Cloning, Expression Analysis, and Functional Characterization of Candidate Oxalate Transporter Genes of HbOT1 and HbOT2 from Rubber Tree (Hevea brasiliensis)
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials
2.2. RNA Extraction, cDNA Synthesis, and qRT-PCR Analysis
2.3. Cloning of HbOT1 and HbOT2 and Sequence Analysis
2.4. Yeast Transformation and Stress Tolerance Assays
2.5. Statistical Methods
3. Results
3.1. Cloning of HbOT1 and HbOT2 from Rubber Tree
3.2. Characterization of HbOT1 and HbOT2
3.3. Multiple Sequence Alignment and Phylogenetic Tree Analysis of HbOT1 and HbOT2
3.4. Tissue-Specific Expression of HbOT1 and HbOT2
3.5. The Expression Pattern of HbOT1 and HbOT2 in Response to Various Metal Ion Stresses
3.6. The Expression Pattern of HbOT1 and HbOT2 in Response to Aluminum Stresses
3.7. Oxalic Acid Resistance and Oxalate Transporter Function Identification of HbOT1 and HbOT2 in Yeast
3.8. Identification of Aluminum Tolerance Function of HbOT1 and HbOT2 in Yeast
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Shen, H.; Yan, X. Toxicity of aluminum to plants and mechanism of plant resistance to aluminum toxicity and its influencing factors. Chin. J. Soil Sci. 2001, 32, 281–285. (In Chinese) [Google Scholar] [CrossRef]
- Ryan, P.R.; Tyerman, S.D.; Sasaki, T.; Furuichi, T.; Yamamoto, Y.; Zhang, W.H.; Delhaize, E. The identification of aluminium-resistance genes provides opportunities for enhancing crop production on acid soils. J. Exp. Bot. 2010, 62, 9–20. [Google Scholar] [CrossRef] [PubMed]
- Kochian, L.V.; Piñeros, M.A.; Liu, J.; Magalhaes, J.V. Plant Adaptation to Acid Soils: The Molecular Basis for Crop Aluminum Resistance. Annu. Rev. Plant Biol. 2015, 66, 571–598. [Google Scholar] [CrossRef] [PubMed]
- Feng, Y.; Yu, M.; Wang, C.; Liu, J. Aluminum toxicity induced cell responses in higher plants. J. Huazhong Agric. Univ. 2005, 24, 320–324. (In Chinese) [Google Scholar] [CrossRef]
- Zhang, H.; Zhang, G.-L.; Zhao, Y.-G.; Zhao, W.-J.; Qi, Z.-P. Chemical degradation of a Ferralsol (Oxisol) under intensive rubber (Hevea brasiliensis) farming in tropical China. Soil Tillage Res. 2007, 93, 109–116. [Google Scholar] [CrossRef]
- Wang, H.; Chen, R.F.; Iwashita, T.; Shen, R.F.; Ma, J.F. Physiological characterization of aluminum tolerance and accumulation in tartary and wild buckwheat. New Phytol. 2015, 205, 273–279. [Google Scholar] [CrossRef]
- Poschenrieder, C.; Gunsé, B.; Corrales, I.; Barceló, J. A glance into aluminum toxicity and resistance in plants. Sci. Total Environ. 2008, 400, 356–368. [Google Scholar] [CrossRef]
- Rahman, R.; Upadhyaya, H. Aluminium Toxicity and Its Tolerance in Plant: A Review. J. Plant Biol. 2020, 64, 101–121. [Google Scholar] [CrossRef]
- Ma, J.F. Syndrome of aluminum toxicity and diversity of aluminum resistance in higher plants. Int. Rev. Cytol. 2007, 264, 225–252. [Google Scholar] [CrossRef]
- Szewińska, J.; Różańska, E.; Papierowska, E.; Labudda, M. Proteolytic and Structural Changes in Rye and Triticale Roots under Aluminum Stress. Cells 2021, 10, 3046. [Google Scholar] [CrossRef]
- Wekesa, C.; Muoma, J.O.; Reichelt, M.; Asudi, G.O.; Furch, A.C.U.; Oelmüller, R. The Cell Membrane of a Novel Rhizobium phaseoli Strain Is the Crucial Target for Aluminium Toxicity and Tolerance. Cells 2022, 11, 873. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; He, Y.; Zheng, S. Research progresses in aluminum tolerance mechanisms in plants. Plant Nutr. Fertil. Sci. 2005, 11, 836–845. (In Chinese) [Google Scholar] [CrossRef]
- You, J.; Yang, Z. Organic acid secretion and its detoxificaton mechanism in plant roots under aluminum stress. J. Plant Physiol. Mol. Biol. 2005, 31, 111–118. (In Chinese) [Google Scholar] [CrossRef]
- Ma, J.F.; Hiradate, S. Form of aluminium for uptake and translocation in buckwheat (Fagopyrum esculentum Moench). Planta 2000, 211, 355–360. [Google Scholar] [CrossRef] [PubMed]
- Ma, J.F.; Hiradate, S.; Matsumoto, H. High Aluminum Resistance in Buckwheat: II. Oxalic Acid Detoxifies Aluminum Internally. Plant Physiol. 1998, 117, 753–759. [Google Scholar] [CrossRef]
- Zheng, S.J.; Ma, J.F.; Matsumoto, H. High Aluminum Resistance in Buckwheat: I. Al-induced Specific Secretion of Oxalic Acid from Root Tips. Plant Physiol. 1998, 117, 745–751. [Google Scholar] [CrossRef]
- Delhaize, E.; Gruber, B.D.; Ryan, P.R. The roles of organic anion permeases in aluminium resistance and mineral nutrition. FEBS Lett. 2007, 581, 2255–2262. [Google Scholar] [CrossRef]
- Yang, J.-L.; Fan, W.; Zheng, S.-J. Mechanisms and regulation of aluminum-induced secretion of organic acid anions from plant roots. J. Zhejiang Univ. Sci. B 2019, 20, 513–527. [Google Scholar] [CrossRef]
- Zhang, X.; Long, Y.; Huang, J.; Xia, J. Molecular Mechanisms for Coping with Al Toxicity in Plants. Int. J. Mol. Sci. 2019, 20, 1551. [Google Scholar] [CrossRef]
- Jiang, Q.; Gao, Z.; Lv, Z.; Hu, H.; Han, C. Research progress on the mechanism of plant resistance to aluminum toxicity. South China Agric. 2016, 10, 125–135. [Google Scholar] [CrossRef]
- Sasaki, T.; Yamamoto, Y.; Ezaki, B.; Katsuhara, M.; Ahn, S.J.; Ryan, P.R.; Delhaize, E.; Matsumoto, H. A wheat gene encoding an aluminum-activated malate transporter. Plant J. 2004, 37, 645–653. [Google Scholar] [CrossRef] [PubMed]
- Hoekenga, O.A.; Maron, L.G.; Piñeros, M.A.; Cançado, G.M.A.; Shaff, J.; Kobayashi, Y.; Ryan, P.R.; Dong, B.; Delhaize, E.; Sasaki, T.; et al. AtALMT1, which encodes a malate transporter, is identified as one of several genes critical for aluminum tolerance in Arabidopsis. Proc. Natl. Acad. Sci. USA 2006, 103, 9738–9743. [Google Scholar] [CrossRef] [PubMed]
- Ligaba, A.; Katsuhara, M.; Ryan, P.R.; Shibasaka, M.; Matsumoto, H. The BnALMT1 and BnALMT2 Genes from Rape Encode Aluminum-Activated Malate Transporters That Enhance the Aluminum Resistance of Plant Cells. Plant Physiol. 2006, 142, 1294–1303. [Google Scholar] [CrossRef]
- Collins, N.C.; Shirley, N.J.; Saeed, M.; Pallotta, M.; Gustafson, J.P. An ALMT1 Gene Cluster Controlling Aluminum Tolerance at the Alt4 Locus of Rye (Secale cereale L.). Genetics 2008, 179, 669–682. [Google Scholar] [CrossRef] [PubMed]
- Liang, C.; Piñeros, M.A.; Tian, J.; Yao, Z.; Sun, L.; Liu, J.; Shaff, J.; Coluccio, A.; Kochian, L.V.; Liao, H. Low pH, Aluminum, and Phosphorus Coordinately Regulate Malate Exudation through GmALMT1 to Improve Soybean Adaptation to Acid Soils. Plant Physiol. 2013, 161, 1347–1361. [Google Scholar] [CrossRef]
- Liu, J.; Magalhaes, J.V.; Shaff, J.; Kochian, L.V. Aluminum-activated citrate and malate transporters from the MATE and ALMT families function independently to confer Arabidopsis aluminum tolerance. Plant J. 2009, 57, 389–399. [Google Scholar] [CrossRef]
- Furukawa, J.; Yamaji, N.; Wang, H.; Mitani, N.; Murata, Y.; Sato, K.; Katsuhara, M.; Takeda, K.; Ma, J.F. An Aluminum-Activated Citrate Transporter in Barley. Plant Cell Physiol. 2007, 48, 1081–1091. [Google Scholar] [CrossRef]
- Magalhaes, J.V.; Liu, J.; Guimarães, C.T.; Lana, U.G.P.; Alves, V.M.C.; Wang, Y.-H.; E Schaffert, R.; A Hoekenga, O.; Pineros, M.; E Shaff, J.; et al. A gene in the multidrug and toxic compound extrusion (MATE) family confers aluminum tolerance in sorghum. Nat. Genet. 2007, 39, 1156–1161. [Google Scholar] [CrossRef]
- Lv, A.; Wen, W.; Fan, N.; Su, L.; Zhou, P.; An, Y. Dehydrin MsDHN1 improves aluminum tolerance of alfalfa (Medicago sativa L.) by affecting oxalate exudation from root tips. Plant J. 2021, 108, 441–458. [Google Scholar] [CrossRef]
- Chen, M.; Wu, Y.; Chen, Z.; Deng, W. Effect of different land utilization patterms and planting years on exchangeable acidity in soils. Guizhou Agric. Sci. 2010, 38, 112–114. (In Chinese) [Google Scholar] [CrossRef]
- Zhang, T.; Liu, Z.; An, F.; Xie, G. Study on the mechanism of death of rubber saplings caused by aluminum stress. Chin. J. Trop. Crops 2020, 41, 2439–2445. (In Chinese) [Google Scholar] [CrossRef]
- Zhang, H.; An, F.; Yuan, K.; Chen, Q.; Wang, Z. Effects of aluminum concentrations on several physiological parameters of rubber tree saplings. Chin. J. Trop. Crops 2014, 35, 1992–1996. (In Chinese) [Google Scholar] [CrossRef]
- Ma, X.; Liu, Z.; Liu, Z.; Xie, G.; Rookes, J.; An, F. Root secretion of oxalic and malic acids mitigates the rubber tree aluminum toxicity. J. Rubber Res. 2021, 24, 381–390. [Google Scholar] [CrossRef]
- Watanabe, T.; Shitan, N.; Suzuki, S.; Umezawa, T.; Shimada, M.; Yazaki, K.; Hattori, T. Oxalate Efflux Transporter from the Brown Rot Fungus Fomitopsis palustris. Appl. Environ. Microbiol. 2010, 76, 7683–7690. [Google Scholar] [CrossRef]
- Aniol, A. Induction of Aluminum Tolerance in Wheat Seedlings by Low Doses of Aluminum in the Nutrient Solution. Plant Physiol. 1984, 76, 551–555. [Google Scholar] [CrossRef]
- Ma, X.; An, F.; Liu, Z.; Xie, G. Screening of reference genes for quantitative real-time PCR of rubber saplings under aluminum stress. Chin. J. Trop. Crops 2020, 41, 955–963. (In Chinese) [Google Scholar] [CrossRef]
- Duan, L.; Liu, Y.; Zhu, Y.; Yang, X. DNPH colorimetry: A simple method for determination of protein carbonyl content. J. Toxicol. 2005, 4, 320–322. (In Chinese) [Google Scholar] [CrossRef]
- Cederberg, J.; Basu, S.; Eriksson, U.J. Increased rate of lipid peroxidation and protein carbonylation in experimental diabetic pregnancy. Diabetologia 2001, 44, 766–774. [Google Scholar] [CrossRef]
- Jin, H.; Li, L. Role of Arabidopsis SNARE proteins in vesicle trafficking. Bull. Bot. 2010, 45, 479–491. (In Chinese) [Google Scholar] [CrossRef]
- Luo, C.; Shi, Y.; Xiang, Y. SNAREs Regulate Vesicle Trafficking During Root Growth and Development. Front. Plant Sci. 2022, 13, 853251. [Google Scholar] [CrossRef]
- Ma, H.; Tan, L. Research progress of plant Qa-SNARE protein. Plant Physiol. J. 2014, 50, 132–142. (In Chinese) [Google Scholar] [CrossRef]
- Slane, D.; Reichardt, I.; El Kasmi, F.; Bayer, M.; Jürgens, G. Evolutionarily diverse SYP1 Qa-SNAREs jointly sustain pollen tube growth in Arabidopsis. Plant J. 2017, 92, 375–385. [Google Scholar] [CrossRef] [PubMed]
- He, X.; Huo, Y.; Liu, X.; Zhou, Q.; Feng, S.; Shen, X.; Li, B.; Wu, S.; Chen, X. Activation of disease resistance against Botryosphaeria dothidea by downregulating the expression of MdSYP121 in apple. Hortic. Res. 2018, 5, 24. [Google Scholar] [CrossRef] [PubMed]
- Laloux, T.; Matyjaszczyk, I.; Beaudelot, S.; Hachez, C.; Chaumont, F. Interaction Between the SNARE SYP121 and the Plasma Membrane Aquaporin PIP2;7 Involves Different Protein Domains. Front. Plant Sci. 2021, 11, 631643. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Feechan, A.; Pedersen, C.; Newman, M.-A.; Qiu, J.-L.; Olesen, K.L.; Thordal-Christensen, H. A SNARE-protein has opposing functions in penetration resistance and defence signalling pathways. Plant J. 2006, 49, 302–312. [Google Scholar] [CrossRef]
- Liu, M.; Peng, Y.; Li, H.; Deng, L.; Wang, X.; Kang, Z. TaSYP71, a Qc-SNARE, Contributes to Wheat Resistance against Puccinia striiformis f. sp. tritici. Front. Plant Sci. 2016, 7, 544. [Google Scholar] [CrossRef]
- Chaineau, M.; Danglot, L.; Galli, T. Multiple roles of the vesicular-SNARE TI-VAMP in post-Golgi and endosomal trafficking. FEBS Lett. 2009, 583, 3817–3826. [Google Scholar] [CrossRef]
- Rossi, V.; Banfield, D.; Vacca, M.; Dietrich, L.; Ungermann, C.; Desposito, M.; Galli, T.; Filippini, F. Longins and their longin domains: Regulated SNAREs and multifunctional SNARE regulators. Trends Biochem. Sci. 2004, 29, 682–688. [Google Scholar] [CrossRef]
- Gu, X.; Fonseka, K.; Agneessens, J.; Casson, S.A.; Smertenko, A.; Guo, G.; Topping, J.F.; Hussey, P.J.; Lindsey, K. The Arabidopsis R-SNARE VAMP714 is essential for polarisation of PIN proteins and auxin responses. New Phytol. 2021, 230, 550–566. [Google Scholar] [CrossRef]
- Xue, Y.; Yang, Y.; Yang, Z.; Wang, X.; Guo, Y. VAMP711 Is Required for Abscisic Acid-Mediated Inhibition of Plasma Membrane H+-ATPase Activity. Plant Physiol. 2018, 178, 1332–1343. [Google Scholar] [CrossRef]
- Sugano, S.; Hayashi, N.; Kawagoe, Y.; Mochizuki, S.; Inoue, H.; Mori, M.; Nishizawa, Y.; Jiang, C.-J.; Matsui, M.; Takatsuji, H. Rice OsVAMP714, a membrane-trafficking protein localized to the chloroplast and vacuolar membrane, is involved in resistance to rice blast disease. Plant Mol. Biol. 2016, 91, 81–95. [Google Scholar] [CrossRef] [PubMed]
- Xue, Y.; Zhao, S.; Yang, Z.; Guo, Y.; Yang, Y. Regulation of plasma membrane H+-ATPase activity by the members of the V-SNARE VAMP7C family in arabidopsis thaliana. Plant Signal. Behav. 2019, 14, e1573097. [Google Scholar] [CrossRef] [PubMed]
- Yun, H.S.; Kwon, C. Vesicle trafficking in plant immunity. Curr. Opin. Plant Biol. 2017, 40, 34–42. [Google Scholar] [CrossRef] [PubMed]
- Decottignies, A.; Grant, A.M.; Nichols, J.W.; de Wet, H.; McIntosh, D.B.; Goffeau, A. ATPase and Multidrug Transport Activities of the Overexpressed Yeast ABC Protein Yor1p. J. Biol. Chem. 1998, 273, 12612–12622. [Google Scholar] [CrossRef]










| Primer Name | Primer Sequence | Expected Size of PCR Products | Description |
|---|---|---|---|
| HbOT1 | F: ATGCCGAAATGGTGGAAGGT | 792 bp | For ORF sequence cloning |
| R: TTATTGACTCTTCTTCAGGCTGTCAC | |||
| HbOT2 | F: ATGGCCGCGGCGAGGAATCTG | 840 bp | |
| R: TCAAAAGGAAACCGAAGTACCA | |||
| HbOT1 (pDR196) | F: TTGGGTACCGGGCCCCCCCTCGAGGATGCCGAAATGGTGGAAGGT | 841 bp | For yeast heterologous expression vector construction |
| R: CTAGTGGATCCCCCGGGCTGCAGGTTATTGACTCTTCTTCAGGC | |||
| HbOT2 (pDR196) | F: TGGGTACCGGGCCCCCCCTCGAGGATGGCCGCGGCGAGGAATCT | 888 bp | |
| R: CTAGTGGATCCCCCGGGCTGCAGGTTACTCATATATCCGCTTTC | |||
| FpOAR (pDR196) | F: GGTACCGGGCCCCCCCTCGAGGATGACCGACCTGCATCGAAG | 1219 bp | |
| R: CTAGTGGATCCCCCGGGCTGCAGGTCAGAGAAGATCTTCTTGCC | |||
| HbOT1 (pCAMBIA1302) | F: GATCGAATTCCAATGCCGAAATGGTGGAAGGT | 814 bp | For subcellular localization vector construction |
| R: GATCAAGCTTTTATTGACTCTTCTTCAGGCTGTCAC | |||
| HbOT2 (pCAMBIA1300) | F: GAGAACACGGGGGACTATGGCCGCGGCGAGGAAT | 878 bp | |
| R: CAGCTCCTCGCCCTTGCTCACCATGCTCATATATCCGCTTTCTTT | |||
| qHbOT1 | F: TGGTTGTCTGCCCATGATCT | 199 bp | For qRT-PCR |
| R: GCTAGGAGAGGATGCAACCA | |||
| qHbOT2 | F: GGCTGATCATCACCTTCCCT | 186 bp | |
| R: TCCTAGGAGATTGATTTCTGGCT | |||
| qHbUBC4 | F: TCCTTATGAGGGCGGAGTC | 82 bp | |
| R: CAAGAACCGCACTTGAGGAG |
| Yeast Cell | Culture Time (day) | |||||||
|---|---|---|---|---|---|---|---|---|
| 0 | 1 | 3 | 5 | 7 | 9 | 11 | 13 | |
| pDR196 | 5 | 4.59 ± 0.082 Aa | 3.87 ± 0.095 Ba | 3.44 ± 0.125 Ba | 3.1 ± 0.066 Ca | 2.89 ± 0.118 Da | 2.78 ± 0.046 Da | 2.76 ± 0.072 Da |
| FpOAR | 5 | 4.09 ± 0.075 Ab | 3.19 ± 0.075 Bab | 2.76 ± 0.095 Cb | 2.64 ± 0.03 Db | 2.55 ± 0.053 DEb | 2.5 ± 0.066 EFb | 2.42 ± 0.05 Fb |
| HbOT1 | 5 | 4.12 ± 0.087 Ab | 3.13 ± 0.131 Bb | 2.67 ± 0.046 Cb | 2.49 ± 0.085 Dc | 2.4 ± 0.092 DEb | 2.32 ± 0.082 Ec | 2.31 ± 0.075 Eb |
| HbOT2 | 5 | 4.13 ± 0.108 Ab | 3.16 ± 0.07 Bb | 2.72 ± 0.079 Cb | 2.54 ± 0.07 Dbc | 2.43 ± 0.066 DEb | 2.4 ± 0.066 DEbc | 2.36 ± 0.075 Eb |
| Yeast Cell | Culture Time (day) | |||||||
|---|---|---|---|---|---|---|---|---|
| 0 | 1 | 3 | 5 | 7 | 9 | 11 | 13 | |
| pDR196 | 0 | 0.025 ± 0.01 Ac | 0.05 ± 0.01 Ab | 0.125 ± 0.018 Bc | 0.175 ± 0.015 Cb | 0.175 ± 0.02 Cb | 0.2 ± 0.023 Cb | 0.2 ± 0.015 Cc |
| FpOAR | 0 | 0.05 ± 0.015 Ab | 0.125 ± 0.02 Ba | 0.175 ± 0.015 Cb | 0.225 ± 0.018 Da | 0.225 ± 0.018 Da | 0.225 ± 0.018 Dab | 0.25 ± 0.01 Db |
| HbOT1 | 0 | 0.075 ± 0.013 Aa | 0.15 ± 0.018 Ba | 0.2 ± 0.013 Cab | 0.225 ± 0.023 CDa | 0.25 ± 0.015 Da | 0.25 ± 0.025 Da | 0.325 ± 0.013 Ea |
| HbOT2 | 0 | 0.05 ± 0.01 Ab | 0.15 ± 0.013 Ba | 0.225 ± 0.015 Ca | 0.225 ± 0.018 Ca | 0.25 ± 0.02 Ca | 0.25 ± 0.018 Ca | 0.325 ± 0.015 Da |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, Z.; Zhao, P.; Peng, W.; Liu, Z.; Xie, G.; Ma, X.; An, Z.; An, F. Cloning, Expression Analysis, and Functional Characterization of Candidate Oxalate Transporter Genes of HbOT1 and HbOT2 from Rubber Tree (Hevea brasiliensis). Cells 2022, 11, 3793. https://doi.org/10.3390/cells11233793
Yang Z, Zhao P, Peng W, Liu Z, Xie G, Ma X, An Z, An F. Cloning, Expression Analysis, and Functional Characterization of Candidate Oxalate Transporter Genes of HbOT1 and HbOT2 from Rubber Tree (Hevea brasiliensis). Cells. 2022; 11(23):3793. https://doi.org/10.3390/cells11233793
Chicago/Turabian StyleYang, Zongming, Pingjuan Zhao, Wentao Peng, Zifan Liu, Guishui Xie, Xiaowei Ma, Zewei An, and Feng An. 2022. "Cloning, Expression Analysis, and Functional Characterization of Candidate Oxalate Transporter Genes of HbOT1 and HbOT2 from Rubber Tree (Hevea brasiliensis)" Cells 11, no. 23: 3793. https://doi.org/10.3390/cells11233793
APA StyleYang, Z., Zhao, P., Peng, W., Liu, Z., Xie, G., Ma, X., An, Z., & An, F. (2022). Cloning, Expression Analysis, and Functional Characterization of Candidate Oxalate Transporter Genes of HbOT1 and HbOT2 from Rubber Tree (Hevea brasiliensis). Cells, 11(23), 3793. https://doi.org/10.3390/cells11233793

