Loss of Proximal Tubular Sirtuin 6 Aggravates Unilateral Ureteral Obstruction-Induced Tubulointerstitial Inflammation and Fibrosis by Regulation of β-Catenin Acetylation
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animal Experiment
2.2. Renal Histology
2.3. Picro Sirius Red Stain
2.4. Western Blotting and Immunoprecipitation
2.5. RNA Isolation and Quantitative PCR Analyses
2.6. Cell Culture Experiment
2.7. Cell Proliferation Assay
2.8. Chromatin Immunoprecipitation (ChIP) Assay
2.9. Statistical Analyses
3. Results
3.1. Loss of Proximal Tubule Sirt6 Exacerbates UUO-Induced Tubular Injury and Fibrosis
3.2. Loss of Proximal Tubule Sirt6 Increases Myofibroblast Activation and Extracellular Matrix Deposition
3.3. Loss of Proximal Tubule Sirt6 Increases Inflammatory Cells Infiltration, as Well as Proinflammatory Cytokine and Chemokine Expression
3.4. Sirt6 Activator MDL-800 Exerts a Therapeutic Effect on UUO-Induced Renal Tubular Injury, Inflammation, and Fibrosis
3.5. Sirt6 Activator MDL-800 Decreases TGF-β1-Induced Extracellular Matrix Protein Expression by Regulation of the β-Catenin Acetylation and TGFβ1-Smad Signaling Pathway in Human Proximal Tubule Cells
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Levin, A.; Tonelli, M.; Bonventre, J.; Coresh, J.; Donner, J.A.; Fogo, A.B.; Fox, C.S.; Gansevoort, R.T.; Heerspink, H.J.L.; Jardine, M.; et al. Global kidney health 2017 and beyond: A roadmap for closing gaps in care, research, and policy. Lancet 2017, 390, 1888–1917. [Google Scholar] [CrossRef]
- Oh, K.H.; Kang, M.; Kang, E.; Ryu, H.; Han, S.H.; Yoo, T.H.; Kim, S.W.; Chae, D.W.; Lee, K.B.; Park, S.K.; et al. The KNOW-CKD Study: What we have learned about chronic kidney diseases. Kidney Res. Clin. Pract. 2020, 39, 121–135. [Google Scholar] [CrossRef] [PubMed]
- Shabaka, A.; Cases-Corona, C.; Fernandez-Juarez, G. Therapeutic Insights in Chronic Kidney Disease Progression. Front. Med. 2021, 8, 645187. [Google Scholar] [CrossRef] [PubMed]
- de Zeeuw, D.; Akizawa, T.; Audhya, P.; Bakris, G.L.; Chin, M.; Christ-Schmidt, H.; Goldsberry, A.; Houser, M.; Krauth, M.; Lambers Heerspink, H.J.; et al. Bardoxolone methyl in type 2 diabetes and stage 4 chronic kidney disease. N. Engl. J. Med. 2013, 369, 2492–2503. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sharma, K.; Ix, J.H.; Mathew, A.V.; Cho, M.; Pflueger, A.; Dunn, S.R.; Francos, B.; Sharma, S.; Falkner, B.; McGowan, T.A.; et al. Pirfenidone for diabetic nephropathy. J. Am. Soc. Nephrol. 2011, 22, 1144–1151. [Google Scholar] [CrossRef]
- Cho, M.E.; Smith, D.C.; Branton, M.H.; Penzak, S.R.; Kopp, J.B. Pirfenidone slows renal function decline in patients with focal segmental glomerulosclerosis. Clin. J. Am. Soc. Nephrol. 2007, 2, 906–913. [Google Scholar] [CrossRef] [Green Version]
- Cai, J.; Liu, Z.; Huang, X.; Shu, S.; Hu, X.; Zheng, M.; Tang, C.; Liu, Y.; Chen, G.; Sun, L.; et al. The deacetylase sirtuin 6 protects against kidney fibrosis by epigenetically blocking beta-catenin target gene expression. Kidney Int. 2020, 97, 106–118. [Google Scholar] [CrossRef]
- Li, S.S.; Sun, Q.; Hua, M.R.; Suo, P.; Chen, J.R.; Yu, X.Y.; Zhao, Y.Y. Targeting the Wnt/beta-Catenin Signaling Pathway as a Potential Therapeutic Strategy in Renal Tubulointerstitial Fibrosis. Front. Pharmacol. 2021, 12, 719880. [Google Scholar] [CrossRef]
- Maarouf, O.H.; Aravamudhan, A.; Rangarajan, D.; Kusaba, T.; Zhang, V.; Welborn, J.; Gauvin, D.; Hou, X.; Kramann, R.; Humphreys, B.D. Paracrine Wnt1 Drives Interstitial Fibrosis without Inflammation by Tubulointerstitial Cross-Talk. J. Am. Soc. Nephrol. 2016, 27, 781–790. [Google Scholar] [CrossRef]
- Zhou, D.; Fu, H.; Zhang, L.; Zhang, K.; Min, Y.; Xiao, L.; Lin, L.; Bastacky, S.I.; Liu, Y. Tubule-Derived Wnts Are Required for Fibroblast Activation and Kidney Fibrosis. J. Am. Soc. Nephrol. 2017, 28, 2322–2336. [Google Scholar] [CrossRef] [Green Version]
- Morigi, M.; Perico, L.; Benigni, A. Sirtuins in Renal Health and Disease. J. Am. Soc. Nephrol. 2018, 29, 1799–1809. [Google Scholar] [CrossRef] [PubMed]
- Zha, J.J.; Tang, Y.; Wang, Y.L. Role of mono-ADP-ribosylation histone modification (Review). Exp. Ther. Med. 2021, 21, 577. [Google Scholar] [CrossRef] [PubMed]
- Du, J.; Zhou, Y.; Su, X.; Yu, J.J.; Khan, S.; Jiang, H.; Kim, J.; Woo, J.; Kim, J.H.; Choi, B.H.; et al. Sirt5 is a NAD-dependent protein lysine demalonylase and desuccinylase. Science 2011, 334, 806–809. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hong, Y.A.; Kim, J.E.; Jo, M.; Ko, G.J. The Role of Sirtuins in Kidney Diseases. Int. J. Mol. Sci. 2020, 21, 6686. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Qu, X.; Ricardo, S.D.; Bertram, J.F.; Nikolic-Paterson, D.J. Resveratrol inhibits renal fibrosis in the obstructed kidney: Potential role in deacetylation of Smad3. Am. J. Pathol. 2010, 177, 1065–1071. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Connelly, K.A.; Thai, K.; Wu, X.; Kapus, A.; Kepecs, D.; Gilbert, R.E. Sirtuin 1 Activation Reduces Transforming Growth Factor-beta1-Induced Fibrogenesis and Affords Organ Protection in a Model of Progressive, Experimental Kidney and Associated Cardiac Disease. Am. J. Pathol. 2017, 187, 80–90. [Google Scholar] [CrossRef] [Green Version]
- Sundaresan, N.R.; Bindu, S.; Pillai, V.B.; Samant, S.; Pan, Y.; Huang, J.Y.; Gupta, M.; Nagalingam, R.S.; Wolfgeher, D.; Verdin, E.; et al. SIRT3 Blocks Aging-Associated Tissue Fibrosis in Mice by Deacetylating and Activating Glycogen Synthase Kinase 3beta. Mol. Cell. Biol. 2015, 36, 678–692. [Google Scholar] [CrossRef] [Green Version]
- Quan, Y.; Park, W.; Jin, J.; Kim, W.; Park, S.K.; Kang, K.P. Sirtuin 3 Activation by Honokiol Decreases Unilateral Ureteral Obstruction-Induced Renal Inflammation and Fibrosis via Regulation of Mitochondrial Dynamics and the Renal NF-kappaBTGF-beta1/Smad Signaling Pathway. Int. J. Mol. Sci. 2020, 21, 402. [Google Scholar] [CrossRef] [Green Version]
- Liu, M.; Liang, K.; Zhen, J.; Zhou, M.; Wang, X.; Wang, Z.; Wei, X.; Zhang, Y.; Sun, Y.; Zhou, Z.; et al. Sirt6 deficiency exacerbates podocyte injury and proteinuria through targeting Notch signaling. Nat. Commun. 2017, 8, 413. [Google Scholar] [CrossRef]
- Tian, K.; Liu, Z.; Wang, J.; Xu, S.; You, T.; Liu, P. Sirtuin-6 inhibits cardiac fibroblasts differentiation into myofibroblasts via inactivation of nuclear factor kappaB signaling. Transl. Res. 2015, 165, 374–386. [Google Scholar] [CrossRef]
- Iwano, M.; Plieth, D.; Danoff, T.M.; Xue, C.; Okada, H.; Neilson, E.G. Evidence that fibroblasts derive from epithelium during tissue fibrosis. J. Clin. Investig. 2002, 110, 341–350. [Google Scholar] [CrossRef] [PubMed]
- Shang, J.; Zhu, Z.; Chen, Y.; Song, J.; Huang, Y.; Song, K.; Zhong, J.; Xu, X.; Wei, J.; Wang, C.; et al. Small-molecule activating SIRT6 elicits therapeutic effects and synergistically promotes anti-tumor activity of vitamin D3 in colorectal cancer. Theranostics 2020, 10, 5845–5864. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.; Lee, A.S.; Jung, Y.J.; Yang, K.H.; Lee, S.; Park, S.K.; Kim, W.; Kang, K.P. Tamoxifen ameliorates renal tubulointerstitial fibrosis by modulation of estrogen receptor alpha-mediated transforming growth factor-beta1/Smad signaling pathway. Nephrol. Dial. Transplant. 2014, 29, 2043–2053. [Google Scholar] [CrossRef] [PubMed]
- Jin, J.; Wang, T.; Park, W.; Li, W.; Kim, W.; Park, S.K.; Kang, K.P. Inhibition of Yes-Associated Protein by Verteporfin Ameliorates Unilateral Ureteral Obstruction-Induced Renal Tubulointerstitial Inflammation and Fibrosis. Int. J. Mol. Sci. 2020, 21, 8184. [Google Scholar] [CrossRef]
- Nguyen-Thanh, T.; Kim, D.; Lee, S.; Kim, W.; Park, S.K.; Kang, K.P. Inhibition of histone deacetylase 1 ameliorates renal tubulointerstitial fibrosis via modulation of inflammation and extracellular matrix gene transcription in mice. Int. J. Mol. Med. 2018, 41, 95–106. [Google Scholar] [CrossRef] [Green Version]
- Kang, K.P.; Kim, D.H.; Jung, Y.J.; Lee, A.S.; Lee, S.; Lee, S.Y.; Jang, K.Y.; Sung, M.J.; Park, S.K.; Kim, W. Alpha-lipoic acid attenuates cisplatin-induced acute kidney injury in mice by suppressing renal inflammation. Nephrol. Dial. Transplant. 2009, 24, 3012–3020. [Google Scholar] [CrossRef]
- Kang, K.P.; Lee, J.E.; Lee, A.S.; Jung, Y.J.; Kim, D.; Lee, S.; Hwang, H.P.; Kim, W.; Park, S.K. Effect of gender differences on the regulation of renal ischemia-reperfusion-induced inflammation in mice. Mol. Med. Rep. 2014, 9, 2061–2068. [Google Scholar] [CrossRef] [Green Version]
- Jung, Y.J.; Park, W.; Noh, J.M.; Kang, K.P.; Nguyen-Thanh, T.; Han, M.K.; Kim, W. SIRT1 induces the adipogenic differentiation of mouse embryonic stem cells by regulating RA-induced RAR expression via NCOR1 acetylation. Stem Cell Res. 2020, 44, 101771. [Google Scholar] [CrossRef]
- Mack, M. Inflammation and fibrosis. Matrix Biol. 2018, 68–69, 106–121. [Google Scholar] [CrossRef]
- Venkatachalam, M.A.; Weinberg, J.M.; Kriz, W.; Bidani, A.K. Failed Tubule Recovery, AKI-CKD Transition, and Kidney Disease Progression. J. Am. Soc. Nephrol. 2015, 26, 1765–1776. [Google Scholar] [CrossRef] [Green Version]
- Hasegawa, K.; Wakino, S.; Simic, P.; Sakamaki, Y.; Minakuchi, H.; Fujimura, K.; Hosoya, K.; Komatsu, M.; Kaneko, Y.; Kanda, T.; et al. Renal tubular Sirt1 attenuates diabetic albuminuria by epigenetically suppressing Claudin-1 overexpression in podocytes. Nat. Med. 2013, 19, 1496–1504. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chuang, P.Y.; Cai, W.; Li, X.; Fang, L.; Xu, J.; Yacoub, R.; He, J.C.; Lee, K. Reduction in podocyte SIRT1 accelerates kidney injury in aging mice. Am. J. Physiol. Renal. Physiol. 2017, 313, F621–F628. [Google Scholar] [CrossRef] [PubMed]
- Perico, L.; Morigi, M.; Benigni, A. Mitochondrial Sirtuin 3 and Renal Diseases. Nephron 2016, 134, 14–19. [Google Scholar] [CrossRef] [PubMed]
- Gertler, A.A.; Cohen, H.Y. SIRT6, a protein with many faces. Biogerontology 2013, 14, 629–639. [Google Scholar] [CrossRef]
- Guo, J.; Wang, Z.; Wu, J.; Liu, M.; Li, M.; Sun, Y.; Huang, W.; Li, Y.; Zhang, Y.; Tang, W.; et al. Endothelial SIRT6 Is Vital to Prevent Hypertension and Associated Cardiorenal Injury Through Targeting Nkx3.2-GATA5 Signaling. Circ. Res. 2019, 124, 1448–1461. [Google Scholar] [CrossRef]
- Maity, S.; Muhamed, J.; Sarikhani, M.; Kumar, S.; Ahamed, F.; Spurthi, K.M.; Ravi, V.; Jain, A.; Khan, D.; Arathi, B.P.; et al. Sirtuin 6 deficiency transcriptionally up-regulates TGF-beta signaling and induces fibrosis in mice. J. Biol. Chem. 2020, 295, 415–434. [Google Scholar] [CrossRef]
- Zhang, Q.; Tu, W.; Tian, K.; Han, L.; Wang, Q.; Chen, P.; Zhou, X. Sirtuin 6 inhibits myofibroblast differentiation via inactivating transforming growth factor-beta1/Smad2 and nuclear factor-kappaB signaling pathways in human fetal lung fibroblasts. J. Cell. Biochem. 2019, 120, 93–104. [Google Scholar] [CrossRef] [Green Version]
- Kim, J.; Park, J. Single-cell transcriptomics: A novel precision medicine technique in nephrology. Korean J. Intern. Med. 2021, 36, 479–490. [Google Scholar] [CrossRef]
- Park, J.; Shrestha, R.; Qiu, C.; Kondo, A.; Huang, S.; Werth, M.; Li, M.; Barasch, J.; Susztak, K. Single-cell transcriptomics of the mouse kidney reveals potential cellular targets of kidney disease. Science 2018, 360, 758–763. [Google Scholar] [CrossRef] [Green Version]
- Wynn, T.A.; Ramalingam, T.R. Mechanisms of fibrosis: Therapeutic translation for fibrotic disease. Nat. Med. 2012, 18, 1028–1040. [Google Scholar] [CrossRef] [Green Version]
- Akhmetshina, A.; Palumbo, K.; Dees, C.; Bergmann, C.; Venalis, P.; Zerr, P.; Horn, A.; Kireva, T.; Beyer, C.; Zwerina, J.; et al. Activation of canonical Wnt signalling is required for TGF-beta-mediated fibrosis. Nat. Commun. 2012, 3, 735. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nlandu-Khodo, S.; Neelisetty, S.; Phillips, M.; Manolopoulou, M.; Bhave, G.; May, L.; Clark, P.E.; Yang, H.; Fogo, A.B.; Harris, R.C.; et al. Blocking TGF-beta and beta-Catenin Epithelial Crosstalk Exacerbates CKD. J. Am. Soc. Nephrol. 2017, 28, 3490–3503. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene | Accession No. | Forward Primer (5′–3′) | Reverse Primer (5′–3′) |
---|---|---|---|
Tnf-a | NM_013693.3 | AGGGTCTGGGCCATAGAACT | CCACCACGCTCTTCTGTCTAC |
Il-1β | NM_008361.4 | GGTCAAAGGTTTGGAAGCAG | TGTGAAATGCCACCTTTTGA |
Icam-1 | NM_010493 | TTTTGGAGCTAGCGGACCAG | CCGCTCAGAAGAACCACCTT |
Mcp-1 | NM_011333 | CAGCCAGATGCAGTTAACGC | TTCTTGGGGTCAGCACAGAC |
Tgf-β1 | NM_011577.2 | CTGCTGACCCCCACTGATAC | GGGGCTGATCCCGTTGATTT |
Fibronectin | NM_010233.2 | CGAGGTGACAGAGACCACAA | CTGGAGTCAAGCCAGACACA |
Col1A1 | NM_007742.4 | GTTTGGAGAGAGCATGACCGA | TGGACATTAGGCGCAGGAA |
Col3A1 | NM_009930.2 | AAAGGGGCTGGAAAGTGAGG | AGCACCATCAGTTGTCCCTG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jin, J.; Li, W.; Wang, T.; Park, B.-H.; Park, S.K.; Kang, K.P. Loss of Proximal Tubular Sirtuin 6 Aggravates Unilateral Ureteral Obstruction-Induced Tubulointerstitial Inflammation and Fibrosis by Regulation of β-Catenin Acetylation. Cells 2022, 11, 1477. https://doi.org/10.3390/cells11091477
Jin J, Li W, Wang T, Park B-H, Park SK, Kang KP. Loss of Proximal Tubular Sirtuin 6 Aggravates Unilateral Ureteral Obstruction-Induced Tubulointerstitial Inflammation and Fibrosis by Regulation of β-Catenin Acetylation. Cells. 2022; 11(9):1477. https://doi.org/10.3390/cells11091477
Chicago/Turabian StyleJin, Jixiu, Wenjia Li, Tian Wang, Byung-Hyun Park, Sung Kwang Park, and Kyung Pyo Kang. 2022. "Loss of Proximal Tubular Sirtuin 6 Aggravates Unilateral Ureteral Obstruction-Induced Tubulointerstitial Inflammation and Fibrosis by Regulation of β-Catenin Acetylation" Cells 11, no. 9: 1477. https://doi.org/10.3390/cells11091477