CFTR Modulation Reduces SARS-CoV-2 Infection in Human Bronchial Epithelial Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cells
2.2. Viral Strains, Titration and Infection
Cell Treatments
2.3. RT-PCR
2.4. Western Immunoblotting
2.5. Flow Cytometry
2.6. Immunofluorescence Microscopy
2.7. TEER Measurement
2.8. Statistical Analysis
3. Results
3.1. SARS-CoV-2 Infection Is Less Effective in ΔF Than in WT CFBE41o- Cells
3.2. ACE-2 Expression Is Modulated by SARS-CoV-2 Infection in CFBE41o- Cells
3.3. SARS-CoV-2 Infection Is Strongly Inhibited in Human Bronchial Epithelial Cells with CRISPR-Cas9-Mediated CFTR Gene Deletion
3.4. Pharmacological Inhibition of CFTR Activity Limits SARS-CoV-2 Infection in CFBE41o- WT Cells
3.5. Differences in SARS-CoV-2 Infection and Epithelium Integrity in wt/wt-CFTR and F508del/F508del-CFTR MucilAir™
3.6. Drug Modulation of CFTR Able to Improve or Worsen SARS-CoV-2 Infection in In Vitro 3D Human Airway Epithelium
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zhu, N.; Zhang, D.; Wang, W.; Li, X.; Yang, B.; Song, J.; Zhao, X.; Huang, B.; Shi, W.; Lu, R.; et al. A Novel Coronavirus from Patients with Pneumonia in China, 2019. N. Engl. J. Med. 2020, 382, 727–733. [Google Scholar] [CrossRef] [PubMed]
- Huang, C.; Wang, Y.; Li, X.; Ren, L.; Zhao, J.; Hu, Y.; Zhang, L.; Fan, G.; Xu, J.; Gu, X.; et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet 2020, 395, 497–506. [Google Scholar] [CrossRef] [Green Version]
- Hui, D.S.; Ahzar, E.I.; Madani, T.A.; Ntoumi, F.; Kock, R.; Dar, O.; Ippolito, G.; McHugh, T.D.; Memish, Z.A.; Drosten, C.; et al. The continuing 2019-nCoV epidemic threat of novel coronaviruses to global health—The latest 2019 novel coronavirus outbreak in Wuhan, China. Int. J. Infect. Dis. 2020, 91, 264–266. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- W.H.O. WHO Director-General’s Opening Remarks at the Media Briefing on COVID-19. 2020. Available online: https://www.who.int/dg/speeches/detail/who-director-general-s-opening-remarksat-the-media-briefing-on-covid-19 (accessed on 11 March 2020).
- Hoffmann, M.; Kleine-Weber, H.; Schroeder, S.; Kruger, N.; Herrler, T.; Erichsen, S.; Schiergens, T.S.; Herrler, G.; Wu, N.H.; Nitsche, A.; et al. SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor. Cell 2020, 181, 271–280.e8. [Google Scholar] [CrossRef]
- Zhou, P.; Yang, X.L.; Wang, X.G.; Hu, B.; Zhang, L.; Zhang, W.; Si, H.R.; Zhu, Y.; Li, B.; Huang, C.L.; et al. A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature 2020, 579, 270–273. [Google Scholar] [CrossRef] [Green Version]
- Yang, J.; Petitjean, S.J.L.; Koehler, M.; Zhang, Q.; Dumitru, A.C.; Chen, W.; Derclaye, S.; Vincent, S.P.; Soumillion, P.; Alsteens, D. Molecular interaction and inhibition of SARS-CoV-2 binding to the ACE2 receptor. Nat. Commun. 2020, 11, 4541. [Google Scholar] [CrossRef]
- Guan, W.J.; Zhong, N.S. Clinical Characteristics of Covid-19 in China. Reply. N. Engl. J. Med. 2020, 382, 1861–1862. [Google Scholar] [CrossRef]
- Farshbafnadi, M.; Kamali Zonouzi, S.; Sabahi, M.; Dolatshahi, M.; Aarabi, M.H. Aging & COVID-19 susceptibility, disease severity, and clinical outcomes: The role of entangled risk factors. Exp. Gerontol. 2021, 154, 111507. [Google Scholar] [CrossRef]
- Collins, F.S. Cystic fibrosis: Molecular biology and therapeutic implications. Science 1992, 256, 774–779. [Google Scholar] [CrossRef]
- Elborn, J.S. Cystic fibrosis. Lancet 2016, 388, 2519–2531. [Google Scholar] [CrossRef]
- O′Sullivan, B.P.; Freedman, S.D. Cystic fibrosis. Lancet 2009, 373, 1891–1904. [Google Scholar] [CrossRef]
- Fainardi, V.; Longo, F.; Chetta, A.; Esposito, S.; Pisi, G. Sars-CoV-2 infection in patients with cystic fibrosis. An overview. Acta Biomed. 2020, 91, e2020035. [Google Scholar] [CrossRef] [PubMed]
- Colombo, C.; Burgel, P.R.; Gartner, S.; van Koningsbruggen-Rietschel, S.; Naehrlich, L.; Sermet-Gaudelus, I.; Southern, K.W. Impact of COVID-19 on people with cystic fibrosis. Lancet Respir. Med. 2020, 8, e35–e36. [Google Scholar] [CrossRef]
- Colombo, C.; Alicandro, G.; Dacco, V.; Gagliano, V.; Morlacchi, L.C.; Casciaro, R.; Pisi, G.; Francalanci, M.; Badolato, R.; Bignamini, E.; et al. SARS-CoV-2 infection in cystic fibrosis: A multicentre prospective study with a control group, Italy, February-July 2020. PLoS ONE 2021, 16, e0251527. [Google Scholar] [CrossRef]
- Mathew, H.R.; Choi, M.Y.; Parkins, M.D.; Fritzler, M.J. Systematic review: Cystic fibrosis in the SARS-CoV-2/COVID-19 pandemic. BMC Pulm. Med. 2021, 21, 173. [Google Scholar] [CrossRef]
- Pizzorno, A.; Padey, B.; Julien, T.; Trouillet-Assant, S.; Traversier, A.; Errazuriz-Cerda, E.; Fouret, J.; Dubois, J.; Gaymard, A.; Lescure, F.X.; et al. Characterization and Treatment of SARS-CoV-2 in Nasal and Bronchial Human Airway Epithelia. Cell Rep. Med. 2020, 1, 100059. [Google Scholar] [CrossRef]
- Illek, B.; Maurisse, R.; Wahler, L.; Kunzelmann, K.; Fischer, H.; Gruenert, D.C. Cl transport in complemented CF bronchial epithelial cells correlates with CFTR mRNA expression levels. Cell. Physiol. Biochem. 2008, 22, 57–68. [Google Scholar] [CrossRef] [Green Version]
- Bruscia, E.; Sangiuolo, F.; Sinibaldi, P.; Goncz, K.K.; Novelli, G.; Gruenert, D.C. Isolation of CF cell lines corrected at DeltaF508-CFTR locus by SFHR-mediated targeting. Gene Ther. 2002, 9, 683–685. [Google Scholar] [CrossRef] [Green Version]
- Bebok, Z.; Collawn, J.F.; Wakefield, J.; Parker, W.; Li, Y.; Varga, K.; Sorscher, E.J.; Clancy, J.P. Failure of cAMP agonists to activate rescued deltaF508 CFTR in CFBE41o- airway epithelial monolayers. J. Physiol. 2005, 569, 601–615. [Google Scholar] [CrossRef]
- Bene, Z.; Fejes, Z.; Szanto, T.G.; Fenyvesi, F.; Varadi, J.; Clarke, L.A.; Panyi, G.; Macek, M., Jr.; Amaral, M.D.; Balogh, I.; et al. Enhanced Expression of Human Epididymis Protein 4 (HE4) Reflecting Pro-Inflammatory Status Is Regulated by CFTR in Cystic Fibrosis Bronchial Epithelial Cells. Front. Pharmacol. 2021, 12, 592184. [Google Scholar] [CrossRef]
- Plebani, R.; Colas, R.A.; Mattoscio, D.; Trerotola, M.; Gomez, E.A.; Isopi, E.; Castagnozzi, S.; Dalli, J.; Romano, M. CFTR ablation by CRISPR/CAS9 impairs the production of pro-resolving lipid mediators by human airway epithelial cells. In Proceedings of the Annual North American Cystic Fibrosis Conference, Online, 21–23 October 2020; p. S75. [Google Scholar]
- Mattoscio, D.; Casadio, C.; Miccolo, C.; Maffini, F.; Raimondi, A.; Tacchetti, C.; Gheit, T.; Tagliabue, M.; Galimberti, V.E.; De Lorenzi, F.; et al. Autophagy regulates UBC9 levels during viral-mediated tumorigenesis. PLoS Pathog. 2017, 13, e1006262. [Google Scholar] [CrossRef] [PubMed]
- Ogando, N.S.; Dalebout, T.J.; Zevenhoven-Dobbe, J.C.; Limpens, R.; van der Meer, Y.; Caly, L.; Druce, J.; de Vries, J.J.C.; Kikkert, M.; Barcena, M.; et al. SARS-coronavirus-2 replication in Vero E6 cells: Replication kinetics, rapid adaptation and cytopathology. J. Gen. Virol. 2020, 101, 925–940. [Google Scholar] [CrossRef] [PubMed]
- Caly, L.; Druce, J.; Roberts, J.; Bond, K.; Tran, T.; Kostecki, R.; Yoga, Y.; Naughton, W.; Taiaroa, G.; Seemann, T.; et al. Isolation and rapid sharing of the 2019 novel coronavirus (SARS-CoV-2) from the first patient diagnosed with COVID-19 in Australia. Med. J. Aust. 2020, 212, 459–462. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Reed, L.J.; Muench, H. A simple method of estimating fifty per cent endpoints. Am. J. Epidemiol. 1938, 27, 493–497. [Google Scholar] [CrossRef]
- Mahy, B.W.J.; Kangro, H.O. Virology Methods Manual. In Virology Methods Manual; Press, A., Ed.; Elsevier: Amsterdam, The Netherlands, 1996. [Google Scholar]
- Li, D.; Zhang, J.; Li, J. Primer design for quantitative real-time PCR for the emerging Coronavirus SARS-CoV-2. Theranostics 2020, 10, 7150–7162. [Google Scholar] [CrossRef]
- Liao, Y.; Li, X.; Mou, T.; Zhou, X.; Li, D.; Wang, L.; Zhang, Y.; Dong, X.; Zheng, H.; Guo, L.; et al. Distinct infection process of SARS-CoV-2 in human bronchial epithelial cell lines. J. Med. Virol. 2020, 92, 2830–2838. [Google Scholar] [CrossRef]
- de Hostos, E.L.; Choy, R.K.; Nguyen, T. Developing novel antisecretory drugs to treat infectious diarrhea. Future Med. Chem. 2011, 3, 1317–1325. [Google Scholar] [CrossRef] [Green Version]
- Erdem, R.; Ambler, G.; Al-Ibrahim, M.; Fraczek, K.; Dong, S.D.; Gast, C.; Mercer, L.D.; Raine, M.; Tennant, S.M.; Chen, W.H.; et al. A Phase 2a randomized, single-center, double-blind, placebo-controlled study to evaluate the safety and preliminary efficacy of oral iOWH032 against cholera diarrhea in a controlled human infection model. PLoS Negl. Trop. Dis. 2021, 15, e0009969. [Google Scholar] [CrossRef]
- Keating, D.; Marigowda, G.; Burr, L.; Daines, C.; Mall, M.A.; McKone, E.F.; Ramsey, B.W.; Rowe, S.M.; Sass, L.A.; Tullis, E.; et al. VX-445-Tezacaftor-Ivacaftor in Patients with Cystic Fibrosis and One or Two Phe508del Alleles. N. Engl. J. Med. 2018, 379, 1612–1620. [Google Scholar] [CrossRef]
- Guerra, L.; Favia, M.; Di Gioia, S.; Laselva, O.; Bisogno, A.; Casavola, V.; Colombo, C.; Conese, M. The preclinical discovery and development of the combination of ivacaftor + tezacaftor used to treat cystic fibrosis. Expert Opin. Drug Discov. 2020, 15, 873–891. [Google Scholar] [CrossRef]
- Cosgriff, R.; Ahern, S.; Bell, S.C.; Brownlee, K.; Burgel, P.R.; Byrnes, C.; Corvol, H.; Cheng, S.Y.; Elbert, A.; Faro, A.; et al. A multinational report to characterise SARS-CoV-2 infection in people with cystic fibrosis. J. Cyst. Fibros. 2020, 19, 355–358. [Google Scholar] [CrossRef] [PubMed]
- McClenaghan, E.; Cosgriff, R.; Brownlee, K.; Ahern, S.; Burgel, P.R.; Byrnes, C.A.; Colombo, C.; Corvol, H.; Cheng, S.Y.; Daneau, G.; et al. The global impact of SARS-CoV-2 in 181 people with cystic fibrosis. J. Cyst. Fibros. 2020, 19, 868–871. [Google Scholar] [CrossRef] [PubMed]
- Alsaadi, E.A.J.; Jones, I.M. Membrane binding proteins of coronaviruses. Future Virol. 2019, 14, 275–286. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Abraham, E.H.; Guidotti, G.; Rapaport, E.; Bower, D.; Brown, J.; Griffin, R.J.; Donnelly, A.; Waitzkin, E.D.; Qamar, K.; Thompson, M.A.; et al. Cystic fibrosis improves COVID-19 survival and provides clues for treatment of SARS-CoV-2. Purinergic Signal 2021, 17, 399–410. [Google Scholar] [CrossRef]
- Mason, K.; Hasan, S.; Darukhanavala, A.; Kutney, K. COVID-19: Pathophysiology and implications for cystic fibrosis, diabetes and cystic fibrosis-related diabetes. J. Clin. Transl. Endocrinol. 2021, 26, 100268. [Google Scholar] [CrossRef]
- Stanton, B.A.; Hampton, T.H.; Ashare, A. SARS-CoV-2 (COVID-19) and cystic fibrosis. Am. J. Physiol. Lung Cell. Mol. Physiol. 2020, 319, L408–L415. [Google Scholar] [CrossRef]
- Bunyavanich, S.; Do, A.; Vicencio, A. Nasal Gene Expression of Angiotensin-Converting Enzyme 2 in Children and Adults. JAMA 2020, 323, 2427–2429. [Google Scholar] [CrossRef]
- Poschet, J.F.; Perkett, E.A.; Timmins, G.S.; Deretic, V. Azithromycin and ciprofloxacin have a chloroquine-like effect on respiratory epithelial cells. bioRxiv 2020. Preprint. [Google Scholar] [CrossRef] [Green Version]
- Bradbury, N.A. Intracellular CFTR: Localization and function. Physiol. Rev. 1999, 79, S175–S191. [Google Scholar] [CrossRef]
- Panou, M.M.; Antoni, M.; Morgan, E.L.; Loundras, E.A.; Wasson, C.W.; Welberry-Smith, M.; Mankouri, J.; Macdonald, A. Glibenclamide inhibits BK polyomavirus infection in kidney cells through CFTR blockade. Antiviral Res. 2020, 178, 104778. [Google Scholar] [CrossRef]
- Jiang, M.; Abend, J.R.; Tsai, B.; Imperiale, M.J. Early events during BK virus entry and disassembly. J. Virol. 2009, 83, 1350–1358. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Qian, M.; Cai, D.; Verhey, K.J.; Tsai, B. A lipid receptor sorts polyomavirus from the endolysosome to the endoplasmic reticulum to cause infection. PLoS Pathog. 2009, 5, e1000465. [Google Scholar] [CrossRef] [PubMed] [Green Version]








| Primers | Sequences (5′ -> 3′) |
|---|---|
| ORF1ab F | TGATGATACTCTCTGACGATGCTGT |
| ORF1ab R | CTCAGTCCAACATTTTGCTTCAGA |
| ACE-2 F | AAACATACTGTGACCCCGCAT |
| ACE-2 R | CCAAGCCTCAGCATATTGAACA |
| GAPDH F | TCAAGAAGGTGGTGAAGCAGG |
| GAPDH R | CAGCGTCAAAGGTGGAGGAGT |
| β-Actin F | CCCTGGACTTCGAGCAAGAG |
| β-Actin R | ACTCCATGCCCAGGAAGGAA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lotti, V.; Merigo, F.; Lagni, A.; Di Clemente, A.; Ligozzi, M.; Bernardi, P.; Rossini, G.; Concia, E.; Plebani, R.; Romano, M.; et al. CFTR Modulation Reduces SARS-CoV-2 Infection in Human Bronchial Epithelial Cells. Cells 2022, 11, 1347. https://doi.org/10.3390/cells11081347
Lotti V, Merigo F, Lagni A, Di Clemente A, Ligozzi M, Bernardi P, Rossini G, Concia E, Plebani R, Romano M, et al. CFTR Modulation Reduces SARS-CoV-2 Infection in Human Bronchial Epithelial Cells. Cells. 2022; 11(8):1347. https://doi.org/10.3390/cells11081347
Chicago/Turabian StyleLotti, Virginia, Flavia Merigo, Anna Lagni, Andrea Di Clemente, Marco Ligozzi, Paolo Bernardi, Giada Rossini, Ercole Concia, Roberto Plebani, Mario Romano, and et al. 2022. "CFTR Modulation Reduces SARS-CoV-2 Infection in Human Bronchial Epithelial Cells" Cells 11, no. 8: 1347. https://doi.org/10.3390/cells11081347
APA StyleLotti, V., Merigo, F., Lagni, A., Di Clemente, A., Ligozzi, M., Bernardi, P., Rossini, G., Concia, E., Plebani, R., Romano, M., Sbarbati, A., Sorio, C., & Gibellini, D. (2022). CFTR Modulation Reduces SARS-CoV-2 Infection in Human Bronchial Epithelial Cells. Cells, 11(8), 1347. https://doi.org/10.3390/cells11081347

