-based study on primiparous women in Finland 1997–2008. BMC Pregnancy Childbirth 2012, 12, 47. [Google Scholar] [CrossRef]
- Jacobsson, B.; Ladfors, L.; Milsom, I. Advanced maternal age and adverse perinatal outcome. Obstet. Gynecol. 2004, 104, 727–733. [Google Scholar] [CrossRef]
- Norwitz, E.R. Defective implantation and placentation: Laying the blueprint for pregnancy complications. Reprod. Biomed. Online 2006, 13, 591–599. [Google Scholar] [CrossRef] [PubMed]
- Abqari, S.; Gupta, A.; Shahab, T.; Rabbani, M.U.; Ali, S.M.; Firdaus, U. Profile and risk factors for congenital heart defects: A study in a tertiary care hospital. Ann. Pediatr. Cardiol. 2016, 9, 216–221. [Google Scholar] [CrossRef] [PubMed]
- Hollier, L.M.; Leveno, K.J.; Kelly, M.A.; DD, M.C.; Cunningham, F.G. Maternal age and malformations in singleton births. Obstet. Gynecol. 2000, 96, 701–706. [Google Scholar] [PubMed]
- Evans, W.N.; Acherman, R.J.; Restrepo, H. Advanced maternal age and critical congenital cardiac malformations in Nevada. Prog. Pediatr. Cardiol. 2021, 62, 101385. [Google Scholar] [CrossRef]
- Schulkey, C.E.; Regmi, S.D.; Magnan, R.A.; Danzo, M.T.; Luther, H.; Hutchinson, A.K.; Panzer, A.A.; Grady, M.M.; Wilson, D.B.; Jay, P.Y. The maternal-age-associated risk of congenital heart disease is modifiable. Nature 2015, 520, 230–233. [Google Scholar] [CrossRef]
- Ballardini, E.; Sisti, M.; Basaglia, N.; Benedetto, M.; Baldan, A.; Borgna-Pignatti, C.; Garani, G. Prevalence and characteristics of positional plagiocephaly in healthy full-term infants at 8–12 weeks of life. Eur. J. Pediatr. 2018, 177, 1547–1554. [Google Scholar] [CrossRef]
- Miller, A.; Riehle-Colarusso, T.; Siffel, C.; Frias, J.L.; Correa, A. Maternal age and prevalence of isolated congenital heart defects in an urban area of the United States. Am. J. Med. Genet. A 2011, 155A, 2137–2145. [Google Scholar] [CrossRef]
- Woods, L.; Perez-Garcia, V.; Kieckbusch, J.; Wang, X.; DeMayo, F.; Colucci, F.; Hemberger, M. Decidualisation and placentation defects are a major cause of age-related reproductive decline. Nat. Commun. 2017, 8, 352. [Google Scholar] [CrossRef]
- Lopes, F.L.; Fortier, A.L.; Darricarrere, N.; Chan, D.; Arnold, D.R.; Trasler, J.M. Reproductive and epigenetic outcomes associated with aging mouse oocytes. Hum. Mol. Genet. 2009, 18, 2032–2044. [Google Scholar] [CrossRef]
- Perez-Garcia, V.; Fineberg, E.; Wilson, R.; Murray, A.; Mazzeo, C.I.; Tudor, C.; Sienerth, A.; White, J.K.; Tuck, E.; Ryder, E.J.; et al. Placentation defects are highly prevalent in embryonic lethal mouse mutants. Nature 2018, 555, 463–468. [Google Scholar] [CrossRef]
- Tanaka, S.; Kunath, T.; Hadjantonakis, A.K.; Nagy, A.; Rossant, J. Promotion of trophoblast stem cell proliferation by FGF4. Science 1998, 282, 2072–2075. [Google Scholar] [CrossRef] [PubMed]
- Murray, A.; Sienerth, A.R.; Hemberger, M. Plet1 is an epigenetically regulated cell surface protein that provides essential cues to direct trophoblast stem cell differentiation. Sci. Rep. 2016, 6, 25112. [Google Scholar] [CrossRef] [PubMed]
- Hallgrimsson, B.; Aponte, J.D.; Katz, D.C.; Bannister, J.J.; Riccardi, S.L.; Mahasuwan, N.; McInnes, B.L.; Ferrara, T.M.; Lipman, D.M.; Neves, A.B.; et al. Automated syndrome diagnosis by three-dimensional facial imaging. Genet. Med. 2020, 22, 1682–1693. [Google Scholar] [CrossRef] [PubMed]
- Coan, P.M.; Angiolini, E.; Sandovici, I.; Burton, G.J.; Constancia, M.; Fowden, A.L. Adaptations in placental nutrient transfer capacity to meet fetal growth demands depend on placental size in mice. J. Physiol. 2008, 586, 4567–4576. [Google Scholar] [CrossRef] [PubMed]
- Weissbein, U.; Schachter, M.; Egli, D.; Benvenisty, N. Analysis of chromosomal aberrations and recombination by allelic bias in RNA-Seq. Nat. Commun. 2016, 7, 12144. [Google Scholar] [CrossRef] [PubMed]
- He, P.; Williams, B.A.; Trout, D.; Marinov, G.K.; Amrhein, H.; Berghella, L.; Goh, S.T.; Plajzer-Frick, I.; Afzal, V.; Pennacchio, L.A.; et al. The changing mouse embryo transcriptome at whole tissue and single-cell resolution. Nature 2020, 583, 760–767. [Google Scholar] [CrossRef]
- Leblond, C.S.; Le, T.L.; Malesys, S.; Cliquet, F.; Tabet, A.C.; Delorme, R.; Rolland, T.; Bourgeron, T. Operative list of genes associated with autism and neurodevelopmental disorders based on database review. Mol. Cell Neurosci. 2021, 113, 103623. [Google Scholar] [CrossRef]
- Chen, C.H.; Huang, Y.S.; Liao, D.L.; Huang, C.Y.; Lin, C.H.; Fang, T.H. Identification of Rare Mutations of Two Presynaptic Cytomatrix Genes BSN and PCLO in Schizophrenia and Bipolar Disorder. J. Pers. Med. 2021, 11, 1057. [Google Scholar] [CrossRef]
- Hess, A.P.; Hamilton, A.E.; Talbi, S.; Dosiou, C.; Nyegaard, M.; Nayak, N.; Genbecev-Krtolica, O.; Mavrogianis, P.; Ferrer, K.; Kruessel, J.; et al. Decidual stromal cell response to paracrine signals from the trophoblast: Amplification of immune and angiogenic modulators. Biol. Reprod. 2007, 76, 102–117. [Google Scholar] [CrossRef]
- Hemberger, M.; Hanna, C.W.; Dean, W. Mechanisms of early placental development in mouse and humans. Nat. Rev. Genet. 2020, 21, 27–43. [Google Scholar] [CrossRef]
- Peters, M.J.; Joehanes, R.; Pilling, L.C.; Schurmann, C.; Conneely, K.N.; Powell, J.; Reinmaa, E.; Sutphin, G.L.; Zhernakova, A.; Schramm, K.; et al. The transcriptional landscape of age in human peripheral blood. Nat. Commun. 2015, 6, 8570. [Google Scholar] [CrossRef] [PubMed]
- White, R.R.; Milholland, B.; MacRae, S.L.; Lin, M.; Zheng, D.; Vijg, J. Comprehensive transcriptional landscape of aging mouse liver. BMC Genom. 2015, 16, 899. [Google Scholar] [CrossRef] [PubMed]
- Sandin, S.; Hultman, C.M.; Kolevzon, A.; Gross, R.; MacCabe, J.H.; Reichenberg, A. Advancing maternal age is associated with increasing risk for autism: A review and meta-analysis. J. Am. Acad. Child Adolesc. Psychiatry 2012, 51, 477–486. [Google Scholar] [CrossRef] [PubMed]
- Shelton, J.F.; Tancredi, D.J.; Hertz-Picciotto, I. Independent and dependent contributions of advanced maternal and paternal ages to autism risk. Autism Res. 2010, 3, 30–39. [Google Scholar] [CrossRef] [PubMed]
- Fountoulakis, K.N.; Gonda, X.; Siamouli, M.; Panagiotidis, P.; Moutou, K.; Nimatoudis, I.; Kasper, S. Paternal and maternal age as risk factors for schizophrenia: A case-control study. Int. J. Psychiatry Clin. Pract. 2018, 22, 170–176. [Google Scholar] [CrossRef]
- Bahar, R.; Hartmann, C.H.; Rodriguez, K.A.; Denny, A.D.; Busuttil, R.A.; Dolle, M.E.; Calder, R.B.; Chisholm, G.B.; Pollock, B.H.; Klein, C.A.; et al. Increased cell-to-cell variation in gene expression in ageing mouse heart. Nature 2006, 441, 1011–1014. [Google Scholar] [CrossRef]
- Ahuja, G.; Bartsch, D.; Yao, W.; Geissen, S.; Frank, S.; Aguirre, A.; Russ, N.; Messling, J.E.; Dodzian, J.; Lagerborg, K.A.; et al. Loss of genomic integrity induced by lysosphingolipid imbalance drives ageing in the heart. EMBO Rep. 2019, 20, e47407. [Google Scholar] [CrossRef]
- Isildak, U.; Somel, M.; Thornton, J.M.; Donertas, H.M. Temporal changes in the gene expression heterogeneity during brain development and aging. Sci. Rep. 2020, 10, 4080. [Google Scholar] [CrossRef]
- Enge, M.; Arda, H.E.; Mignardi, M.; Beausang, J.; Bottino, R.; Kim, S.K.; Quake, S.R. Single-Cell Analysis of Human Pancreas Reveals Transcriptional Signatures of Aging and Somatic Mutation Patterns. Cell 2017, 171, 321–330. [Google Scholar] [CrossRef]
- Cheung, P.; Vallania, F.; Warsinske, H.C.; Donato, M.; Schaffert, S.; Chang, S.E.; Dvorak, M.; Dekker, C.L.; Davis, M.M.; Utz, P.J.; et al. Single-Cell Chromatin Modification Profiling Reveals Increased Epigenetic Variations with Aging. Cell 2018, 173, 1385–1397. [Google Scholar] [CrossRef]
- Marti, G.E.W.; Chu, S.; Quake, S.R. Aging causes changes in transcriptional noise across a diverse set of cell types. bioRxiv 2022. [Google Scholar] [CrossRef]
- Zahn, J.M.; Sonu, R.; Vogel, H.; Crane, E.; Mazan-Mamczarz, K.; Rabkin, R.; Davis, R.W.; Becker, K.G.; Owen, A.B.; Kim, S.K. Transcriptional profiling of aging in human muscle reveals a common aging signature. PLoS Genet. 2006, 2, e115. [Google Scholar] [CrossRef]
- Rosenfeld, C.S. The placenta-brain-axis. J. Neurosci. Res. 2021, 99, 271–283. [Google Scholar] [CrossRef] [PubMed]
- Bonnin, A.; Goeden, N.; Chen, K.; Wilson, M.L.; King, J.; Shih, J.C.; Blakely, R.D.; Deneris, E.S.; Levitt, P. A transient placental source of serotonin for the fetal forebrain. Nature 2011, 472, 347–350. [Google Scholar] [CrossRef]
- Green, B.B.; Kappil, M.; Lambertini, L.; Armstrong, D.A.; Guerin, D.J.; Sharp, A.J.; Lester, B.M.; Chen, J.; Marsit, C.J. Expression of imprinted genes in placenta is associated with infant neurobehavioral development. Epigenetics 2015, 10, 834–841. [Google Scholar] [CrossRef]
- Lesseur, C.; Armstrong, D.A.; Murphy, M.A.; Appleton, A.A.; Koestler, D.C.; Paquette, A.G.; Lester, B.M.; Marsit, C.J. Sex-specific associations between placental leptin promoter DNA methylation and infant neurobehavior. Psychoneuroendocrinology 2014, 40, 1–9. [Google Scholar] [CrossRef][Green Version]
- Marsit, C.J.; Lambertini, L.; Maccani, M.A.; Koestler, D.C.; Houseman, E.A.; Padbury, J.F.; Lester, B.M.; Chen, J. Placenta-imprinted gene expression association of infant neurobehavior. J. Pediatr. 2012, 160, 854–860. [Google Scholar] [CrossRef]
- Paquette, A.G.; Lesseur, C.; Armstrong, D.A.; Koestler, D.C.; Appleton, A.A.; Lester, B.M.; Marsit, C.J. Placental HTR2A methylation is associated with infant neurobehavioral outcomes. Epigenetics 2013, 8, 796–801. [Google Scholar] [CrossRef]
- Rosenfeld, C.S. Sex-Specific Placental Responses in Fetal Development. Endocrinology 2015, 156, 3422–3434. [Google Scholar] [CrossRef]
Litter | Mat. Age [wks] | No Implantation Sites | Embryo ID | Somite Number * | Sex |
---|---|---|---|---|---|
Young Litter 1 | 13 | 9 | Y1 | N.D. | MALE |
Young Litter 2 | 7 | 9 | Y2 | N.D. | MALE |
Young Litter 3 | 8 | 9 | Y3 | N.D. | FEMALE |
Aged Litter 1 | 43 | 9 | A1.1 | N.D. | FEMALE |
A1.2 | N.D. | MALE | |||
Aged Litter 2 | 50 | 11 | A2.1 | N.D. | MALE |
A2.2 | 24 | MALE | |||
Aged Litter 3 | 46 | 6 | A3.1 | 21 | MALE |
A3.2 | 24 | FEMALE |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kokorudz, C.; Radford, B.N.; Dean, W.; Hemberger, M. Advanced Maternal Age Differentially Affects Embryonic Tissues with the Most Severe Impact on the Developing Brain. Cells 2023, 12, 76. https://doi.org/10.3390/cells12010076
Kokorudz C, Radford BN, Dean W, Hemberger M. Advanced Maternal Age Differentially Affects Embryonic Tissues with the Most Severe Impact on the Developing Brain. Cells. 2023; 12(1):76. https://doi.org/10.3390/cells12010076
Chicago/Turabian StyleKokorudz, Caroline, Bethany N. Radford, Wendy Dean, and Myriam Hemberger. 2023. "Advanced Maternal Age Differentially Affects Embryonic Tissues with the Most Severe Impact on the Developing Brain" Cells 12, no. 1: 76. https://doi.org/10.3390/cells12010076
APA StyleKokorudz, C., Radford, B. N., Dean, W., & Hemberger, M. (2023). Advanced Maternal Age Differentially Affects Embryonic Tissues with the Most Severe Impact on the Developing Brain. Cells, 12(1), 76. https://doi.org/10.3390/cells12010076