Next Article in Journal
Biochemical Pathways of Cellular Mechanosensing/Mechanotransduction and Their Role in Neurodegenerative Diseases Pathogenesis
Next Article in Special Issue
Src Family Kinases Facilitate the Crosstalk between CGRP and Cytokines in Sensitizing Trigeminal Ganglion via Transmitting CGRP Receptor/PKA Pathway
Previous Article in Journal
Gut Microbiota in Nutrition and Health with a Special Focus on Specific Bacterial Clusters
Previous Article in Special Issue
Pathophysiology and Therapy of Associated Features of Migraine
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Cells
Volume 11
Issue 19
10.3390/cells11193092
cells-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Antagonism of CGRP Receptor: Central and Peripheral Mechanisms and Mediators in an Animal Model of Chronic Migraine

by
Rosaria Greco
1,*,
Chiara Demartini
1,2,
Miriam Francavilla
1,
Anna Maria Zanaboni
1,2 and
Cristina Tassorelli
1,2
1
Unit of Translational Neurovascular Research, IRCCS Mondino Foundation, 27100 Pavia, Italy
2
Department of Brain and Behavioral Sciences, University of Pavia, 27100 Pavia, Italy
*
Author to whom correspondence should be addressed.
Cells 2022, 11(19), 3092; https://doi.org/10.3390/cells11193092
Submission received: 6 September 2022 / Revised: 28 September 2022 / Accepted: 28 September 2022 / Published: 30 September 2022
(This article belongs to the Special Issue Migraine Neuroscience: From Experimental Models to Target Therapy)
Browse Figures
Versions Notes

Abstract

:
Calcitonin-gene-related peptide (CGRP) plays a key role in migraine pathophysiology and more specifically in the mechanisms underlying peripheral and central sensitization. Here, we explored the interaction of CGRP with other pain mediators relevant for neuronal sensitization in an animal model of chronic migraine. Male Sprague-Dawley rats were exposed to nitroglycerin (NTG, 5 mg/kg, i.p.) or vehicle co-administered with the CGRP receptor antagonist olcegepant (2 mg/kg i.p.), or its vehicle, every other day over a 9-day period. Twenty-four hours after the last injection of NTG (or vehicle), behavioral test and ex vivo analysis were performed. Olcegepant attenuated NTG-induced trigeminal hyperalgesia in the second phase of the orofacial formalin test. Interestingly, it also reduced gene expression and protein levels of CGRP, pro-inflammatory cytokines, inflammatory-associated miRNAs (miR-155-5p, miR-382-5p, and miR-34a-5p), and transient receptor potential ankyrin channels in the medulla–pons area, cervical spinal cord, and trigeminal ganglia. Similarly, olcegepant reduced the NTG-induced increase in CGRP and inflammatory cytokines in serum. The findings show that the activation of the CGRP pathway in a migraine animal model was associated to the persistent activation of inflammatory pathways, which was paralleled by a condition of hyperalgesia. These molecular events are relevant for informing us about the mechanisms underlying chronic migraine.

1. Introduction

Migraine is associated with the activation of the trigeminovascular system, which induces peripheral and central sensitization [1]. The role of central sensitization, and the associated increase in the transmission of pain signals along the second and third neuron, seems particularly important for chronic migraine.
A huge number of studies support the involvement of calcitonin gene-related peptide (CGRP) in the development of sensitization and enhanced pain sensibility that characterize migraine pain [2]. CGRP exists in two forms: α-CGRP predominates in the peripheral and central nervous system, whereas β-CGRP is mostly distributed in the enteric nervous system [3]. α-CGRP is released from trigeminal nerves during migraine attacks. The activation of the trigeminal nerve causes an antidromic release of α-CGRP to induce non-endothelium-mediated vasodilatation. In the trigeminal nucleus caudalis (TNC), CGRP acts on second-order neurons to transmit pain signals through the brainstem and midbrain to higher levels [4]. The CGRP receptors are highly distributed throughout the trigeminovascular system, particularly, but not limited to, on neurons and glial cells [5]. CGRP is also involved in mast cell degranulation and thus in neurogenic inflammation [6]. In vitro, CGRP enhances pro-inflammatory cytokine’ expression and release from rodent satellite glial cells of the trigeminal ganglia (TGs) [7], as well as from human peripheral blood mononuclear cells [8]. Circulating cytokines are known to be involved in the inflammatory pain phenomenon, and indirect evidence suggests that the release of these mediators from the trigeminovascular endings is involved in the initiation and persistence of pain [9]. The CGRP inflammatory mediator relationship may be bidirectional, since inflammatory mediators released during a migraine attack lead to the activation of transient receptor potential ankyrin 1 channels (TRPA1) [10,11], located on the trigeminal afferents, which in turn favor the release of CGRP [12,13]. The presence of inflammation in patients with migraine disease has been confirmed; for instance, several plasma cytokines, including tumor necrosis factor alpha (TNF-alpha), interleukin (IL)-1beta, and IL-6, increase during migraine attacks and in attack-free intervals [14]. Thus, the activation of the trigeminovascular system and the release of CGRP and neurogenic inflammation are key factors in migraine pathogenesis, together with the maintenance of a sensitized neuronal state [15,16,17,18].
Clinical studies confirmed the therapeutic potential of blocking CGRP in migraine pain by different CGRP receptor antagonists and monoclonal antibodies targeting either the CGRP or its receptor in the acute and preventive treatment of migraine with positive results [19,20,21]. Besides pain transmission, the blockade of CGRP signaling may exert beneficial effects also in relation to the inflammatory pathway in migraine, although the mechanisms are still not fully understood [22,23].
In the multifaceted scenario of migraine pathophysiology, there are also other elements that appear to be involved. MicroRNAs (miRNAs) are short non-coding RNAs that regulate a multiplicity of cellular processes, including immune/inflammatory responses and migraine pain [24,25]. Recently, we demonstrated that in patients with migraine disease, CGRP plasma levels and miR-382-5p and miR-34a-5p gene expression in peripheral cells are associated with each other at the individual level across the migraine spectrum [26]. In addition, CGRP plasma levels were positively correlated with the peripheral levels of both miRNAs, suggesting an interaction between CGRP and these signaling molecules. CGRP may induce IL-6 gene expression in macrophages by the upregulation of circular RNA_007893, a modulator of miR-485-5p [27].
The aim of this study was to explore in more depth the interplay between the neuropeptide CGRP and the inflammatory mediators within the mechanisms of neuronal sensitization in an animal model of chronic migraine, using olcegepant as a pharmacological probe. Specifically, we used the experimental animal model based on chronic systemic administration of nitroglycerin (NTG) that produces cephalic and extracephalic hypersensitivity [28,29,30] and evaluated ongoing changes of signaling molecules linked to inflammation in specific areas.

2. Materials and Methods

2.1. Animals and Experimental Design

Adult male Sprague-Dawley rats, weighing 250–270 g, were used in this study and randomly allocated in the different experimental groups, as reported in Table 1.
The IASP’s guidelines for pain research in animals were followed [31]. All procedures were conducted in accordance with the European Convention for Care and Use of Laboratory Animals, and the experimental protocols were approved by the Italian Ministry of Health (no. 691/2020-PR). The animals were housed in the animal facility of the University of Pavia (Pavia, Italy) in groups of two per cages under controlled conditions (i.e., temperature 21–22 °C, 60–50% relative humidity) and 12/12 h light cycle (with lights on at 7.00 a.m.). Food and water were available ad libitum. Upon arrival, animals were habituated to the housing conditions for one week before the experimental testing. The experiments were performed in a randomized manner by an experimenter blinded to treatments.
NTG (Bioindustria L.I.M., Novi Ligure (AL), Italy) was prepared from a stock solution of 5.0 mg/1.5 mL dissolved in 27% alcohol and 73% propylene glycol. For injections, NTG was further diluted in saline (0.9% NaCl) to reach the final concentration of 6% alcohol and 16% propylene glycol.
To test the appropriate dose of olcegepant able to counteract NTG-induced trigeminal hyperalgesia, we first tested two doses of the CGRP receptor antagonist in the acute animal model of migraine on the basis of a single NTG (10 mg/kg, i.p.) administration. For this purpose, groups of 6–9 rats were treated with olcegepant (1 or 2 mg/kg, i.p.) or vehicle (PEG 200/Tween-80/saline 1:1:18, 1 mL/kg, i.p.) 3 h after NTG (10 mg/kg, i.p.) or vehicle administration. Four hours after NTG (or vehicle) injection, the animals underwent the orofacial formalin test (Figure 1). The latency of h from NTG injection and the administration timing and doses of olcegepant were selected in agreement with previous observations [28,29,32,33,34].
The optimal dose identified with the above-described set of experiments was used within the animal model of chronic migraine, where 4 groups of 6 rats each received NTG (5 mg/kg, i.p.) or vehicle injection co-administered with olcegepant 2 mg/kg i.p. or its vehicle (1 mL/kg, i.p.) every 2 days over a 9-day period (see Table 1 for experimental group assignments).
Twenty-four hours after the last injection of NTG (or vehicle), a first set of rats underwent the orofacial formalin test. A second set of animals (not exposed to the orofacial formalin test) was used to evaluate CGRP, miRNAs, pro-inflammatory cytokines, and TRPA1 gene expression in medulla-pons, cervical spinal cord (CSC), and TGs. In the same areas, we also evaluated the protein levels of the same cytokines. Additionally, we assayed CGRP serum levels (Table 1 and Figure 1).

2.2. Orofacial Formalin Test

Since NTG is systemically administered and its sensitization properties can induce cephalic and extra-cephalic changes, the orofacial formalin test was used in association with the NTG model to specifically activate the trigeminal system. Such a combination allows for the study of NTG-induced hyperalgesia at the trigeminal level, reflecting the orofacial/cephalic hypersensitivity observed in migraine patients.
The procedures applied for the behavioral test were those extensively described elsewhere [35]. Briefly, after rats’ acclimatization (20 min) to the test chamber, they were injected subcutaneously with 50 μL of formalin 1.5% into the right upper lip. Face rubbing was measured by a researcher blind to treatments, counting the seconds the animal spent grooming the injected area with the ipsilateral forepaw or hindpaw 0–3 min (Phase I) and 12–45 min (Phase II) after formalin injection.

2.3. Rt-PCR and Enzyme-Linked Immunosorbent Assay (ELISA)

Rats of the second experimental set of the chronic model were euthanized under deep anesthesia (sodium thiopental) after the last NTG of vehicle injection. After decapitation, medulla–pons (bregma, −13.30 to −14.60 mm), CSC (C1–C2), and TGs were quickly dissected out, divided into right and left parts, rinsed in cold sterile 0.9% NaCl solution, placed in cryogenic tubes, and immediately frozen in liquid nitrogen. They were subsequently kept at −80 °C until rt-PCR processing for TNF-alpha, IL-1beta protein and gene expression, α-CGRP and TRPA1 gene expression, and miRNA evaluation. We selected medulla–pons and CSC because they contain several nuclei that play an important role in the mediation of migraine pain, e.g., TNC, locus coeruleus, and periacqueductal gray [36,37].
For mRNA, all procedures were performed under RNase-free conditions; after RNA extraction, the absorbance ratios (260/280 nm) ranged from 1.9 to 2.0 in all RNA samples, indicating no significant protein (including of blood origin) contamination. mRNA levels were measured by rt-PCR [38]. Primer sequences obtained from the Primer3 (https://primer3.ut.ee/, accessed on 14 January 2021) are reported in Table 2. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH), whose expression remained constant in all experimental groups, was used for normalization.
The same RNA was used for miRNA extraction in the same areas. Synthesis of cDNA was performed by using MirXMirna First Strand Synthesis (Takara-Diatech Labline, Jesi-Ancona, Italy), and TB Green q-Rt PCR was used (Takara-Diatech, Labline Jesi-Ancona, Italy) to determine expression levels of miR-155-5p, miR-34a-5p, and miR-382-5p. miRNAs expression was normalized with U6 (a type of small nuclear RNA), used as a housekeeping gene. The primers of miRNAs were selected from the Primer3 software (https://primer3.ut.ee/, accessed on 26 May 2021) and synthesized by Sigma Aldrich (Milan, Italy) (Table 2). Triplicate reactions were averaged for each mRNA and miRNA. The amount of mRNA was normalized to GAPDH or U6 using the 2–ΔΔCT method.
Pro-inflammatory cytokines in medulla–pons, CSC, and TG were evaluated using the ELISA procedure. All tissues were weighed and homogenized using a Precellys homogenizer, and central and peripheral cytokine levels were analyzed using a commercial ELISA kit (Diaclone Co, Besançon, France), adhering to the manufacturer’s instructions.
For CGRP, TNF-alpha, and IL-1beta serum levels, the blood samples were collected in a clot activator with gel separator serum tubes and centrifuged for 15 min at 1000× g at 2–8 °C. Protein levels were measured using commercial ELISA kits (α-CGRP: Elabsciences, Houston, TX, USA; TNF-alpha and IL-1beta: Diaclone Co, Besançon, France). The measured absorbance of the samples in a microplate reader (Biotek, Santa Clara, CA, USA) was compared with a standard curve, and the concentrations were calculated.

2.4. Statistical Analysis

An a priori power analysis was conducted to determine the required sample size needed to obtain a statistical power of 0.80 at an alpha level of 0.05 (GPower version 3.1.9.4, Franz Faul, University Kiel, Kiel, Germany). We hypothesized a difference in total nociceptive response in Phase II of the orofacial formalin test (face rubbing time, in the acute and the chronic models) between rats injected with NTG and rats injected with NTG + olcegepant of that at least equal to the control condition (NTG = 160 ± 14 SEM; CT = 135 ± 18 SEM), and thus we estimated a sample size of at least 6 rats in each experimental group with an effect size of 1.55. The data were tested for normality using the Shapiro–Wilk normality test and considered normal. For nociceptive responses, gene expression, and protein levels, the statistical differences between groups were determined using the one-way ANOVA followed by post hoc Tukey’s multiple comparisons test.
A probability level of <5% was considered significant.

3. Results

3.1. Acute Migraine Model

Orofacial Formalin Test

As illustrated in Figure 2, NTG administration induced a hyperalgesic state that was detectable as an increase in nocifensive behavior (total face rubbing time) during Phase II of the orofacial formalin test. Only 2 mg/kg of olcegepant significantly reduced NTG-induced nocifensive behavior in Phase II compared with NTG group, demonstrating a dose-dependent effect on trigeminal hyperalgesia. No significant effect was observed when olcegepant was injected with NTG vehicle compared with the CT group. No significant differences among groups were seen during Phase I of the test. The 2 mg/kg dose of olcegepant was then adopted to perform all the evaluations within the chronic migraine model.

3.2. Chronic Migraine Model

3.2.1. Orofacial Formalin Test

As illustrated in Figure 3, NTG administration induced a persistent hyperalgesic state, which was detectable as an increase in nocifensive behavior (total face rubbing time) during Phase II of the orofacial formalin test. This hyperalgesic state was detected 24 h after the last NTG treatment. The NTG-induced increase in face rubbing time was prevented by the chronic administration of olcegepant, confirming a key role of CGRP in the central and peripheral sensitization. Olcegepant did not induce any significant change in the orofacial formalin test when administered to the rats treated with NTG vehicle. No significant differences among groups were seen during Phase I of the test.

3.2.2. CGRP

Chronic NTG treatment increased CGRP gene expression in the central areas (CSC and medulla–pons, Figure 4A,B, respectively) and in the TG (Figure 4C) when compared with the control (CT) group. It also significantly increased CGRP serum levels (Figure 4D). These changes were significantly inhibited by chronic olcegepant treatment (Figure 4). No effect on CGRP gene expression and serum levels was observed when olcegepant was given with NTG vehicle (olcegepant 2 mg group).
The data suggest that olcegepant treatment reduces CGRP levels by blocking its receptor, probably via a negative feedback loop on NTG-induced inflammation.

3.2.3. Cytokines

Chronic NTG treatment increased gene expression and protein levels of TNF-alpha (Figure 5) and IL-1-beta (Figure 6) in medulla–pons, CSC, and TG compared to the CT group; moreover, the NTG challenge significantly increased TNF-alpha (Figure 5G) and IL-1-beta (Figure 6G) serum levels compared to the CT group. Chronic treatment with olcegepant induced a significant decrease in NTG-induced mRNA TNF-alpha in all the areas under evaluation (Figure 5A–C). Olcegepant administration also reduced TNF-alpha protein levels in the medulla–pons and TG (Figure 5D–F). Olcegepant reduced the NTG-induced increase in IL-1beta mRNA in all the areas under investigation. It also reduced IL-1beta protein levels in the CSC and medulla–pons and in the serum (Figure 6A–F). Olcegepant did not induce any significant change in the parameters under evaluation when administered to the rats treated with NTG vehicle. Data are shown in Figure 5 and Figure 6.
These findings indicate that the release of cytokines is mediated by CGRP probably from the activated glial cells, which is responsible for the persistence of trigeminal pain.

3.2.4. microRNAs

Chronic NTG-treated animals showed a significant increase in miR-155-5p (Figure 7A–C), miR-34a-5p (Figure 7D–F), and miR-382-5p (Figure 7G–I) expression in CSC, medulla–pons, and TG compared to the CT group. These changes were significantly attenuated in all areas by olcegepant treatment (Figure 7). No effect on microRNA levels was observed when olcegepant was given with NTG vehicle (olcegepant 2 mg group) (Figure 7). The findings suggest that CGRP may interfere by still unknown mechanisms in the modulation of inflammatory-related miRNAs.

3.2.5. TRPA1 Gene Expression

Chronic NTG administration caused a significant increase in TRPA1 mRNA expression levels in all the areas investigated compared to the CT group. These changes were significantly attenuated by olcegepant treatment in all the three areas. Data are reported in Figure 8. These results suggest that the blockade of CGRP receptor, probably by inhibition of pro-inflammatory pathways, interrupts the processes that lead to the neuropeptide release following TRPA1 activation.

4. Discussion

In migraine, peripheral and central sensitization play an important pathophysiological role, since they augment pain signal transmission, causing an altered processing of sensory stimuli. In this context, a major role belongs to CGRP, which is expressed in sensory afferents innervating the cranial vasculature and it exerts vasodilatory and neuroinflammatory action, contributing to the development of peripheral and central sensitization.
Here, we explored in depth the interaction of CGRP with other pain mediators relevant for neuronal sensitization in a migraine animal model of chronic migraine, using olcegepant as a pharmacological probe. In this context, our study yielded multiple important pieces of information. First, we confirmed the pivotal role of CGRP in migraine pathophysiology, as suggested by the increase in CGRP gene expression in medulla–pons, CSC, and TGs, as well as in the serum. In addition, we reported that the above-mentioned changes affecting the CGRP pathway are paralleled by an increase in (i) inflammatory cytokines in central and peripheral areas of the nervous system that are relevant in migraine circuitry and in the serum, (ii) miRNA associated to inflammation in the same areas, and (iii) TRPA1 gene expression in the same areas. These effects were all significantly counteracted by olcegepant administration in order to confirm the role of the CGRP pathway.
In agreement, mRNA and protein levels of CGRP were found to be significantly increased in the periaqueductal gray and TNC after NTG administration, supporting an involvement of CGRP in the endogenous pain modulatory system [39,40]. As noted, higher expression levels of CGRP in the brainstem are found in the locus coeruleus [36], a mainly noradrenergic nucleus involved in the regulation of autonomic [41], stress [42], and nociceptive functions [43]. The increase in CGRP serum levels likely reflects a peripherally restricted phenomenon, where CGRP is released from trigeminal fibers outside the blood–brain barrier (dura mater) and drained via intra- and extracranial venous vessels into the jugular blood [44,45,46].
Thus, the released CGRP would increase sensory activity at multiple levels, peripheral and central, a feature of migraine pain [47,48]. In the present study, NTG-induced increase in CGRP gene expression was significantly reversed after treatment with olcegepant, as was NTG-induced increase in CGRP serum levels. One of the possible ways through which CGRP is released after NTG is the activation of the TRPA1 channels [49], whose gene expression was increased by the NTG challenge, in agreement with previous data showing that TRPA1 channel activation in trigeminal nociceptive fibers leads to the release of the neuropeptide [12,13].
The increase in cytokines observed in the nervous tissues and in the serum in our experiments was inhibited by olcegepant. These findings indicate that the cytokine expression and release is mediated by CGRP. This latter was indeed reported to enhance the expression and release of pro-inflammatory cytokines from human peripheral blood mononuclear cells [8] and lymphocytes [50]. Interestingly, patients with an ongoing migraine attack have higher serum levels of pro-inflammatory cytokines compared to healthy controls, and their serum CGRP levels positively correlate with cytokine’s levels [51]. It is tempting to hypothesize that NTG-activated glial cells have a role in the increased cytokine expression and release in the TGs, CSC, and medulla–pons [52]. In line with this idea, previous data suggest that CGRP stimulates satellite glial cells within the TGs, subsequently to sensory neurons’ sensitization [7,53,54], probably also through the potentiation of the P2Y purinergic receptors [55]. Thus, we can speculate that the blockade of CGRP receptors by olcegepant led to a reduction in CGRP release and, hence, of pro-inflammatory mediators, thus breaking down the pathways that give rise to CGRP release. In line with this hypothesis, olcegepant inhibited TRPA1-mediated dilation [56] and blood flow [57] of the meningeal artery, thus suggesting a reduction of CGRP release [56,57]. Olcegepant-mediated block of pain and inflammation may in turn represent the signal for the system to further reduce CGRP release, again also via TRPA1, thus returning to a physiological level of CGRP receptor stimulation.
Mounting evidence suggests that several miRNAs expressed in the nervous system play important roles in neuroinflammation and chronic pain [58]. In particular, miR-155 has been shown to be deeply involved in regulating inflammation-associated diseases [5], including migraine [59,60]. Indeed, miR-155 was found to be upregulated in migraine patients in pain-free periods [59]; the same was also reported for miR-382-5p [61]. Intriguingly, the serum upregulation of miR-382-5p is also associated, together with miR-34a-5p, with migraine attacks [61].
In line with the above-mentioned observations, our study shows that the three miRNAs investigated here were upregulated in the model of chronic migraine, while they were downregulated by olcegepant treatment in the central and peripheral areas of the nervous system relevant for migraine pain. This downregulation was associated with a significant reduction of pro-inflammatory cytokines (gene and protein expression) in both peripheral and central nervous system areas, suggesting a relationship between CGRP, miRNAs, and cytokine pathways.
Recently, Chen et al. [39] reported an increase in TNF-alpha and IL-1beta levels and polarized microglia in TNC after chronic NTG; this suggests the possibility that NTG induces an upstream mechanism in which neuroinflammation is involved [39] and that blockade of the CGRP signaling is able to modulate neuroinflammation and pain. NTG may induce an inflammatory response within the dura mater and TG, potentiated by CGRP release, with an increase in pro-inflammatory cytokines IL-1beta and TNF-alpha levels by nuclear factor kappa B (NF-κB) activation [62,63]. This response may induce an upregulation of miRNAs, not only at the peripheral level but indirectly at the central level, confirming a link with pathways associated with pain transmission/modulation [25]. MiR-382-5p acts as a negative modulator of the interleukin 10 receptor alpha subunit (IL-10RA), an endogenous inhibitor of pro-inflammatory IL-1beta signaling gene expression [61], and thus its reduction is in keeping with the inhibition of CGRP pro-inflammatory activity after olcegepant treatment. Increased miR-382-5p expression in pain conditions may also be related to NF-κB signaling [64], which is a transcription factor for many miRNAs [65], including miR-382 [66]. MiR-34a-5p negatively modulates the GABAergic signaling and thus the reduced expression of miR-34a-5p after olcegepant may reflect a more active GABAergic transmission [61]. In agreement, we previously found that expression of miR-382-5p and miR-34a-5p in peripheral cells of patients with chronic migraine was significantly reduced after erenumab [67], the first-in-class fully human monoclonal antibody targeting the CGRP receptor. Moreover, in another study, we observed that CGRP plasma levels were positively correlated with miR-382-5p and miR-34a-5p in peripheral cells of chronic and episodic subjects, confirming a potential interaction [26] with the CGRP pathway. Here, we also demonstrated a significant upregulation of miR-155-5p, involved in the polarization of microglia and inflammatory processes in a variety of neurological diseases. MiR-155 overexpression promotes a pro-inflammatory phenotype in monocytes/macrophages and triggers the spontaneous production of several pro-inflammatory cytokines, including TNF-alpha, IL-6, and IL-1beta [68,69]. This finding is confirmed by a recent study, where changes in miR-155-5p expression were associated with microglial activation in the TNC after chronic NTG in rats, indicating that miR-155-5p may be involved in trigeminal hyperalgesia [60].
Altogether, these observations suggest the possibility that peripheral changes in miRNAs levels, previously reported by us in migraine patients, may likely reflect changes in central/peripheral areas of the nervous system involved in migraine pain modulation. Additionally, the findings also support a role for miR-382-5p, miR-34a-5p, and miR-155-5p in chronic migraine, which is partly, but probably not entirely, linked to the interaction with the CGRP pathway. The potential interplay between CGRP and the inflammatory mediators within the mechanisms of neuronal sensitization is reported in Figure 9.

Possible Limitations of the Study

A repeated use of acute migraine drugs can induce a condition of medication overuse headache [70]. In light of the experimental settings used in the present study, in which an acute migraine drug was used chronically, it must be noted that we did not detect any change in nociceptive and hyperalgesic behavior in the animals treated chronically with olcegepant and NTG vehicle (Figure 3), nor did we find an increase in the expression of inflammatory cytokines or of CGRP plasma levels, when comparing them with the control group. This is in agreement with previous literature showing that gepants (olcegepant and ubrogepant) did not induce central sensitization upon chronic administration [71,72]. Our data are also in accordance with clinical reports, in which neither gepants nor CGRP-targeting monoclonal antibodies were associated with the development of medication overuse headache [73,74].
In this study, we show that chronic CGRP antagonism attenuates NTG-induced trigeminal hyperalgesia. In the clinical setting, olcegepant failed to prevent NTG-induced migraine attacks in subjects with migraine disease [75]. A comparison of methodology between pre-clinical and clinical experiments is of course not possible. However, it is worth noting that our finding is in accordance with a recent study, in which migraine-like intracranial and extracranial neuronal hypersensitivity, as well as central trigeminocervical neurons’ activation stimulated by NTG, were reduced after olgecepant treatment [34]. Additionally, olcegepant was also effective in reducing the NTG-induced plantar allodynia [76] in another pre-clinical study. Another point that must be noted is that, differently from our study in animals and that of Juahsz et al. [45] in humans, Tvedskov and colleagues did not report changes in CGRP levels after NTG in migraine subjects [77].
The findings of the present study suggest a consistent modulation of the biomarkers under investigation in peripheral and central sites, which may be surprising when considering that olcegepant poorly penetrates the blood–brain barrier [78]. Thus, a possible limitation of the present study is that we tested olcegepant following systemic but not intracerebroventricular administration, thus not allowing a more comprehensive analysis of its site of action. It should, however, be noted that in the mouse model of chronic NTG, the intracerebroventricular administration of olcegepant was not effective compared with the systemic administration, thus suggesting that olcegepant has only peripheral effects [79]. Despite this observation, olcegepant was also reported to act in the TNC where it reduced the activation of second order neurons [80]. One possible interpretation is that olcegepant possesses a direct action in the periphery, which subsequently results in an indirect effect at the central level. This effect would in turn modulate the serum levels of the neuropeptide and also its gene expression in peripheral and central areas. An alternative hypothesis is that NTG-associated activation of neuroinflammation and CGRP release may alter blood–brain barrier permeability [81], thus allowing a direct central effect of olcegepant. Specifically targeted studies will be required to confirm or refute these alternative hypotheses.

5. Conclusions

The key role of CGRP in migraine pathogenesis and its chronicization is universally accepted. Here, we report that the changes in the CGRP pathway are paralleled by the activation of the neuroinflammation cascade and of miRNAs involved in the inflammatory pathway. To the best of our knowledge, this is the first report to evaluate these downstream molecular mechanisms following ligand-receptor blockade by olcegepant and demonstrating that the CGRP receptor antagonist reduces the mediators of sensitization in peripheral and central areas of the nervous system that are important in the circuitry of migraine pain.
Altogether, the present data contribute important additional pieces of knowledge in the understanding the complexity of the mechanisms related to CGRP in migraine pathogenesis; it seems reasonable to hypothesize that the miRNAs and cytokines investigated, together with the increased TRPA1 gene expression, may represent only a part of a multi-biomarker panel signature of the migraine disease.

Author Contributions

Conceptualization, R.G.; methodology, C.D., M.F. and A.M.Z.; validation, R.G.; formal analysis, R.G.; investigation, R.G., C.D., M.F. and A.M.Z.; resources, R.G., C.D., M.F. and A.M.Z.; data curation, R.G.; writing—original draft preparation, R.G. and C.D.; writing—review and editing, C.T.; visualization C.D.; supervision, R.G.; project administration, R.G.; Funding acquisition, C.T. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the European Funding for Neuroscience Research (Biomiga project, ERA-NET NEURON, Joint Transnational Research Projects 2019) to C.T., IRCCS Mondino Foundation, Pavia, Italy.

Institutional Review Board Statement

All procedures were approved by the Italian Ministry of Health (no. 691/2020-PR) and performed in agreement with the guidelines of the European Community Directive 2010/63/EU of 22 September 2010.

Data Availability Statement

The data presented in this study are available from the ZENODO repository (doi: 10.5281/zenodo.6794106).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Goadsby, P.J.; Holland, P.R.; Martins-Oliveira, M.; Hoffmann, J.; Schankin, C.; Akerman, S. Pathophysiology of Migraine: A Disorder of Sensory Processing. Physiol. Rev. 2017, 97, 553–622. [Google Scholar] [CrossRef]
  2. Edvinsson, L. CGRP and migraine: From bench to bedside. Rev. Neurol. 2021, 177, 785–790. [Google Scholar] [CrossRef]
  3. Mulderry, P.K.; Ghatei, M.A.; Spokes, R.A.; Jones, P.M.; Pierson, A.M.; Hamid, Q.A.; Kanse, S.; Amara, S.G.; Burrin, J.M.; Legon, S.; et al. Differential expression of alpha-CGRP and beta-CGRP by primary sensory neurons and enteric autonomic neurons of the rat. Neuroscience 1988, 25, 195–205. [Google Scholar] [CrossRef]
  4. Iyengar, S.; Johnson, K.W.; Ossipov, M.H.; Aurora, S.K. CGRP and the Trigeminal System in Migraine. Headache 2019, 59, 659–681. [Google Scholar] [CrossRef]
  5. Lennerz, J.K.; Rühle, V.; Ceppa, E.P.; Neuhuber, W.L.; Bunnett, N.W.; Grady, E.F.; Messlinger, K. Calcitonin receptor-like receptor (CLR), receptor activity-modifying protein 1 (RAMP1), and calcitonin gene-related peptide (CGRP) immunoreactivity in the rat trigeminovascular system: Differences between peripheral and central CGRP receptor distribution. J. Comp. Neurol. 2008, 507, 1277–1299. [Google Scholar] [CrossRef]
  6. Theoharides, T.C.; Donelan, J.; Kandere-Grzybowska, K.; Konstantinidou, A. The role of mast cells in migraine pathophysiology. Brain Res. Brain Res. Rev. 2005, 49, 65–76. [Google Scholar] [CrossRef]
  7. Afroz, S.; Arakaki, R.; Iwasa, T.; Oshima, M.; Hosoki, M.; Inoue, M.; Baba, O.; Okayama, Y.; Matsuka, Y. CGRP Induces Differential Regulation of Cytokines from Satellite Glial Cells in Trigeminal Ganglia and Orofacial Nociception. Int. J. Mol. Sci. 2019, 20, 711. [Google Scholar] [CrossRef]
  8. Cuesta, M.C.; Quintero, L.; Pons, H.; Suarez-Roca, H. Substance P and calcitonin gene-related peptide increase IL-1 beta, IL-6 and TNF alpha secretion from human peripheral blood mononuclear cells. Neurochem. Int. 2002, 40, 301–306. [Google Scholar] [CrossRef]
  9. Souza, G.R.; Talbot, J.; Lotufo, C.M.; Cunha, F.Q.; Cunha, T.M.; Ferreira, S.H. Fractalkine mediates inflammatory pain through activation of satellite glial cells. Proc. Natl. Acad. Sci. USA 2013, 110, 11193–11198. [Google Scholar] [CrossRef]
  10. Diogenes, A.; Akopian, A.N.; Hargreaves, K.M. NGF up-regulates TRPA1: Implications for orofacial pain. J. Dent. Res. 2007, 86, 550–555. [Google Scholar] [CrossRef]
  11. Hatano, N.; Itoh, Y.; Suzuki, H.; Muraki, Y.; Hayashi, H.; Onozaki, K.; Wood, I.C.; Beech, D.J.; Muraki, K. Hypoxia-inducible factor-1α (HIF1α) switches on transient receptor potential ankyrin repeat 1 (TRPA1) gene expression via a hypoxia response element-like motif to modulate cytokine release. J. Biol. Chem. 2012, 287, 31962–31972. [Google Scholar] [CrossRef]
  12. Eberhardt, M.; Dux, M.; Namer, B.; Miljkovic, J.; Cordasic, N.; Will, C.; Kichko, T.I.; de la Roche, J.; Fischer, M.; Suárez, S.A.; et al. H2S and NO cooperatively regulate vascular tone by activating a neuroendocrine HNO-TRPA1-CGRP signalling pathway. Nat. Commun. 2014, 5, 4381. [Google Scholar] [CrossRef]
  13. Kunkler, P.E.; Ballard, C.J.; Oxford, G.S.; Hurley, J.H. TRPA1 receptors mediate environmental irritant-induced meningeal vasodilatation. Pain 2011, 152, 38–44. [Google Scholar] [CrossRef]
  14. Edvinsson, L.; Haanes, K.A.; Warfvinge, K. Does inflammation have a role in migraine? Nat. Rev. Neurol. 2019, 15, 483–490. [Google Scholar] [CrossRef]
  15. Buzzi, M.G.; Pellegrino, M.G.; Bellantonio, P. Causes and mechanisms of primary headaches: Toward a bio-behavioral model. Ital. J. Neurol. Sci. 1995, 16, 15–19. [Google Scholar] [CrossRef] [PubMed]
  16. Reuter, U.; Bolay, H.; Jansen-Olesen, I.; Chiarugi, A.; Sanchez del Rio, M.; Letourneau, R.; Theoharides, T.C.; Waeber, C.; Moskowitz, M.A. Delayed inflammation in rat meninges: Implications for migraine pathophysiology. Brain 2001, 124 Pt 12, 2490–2502. [Google Scholar] [CrossRef]
  17. Bolay, H.; Reuter, U.; Dunn, A.K.; Huang, Z.; Boas, D.A.; Moskowitz, M.A. Intrinsic brain activity triggers trigeminal meningeal afferents in a migraine model. Nat. Med. 2002, 8, 136–142. [Google Scholar] [CrossRef]
  18. Parsons, A.A.; Strijbos, P.J. The neuronal versus vascular hypothesis of migraine and cortical spreading depression. Curr. Opin. Pharmacol. 2003, 3, 73–77. [Google Scholar] [CrossRef]
  19. Hong, P.; Tan, T.; Liu, Y.; Xiao, J. Gepants for abortive treatment of migraine: A network meta-analysis. Brain Behav. 2020, 10, e01701. [Google Scholar] [CrossRef] [PubMed]
  20. Chiang, C.C.; Schwedt, T.J. Calcitonin gene-related peptide (CGRP)-targeted therapies as preventive and acute treatments for migraine-The monoclonal antibodies and gepants. Prog. Brain Res. 2020, 255, 143–170. [Google Scholar] [CrossRef]
  21. Vandervorst, F.; Van Deun, L.; Van Dycke, A.; Paemeleire, K.; Reuter, U.; Schoenen, J.; Versijpt, J. CGRP monoclonal antibodies in migraine: An efficacy and tolerability comparison with standard prophylactic drugs. J. Headache Pain 2021, 22, 128. [Google Scholar] [CrossRef] [PubMed]
  22. Cavestro, C.; Ferrero, M.; Mandrino, S.; Di Tavi, M.; Rota, E. Novelty in Inflammation and Immunomodulation in Migraine. Curr. Pharm. Des. 2019, 25, 2919–2936. [Google Scholar] [CrossRef]
  23. Biscetti, L.; De Vanna, G.; Cresta, E.; Bellotti, A.; Corbelli, I.; Cupini, M.L.; Calabresi, P.; Sarchielli, P. Immunological findings in patients with migraine and other primary headaches: A narrative review. Clin. Exp. Immunol. 2022, 207, 11–26. [Google Scholar] [CrossRef] [PubMed]
  24. Sayed, D.; Abdellatif, M. MicroRNAs in development and disease. Physiol. Rev. 2011, 91, 827–887. [Google Scholar] [CrossRef] [PubMed]
  25. Ahmad, L.; Demartini, C.; Corrado, M.; Vaghi, G.; Piella, E.M.; Allena, M.; Zanaboni, A.M.; Greco, R.; Tassorelli, C.; De Icco, R. Expression of Selected microRNAs in Migraine: A New Class of Possible Biomarkers of Disease? Processes 2021, 9, 2199. [Google Scholar] [CrossRef]
  26. Greco, R.; De Icco, R.; Demartini, C.; Zanaboni, A.M.; Tumelero, E.; Sances, G.; Allena, M.; Tassorelli, C. Plasma levels of CGRP and expression of specific microRNAs in blood cells of episodic and chronic migraine subjects: Towards the identification of a panel of peripheral biomarkers of migraine? J. Headache Pain 2020, 21, 122. [Google Scholar] [CrossRef] [PubMed]
  27. Deng, T.; Yang, L.; Zheng, Z.; Li, Y.; Ren, W.; Wu, C.; Guo, L. Calcitonin gene-related peptide induces IL-6 expression in RAW264.7 macrophages mediated by mmu_circRNA_007893. Mol. Med. Rep. 2017, 16, 9367–9374. [Google Scholar] [CrossRef]
  28. Greco, R.; Ferrigno, A.; Demartini, C.; Zanaboni, A.; Mangione, A.S.; Blandini, F.; Nappi, G.; Vairetti, M.; Tassorelli, C. Evaluation of ADMA-DDAH-NOS axis in specific brain areas following nitroglycerin administration: Study in an animal model of migraine. J. Headache Pain 2015, 16, 560. [Google Scholar] [CrossRef]
  29. Greco, R.; Demartini, C.; Zanaboni, A.; Casini, I.; De Icco, R.; Reggiani, A.; Misto, A.; Piomelli, D.; Tassorelli, C. Characterization of the peripheral FAAH inhibitor, URB937, in animal models of acute and chronic migraine. Neurobiol. Dis. 2021, 147, 105157. [Google Scholar] [CrossRef]
  30. Harriott, A.M.; Strother, L.C.; Vila-Pueyo, M.; Holland, P.R. Animal models of migraine and experimental techniques used to examine trigeminal sensory processing. J. Headache Pain 2019, 20, 91. [Google Scholar] [CrossRef]
  31. Zimmermann, M. Ethical guidelines for investigations of experimental pain in conscious animals. Pain 1983, 16, 109–110. [Google Scholar] [CrossRef]
  32. Ramachandran, R.; Bhatt, D.K.; Ploug, K.B.; Hay-Schmidt, A.; Jansen-Olesen, I.; Gupta, S.; Olesen, J. Nitric oxide synthase, calcitonin gene-related peptide and NK-1 receptor mechanisms are involved in GTN-induced neuronal activation. Cephalalgia 2014, 34, 136–147. [Google Scholar] [CrossRef] [PubMed]
  33. Munro, G.; Petersen, S.; Jansen-Olesen, I.; Olesen, J. A unique inbred rat strain with sustained cephalic hypersensitivity as a model of chronic migraine-like pain. Sci. Rep. 2018, 8, 1836. [Google Scholar] [CrossRef] [PubMed]
  34. Akerman, S.; Romero-Reyes, M.; Karsan, N.; Bose, P.; Hoffmann, J.R.; Holland, P.R.; Goadsby, P.J. Therapeutic targeting of nitroglycerin-mediated trigeminovascular neuronal hypersensitivity predicts clinical outcomes of migraine abortives. Pain 2021, 162, 1567–1577. [Google Scholar] [CrossRef] [PubMed]
  35. Greco, R.; Demartini, C.; Zanaboni, A.M.; Tumelero, E.; Reggiani, A.; Misto, A.; Piomelli, D.; Tassorelli, C. FAAH inhibition as a preventive treatment for migraine: A pre-clinical study. Neurobiol. Dis. 2020, 134, 104624. [Google Scholar] [CrossRef] [PubMed]
  36. Tajti, J.; Uddman, R.; Edvinsson, L. Neuropeptide localization in the “migraine generator” region of the human brainstem. Cephalalgia 2001, 21, 96–101. [Google Scholar] [CrossRef]
  37. Vila-Pueyo, M.; Strother, L.C.; Kefel, M.; Goadsby, P.J.; Holland, P.R. Divergent influences of the locus coeruleus on migraine pathophysiology. Pain 2019, 160, 385–394. [Google Scholar] [CrossRef]
  38. Greco, R.; Demartini, C.; Zanaboni, A.M.; Redavide, E.; Pampalone, S.; Toldi, J.; Fülöp, F.; Blandini, F.; Nappi, G.; Sandrini, G.; et al. Effects of kynurenic acid analogue 1 (KYNA-A1) in nitroglycerin-induced hyperalgesia: Targets and anti-migraine mechanisms. Cephalalgia 2017, 37, 1272–1284. [Google Scholar] [CrossRef]
  39. Chen, H.; Tang, X.; Li, J.; Hu, B.; Yang, W.; Zhan, M.; Ma, T.; Xu, S. IL-17 crosses the blood-brain barrier to trigger neuroinflammation: A novel mechanism in nitroglycerin-induced chronic migraine. J. Headache Pain 2022, 23, 1. [Google Scholar] [CrossRef]
  40. Yao, G.; Han, X.; Hao, T.; Huang, Q.; Yu, T. Effects of rizatriptan on the expression of calcitonin gene-related peptide and cholecystokinin in the periaqueductal gray of a rat migraine model. Neurosci. Lett. 2015, 587, 29–34. [Google Scholar] [CrossRef]
  41. Samuels, E.R.; Szabadi, E. Functional neuroanatomy of the noradrenergic locus coeruleus: Its roles in the regulation of arousal and autonomic function part II: Physiological and pharmacological manipulations and pathological alterations of locus coeruleus activity in humans. Curr. Neuropharmacol. 2008, 6, 254–285. [Google Scholar] [CrossRef] [PubMed]
  42. McCall, J.G.; Al-Hasani, R.; Siuda, E.R.; Hong, D.Y.; Norris, A.J.; Ford, C.P.; Bruchas, M.R. CRH Engagement of the Locus Coeruleus Noradrenergic System Mediates Stress-Induced Anxiety. Neuron 2015, 87, 605–620. [Google Scholar] [CrossRef] [PubMed]
  43. Llorca-Torralba, M.; Borges, G.; Neto, F.; Mico, J.A.; Berrocoso, E. Noradrenergic Locus Coeruleus pathways in pain modulation. Neuroscience 2016, 338, 93–113. [Google Scholar] [CrossRef]
  44. Goadsby, P.J.; Edvinsson, L.; Ekman, R. Vasoactive peptide release in the extracerebral circulation of humans during migraine headache. Ann. Neurol. 1990, 28, 183–187. [Google Scholar] [CrossRef] [PubMed]
  45. Juhasz, G.; Zsombok, T.; Modos, E.A.; Olajos, S.; Jakab, B.; Nemeth, J.; Szolcsanyi, J.; Vitrai, J.; Bagdy, G. NO-induced migraine attack: Strong increase in plasma calcitonin gene-related peptide (CGRP) concentration and negative correlation with platelet serotonin release. Pain 2003, 106, 461–470. [Google Scholar] [CrossRef]
  46. Juhasz, G.; Zsombok, T.; Jakab, B.; Nemeth, J.; Szolcsanyi, J.; Bagdy, G. Sumatriptan causes parallel decrease in plasma calcitonin gene-related peptide (CGRP) concentration and migraine headache during nitroglycerin induced migraine attack. Cephalalgia 2005, 25, 179–183. [Google Scholar] [CrossRef]
  47. O’Connor, T.P.; van der Kooy, D. Enrichment of a vasoactive neuropeptide (calcitonin gene related peptide) in the trigeminal sensory projection to the intracranial arteries. J. Neurosci. 1988, 8, 2468–2476. [Google Scholar] [CrossRef]
  48. Raddant, A.C.; Russo, A.F. Calcitonin gene-related peptide in migraine: Intersection of peripheral inflammation and central modulation. Expert Rev. Mol. Med. 2011, 13, e36. [Google Scholar] [CrossRef]
  49. Demartini, C.; Tassorelli, C.; Zanaboni, A.M.; Tonsi, G.; Francesconi, O.; Nativi, C.; Greco, R. The role of the transient receptor potential ankyrin type-1 (TRPA1) channel in migraine pain: Evaluation in an animal model. J. Headache Pain 2017, 18, 94. [Google Scholar] [CrossRef]
  50. Holzmann, B. Modulation of immune responses by the neuropeptide CGRP. Amino. Acids 2013, 45, 1–7. [Google Scholar] [CrossRef]
  51. Han, D. Association of Serum Levels of Calcitonin Gene-related Peptide and Cytokines during Migraine Attacks. Ann. Indian Acad. Neurol. 2019, 22, 277–281. [Google Scholar] [CrossRef] [PubMed]
  52. Conti, P.; D’Ovidio, C.; Conti, C.; Gallenga, C.E.; Lauritano, D.; Caraffa, A.; Kritas, S.K.; Ronconi, G. Progression in migraine: Role of mast cells and pro-inflammatory and anti-inflammatory cytokines. Eur. J. Pharmacol. 2019, 844, 87–94. [Google Scholar] [CrossRef] [PubMed]
  53. Cady, R.J.; Glenn, J.R.; Smith, K.M.; Durham, P.L. Calcitonin gene-related peptide promotes cellular changes in trigeminal neurons and glia implicated in peripheral and central sensitization. Mol. Pain 2011, 7, 94. [Google Scholar] [CrossRef] [PubMed]
  54. Vause, C.V.; Durham, P.L. Calcitonin gene-related peptide differentially regulates gene and protein expression in trigeminal glia cells: Findings from array analysis. Neurosci. Lett. 2010, 473, 163–167. [Google Scholar] [CrossRef]
  55. Ceruti, S.; Villa, G.; Fumagalli, M.; Colombo, L.; Magni, G.; Zanardelli, M.; Fabbretti, E.; Verderio, C.; van den Maagdenberg, A.M.; Nistri, A.; et al. Calcitonin gene-related peptide-mediated enhancement of purinergic neuron/glia communication by the algogenic factor bradykinin in mouse trigeminal ganglia from wild-type and R192Q Cav2.1 Knock-in mice: Implications for basic mechanisms of migraine pain. J. Neurosci. 2011, 31, 3638–3649. [Google Scholar] [CrossRef]
  56. Hansted, A.K.; Bhatt, D.K.; Olesen, J.; Jensen, L.J.; Jansen-Olesen, I. Effect of TRPA1 activator allyl isothiocyanate (AITC) on rat dural and pial arteries. Pharmacol. Rep. 2019, 71, 565–572. [Google Scholar] [CrossRef]
  57. Nassini, R.; Materazzi, S.; Vriens, J.; Prenen, J.; Benemei, S.; De Siena, G.; la Marca, G.; Andrè, E.; Preti, D.; Avonto, C.; et al. The ‘headache tree’ via umbellulone and TRPA1 activates the trigeminovascular system. Brain 2012, 135 Pt 2, 376–390. [Google Scholar] [CrossRef]
  58. Imai, S.; Saeki, M.; Yanase, M.; Horiuchi, H.; Abe, M.; Narita, M.; Kuzumaki, N.; Suzuki, T. Change in microRNAs associated with neuronal adaptive responses in the nucleus accumbens under neuropathic pain. J. Neurosci. 2011, 31, 15294–15299. [Google Scholar] [CrossRef] [PubMed]
  59. Cheng, C.Y.; Chen, S.P.; Liao, Y.C.; Fuh, J.L.; Wang, Y.F.; Wang, S.J. Elevated circulating endothelial-specific microRNAs in migraine patients: A pilot study. Cephalalgia 2018, 38, 1585–1591. [Google Scholar] [CrossRef] [PubMed]
  60. Wen, Q.; Wang, Y.; Pan, Q.; Tian, R.; Zhang, D.; Qin, G.; Zhou, J.; Chen, L. MicroRNA-155-5p promotes neuroinflammation and central sensitization via inhibiting SIRT1 in a nitroglycerin-induced chronic migraine mouse model. J. Neuroinflammation 2021, 18, 287. [Google Scholar] [CrossRef] [PubMed]
  61. Andersen, H.H.; Duroux, M.; Gazerani, P. Serum MicroRNA Signatures in Migraineurs During Attacks and in Pain-Free Periods. Mol. Neurobiol. 2016, 53, 1494–1500. [Google Scholar] [CrossRef]
  62. Reuter, U.; Chiarugi, A.; Bolay, H.; Moskowitz, M.A. Nuclear factor-kappaB as a molecular target for migraine therapy. Ann. Neurol. 2002, 51, 507–516. [Google Scholar] [CrossRef]
  63. Greco, R.; Tassorelli, C.; Cappelletti, D.; Sandrini, G.; Nappi, G. Activation of the transcription factor NF-kappaB in the nucleus trigeminalis caudalis in an animal model of migraine. Neurotoxicology 2005, 26, 795–800. [Google Scholar] [CrossRef] [PubMed]
  64. Sarchielli, P.; Floridi, A.; Mancini, M.L.; Rossi, C.; Coppola, F.; Baldi, A.; Pini, L.A.; Calabresi, P. NF-κB activity and iNOS expression in monocytes from internal jugular blood of migraine without aura patients during attacks. Cephalalgia 2006, 26, 1071–1079. [Google Scholar] [CrossRef] [PubMed]
  65. Zhai, Y.; Zhu, Y.Y. MiR-30a relieves migraine by degrading CALCA. Eur. Rev. Med. Pharmacol. Sci. 2018, 22, 2022–2028. [Google Scholar] [CrossRef]
  66. Tafuri, E.; Santovito, D.; De Nardis, V.; Marcantonio, P.; Paganelli, C.; Affaitati, G.; Bucci, M.; Mezzetti, A.; Giamberardino, M.A.; Cipollone, F. MicroRNA profiling in migraine without aura: Pilot study. Ann. Med. 2015, 47, 468–473. [Google Scholar] [CrossRef] [PubMed]
  67. De Icco, R.; Fiamingo, G.; Greco, R.; Bottiroli, S.; Demartini, C.; Zanaboni, A.M.; Allena, M.; Guaschino, E.; Martinelli, D.; Putortì, A.; et al. Neurophysiological and biomolecular effects of erenumab in chronic migraine: An open label study. Cephalalgia 2020, 40, 1336–1345. [Google Scholar] [CrossRef] [PubMed]
  68. Kurowska-Stolarska, M.; Alivernini, S.; Ballantine, L.E.; Asquith, D.L.; Millar, N.L.; Gilchrist, D.S.; Reilly, J.; Ierna, M.; Fraser, A.R.; Stolarski, B.; et al. MicroRNA-155 as a proinflammatory regulator in clinical and experimental arthritis. Proc. Natl. Acad. Sci. USA 2011, 108, 11193–11198. [Google Scholar] [CrossRef]
  69. Elmesmari, A.; Fraser, A.R.; Wood, C.; Gilchrist, D.; Vaughan, D.; Stewart, L.; McSharry, C.; McInnes, I.B.; Kurowska-Stolarska, M. MicroRNA-155 regulates monocyte chemokine and chemokine receptor expression in Rheumatoid Arthritis. Rheumatology 2016, 55, 2056–2065. [Google Scholar] [CrossRef] [PubMed]
  70. Thorlund, K.; Sun-Edelstein, C.; Druyts, E.; Kanters, S.; Ebrahim, S.; Bhambri, R.; Ramos, E.; Mills, E.J.; Lanteri-Minet, M.; Tepper, S. Risk of medication overuse headache across classes of treatments for acute migraine. J. Headache Pain 2016, 17, 107. [Google Scholar] [CrossRef] [Green Version]
  71. Saengjaroentham, C.; Strother, L.C.; Dripps, I.; Sultan Jabir, M.R.; Pradhan, A.; Goadsby, P.J.; Holland, P.R. Differential medication overuse risk of novel anti-migraine therapeutics. Brain 2020, 143, 2681–2688. [Google Scholar] [CrossRef]
  72. Navratilova, E.; Behravesh, S.; Oyarzo, J.; Dodick, D.W.; Banerjee, P.; Porreca, F. Ubrogepant does not induce latent sensitization in a preclinical model of medication overuse headache. Cephalalgia 2020, 40, 892–902. [Google Scholar] [CrossRef]
  73. Tepper, S.J.; Diener, H.C.; Ashina, M.; Brandes, J.L.; Friedman, D.I.; Reuter, U.; Cheng, S.; Nilsen, J.; Leonardi, D.K.; Lenz, R.A.; et al. Erenumab in chronic migraine with medication overuse: Subgroup analysis of a randomized trial. Neurology 2019, 92, e2309–e2320. [Google Scholar] [CrossRef]
  74. Moreno-Ajona, D.; Villar-Martínez, M.D.; Goadsby, P.J. New Generation Gepants: Migraine Acute and Preventive Medications. J. Clin. Med. 2022, 11, 1656. [Google Scholar] [CrossRef] [PubMed]
  75. Olesen, J.; Diener, H.C.; Husstedt, I.W.; Goadsby, P.J.; Hall, D.; Meier, U.; Pollentier, S.; Lesko, L.M.; BIBN 4096 BS Clinical Proof of Concept Study Group. Calcitonin gene-related peptide receptor antagonist BIBN 4096 BS for the acute treatment of migraine. N. Engl. J. Med. 2004, 350, 1104–1110. [Google Scholar] [CrossRef]
  76. Ernstsen, C.; Christensen, S.L.; Olesen, J.; Kristensen, D.M. No additive effect of combining sumatriptan and olcegepant in the GTN mouse model of migraine. Cephalalgia 2021, 41, 329–339. [Google Scholar] [CrossRef]
  77. Tvedskov, J.F.; Tfelt-Hansen, P.; Petersen, K.A.; Jensen, L.T.; Olesen, J. CGRP receptor antagonist olcegepant (BIBN4096BS) does not prevent glyceryl trinitrate-induced migraine. Cephalalgia 2010, 30, 1346–1353. [Google Scholar] [CrossRef]
  78. Edvinsson, L.; Warfvinge, K. Recognizing the role of CGRP and CGRP receptors in migraine and its treatment. Cephalalgia 2019, 39, 366–373. [Google Scholar] [CrossRef]
  79. Christensen, S.L.; Ernstsen, C.; Olesen, J.; Kristensen, D.M. No central action of CGRP antagonising drugs in the GTN mouse model of migraine. Cephalalgia 2020, 40, 924–934. [Google Scholar] [CrossRef]
  80. Sixt, M.L.; Messlinger, K.; Fischer, M.J. Calcitonin gene-related peptide receptor antagonist olcegepant acts in the spinal trigeminal nucleus. Brain 2009, 132 Pt 11, 3134–3341. [Google Scholar] [CrossRef] [Green Version]
  81. Long, T.; He, W.; Pan, Q.; Zhang, S.; Zhang, D.; Qin, G.; Chen, L.; Zhou, J. Microglia P2X4R-BDNF signalling contributes to central sensitization in a recurrent nitroglycerin-induced chronic migraine model. J. Headache Pain 2020, 21, 4. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Cells 11 03092 g001 550
Figure 1. Experimental design of the acute and chronic models with specific procedures. Acute migraine model: after treatments, the animals underwent the orofacial formalin test; at the end of the behavioral test, all animals were sacrificed. Chronic migraine model: after treatments, the animals were divided into two different experimental sets. In the first set, the animals underwent the orofacial formalin test and then they were sacrificed. Within the second set, after sacrifice, the samples were collected to be used for rt-PCR and ELISA analysis. ELISA: enzyme-linked immunosorbent assay; n: number of animals per group; NTG: nitroglycerin; OFT: orofacial formalin test; rt-PCR: real time polymerase chain reaction.
Figure 1. Experimental design of the acute and chronic models with specific procedures. Acute migraine model: after treatments, the animals underwent the orofacial formalin test; at the end of the behavioral test, all animals were sacrificed. Chronic migraine model: after treatments, the animals were divided into two different experimental sets. In the first set, the animals underwent the orofacial formalin test and then they were sacrificed. Within the second set, after sacrifice, the samples were collected to be used for rt-PCR and ELISA analysis. ELISA: enzyme-linked immunosorbent assay; n: number of animals per group; NTG: nitroglycerin; OFT: orofacial formalin test; rt-PCR: real time polymerase chain reaction.
Cells 11 03092 g001
Cells 11 03092 g002 550
Figure 2. Time of face rubbing (expressed in seconds) during Phase I and II of the orofacial formalin test following acute systemic adminsitration of nitroglycerin (NTG)/vehicle and olcegepant/vehicle. Data are expressed as mean ± SEM. One-way ANOVA followed by Tukey’s multiple comparisons test: *** p < 0.001 vs. control (CT), olcegepant 1 mg and olcegepant 2 mg; ° p < 0.05 vs. NTG; # p < 0.05 vs. olcegepant 1 mg.
Figure 2. Time of face rubbing (expressed in seconds) during Phase I and II of the orofacial formalin test following acute systemic adminsitration of nitroglycerin (NTG)/vehicle and olcegepant/vehicle. Data are expressed as mean ± SEM. One-way ANOVA followed by Tukey’s multiple comparisons test: *** p < 0.001 vs. control (CT), olcegepant 1 mg and olcegepant 2 mg; ° p < 0.05 vs. NTG; # p < 0.05 vs. olcegepant 1 mg.
Cells 11 03092 g002
Cells 11 03092 g003 550
Figure 3. Time of face rubbing (expressed in seconds) during Phase I and II of the orofacial formalin test following chronic systemic administration of nitroglycerin (NTG)/vehicle and olcegepant/vehicle. Data are expressed as mean ± SEM. One-way ANOVA followed by Tukey’s multiple comparisons test: * p < 0.05 vs. control (CT) and olcegepant 2 mg; °° p < 0.01 vs. NTG.
Figure 3. Time of face rubbing (expressed in seconds) during Phase I and II of the orofacial formalin test following chronic systemic administration of nitroglycerin (NTG)/vehicle and olcegepant/vehicle. Data are expressed as mean ± SEM. One-way ANOVA followed by Tukey’s multiple comparisons test: * p < 0.05 vs. control (CT) and olcegepant 2 mg; °° p < 0.01 vs. NTG.
Cells 11 03092 g003
Cells 11 03092 g004 550
Figure 4. CGRP mRNA levels expressed as relative quantification (RQ) in cervical spinal cord (CSC) (A), medulla–pons (B), and trigeminal ganglia (TG) (C); CGRP serum levels expressed as pg/mL (D). Data are expressed as mean ± SEM; one-way ANOVA followed by Tukey’s multiple comparisons test. ** p < 0.01 and *** p < 0.001, vs. control (CT) and olcegepant 2 mg; °°° p < 0.001 vs. nitroglycerin (NTG).
Figure 4. CGRP mRNA levels expressed as relative quantification (RQ) in cervical spinal cord (CSC) (A), medulla–pons (B), and trigeminal ganglia (TG) (C); CGRP serum levels expressed as pg/mL (D). Data are expressed as mean ± SEM; one-way ANOVA followed by Tukey’s multiple comparisons test. ** p < 0.01 and *** p < 0.001, vs. control (CT) and olcegepant 2 mg; °°° p < 0.001 vs. nitroglycerin (NTG).
Cells 11 03092 g004
Cells 11 03092 g005 550
Figure 5. TNF-alpha gene expression levels (A–C) and protein levels (D–F) in cervical spinal cord (CSC), medulla–pons and trigeminal ganglion (TG), and TNF-alpha serum levels (G). mRNA levels are expressed as relative quantification (RQ); protein levels in tissues are expressed as pg/mg of protein and in serum are expressed as pg/mL. Data are expressed as mean ± SEM; one-way ANOVA followed by Tukey’s multiple comparisons test. * p < 0.05, ** p < 0.01, and *** p < 0.001 vs. control (CT) and olcegepant 2 mg; °° p < 0.01 and °°° p < 0.001 vs. nitroglycerin (NTG); § p < 0.05 vs. CT.
Figure 5. TNF-alpha gene expression levels (A–C) and protein levels (D–F) in cervical spinal cord (CSC), medulla–pons and trigeminal ganglion (TG), and TNF-alpha serum levels (G). mRNA levels are expressed as relative quantification (RQ); protein levels in tissues are expressed as pg/mg of protein and in serum are expressed as pg/mL. Data are expressed as mean ± SEM; one-way ANOVA followed by Tukey’s multiple comparisons test. * p < 0.05, ** p < 0.01, and *** p < 0.001 vs. control (CT) and olcegepant 2 mg; °° p < 0.01 and °°° p < 0.001 vs. nitroglycerin (NTG); § p < 0.05 vs. CT.
Cells 11 03092 g005
Cells 11 03092 g006 550
Figure 6. IL-1beta gene expression levels (A–C) and protein levels (D–F) in cervical spinal cord (CSC), medulla–pons and trigeminal ganglion (TG), and IL-1beta serum levels (G). mRNA levels are expressed as relative quantification (RQ); protein levels in tissues are expressed as pg/mg of protein and in serum are expressed as pg/mL. Data are expressed as mean ± SEM; one-way ANOVA followed by Tukey’s multiple comparisons test. * p < 0.05, ** p < 0.01, and *** p < 0.001 vs. control (CT) and olcegepant 2 mg; ° p < 0.05 and °°° p < 0.001 vs. nitroglycerin (NTG).
Figure 6. IL-1beta gene expression levels (A–C) and protein levels (D–F) in cervical spinal cord (CSC), medulla–pons and trigeminal ganglion (TG), and IL-1beta serum levels (G). mRNA levels are expressed as relative quantification (RQ); protein levels in tissues are expressed as pg/mg of protein and in serum are expressed as pg/mL. Data are expressed as mean ± SEM; one-way ANOVA followed by Tukey’s multiple comparisons test. * p < 0.05, ** p < 0.01, and *** p < 0.001 vs. control (CT) and olcegepant 2 mg; ° p < 0.05 and °°° p < 0.001 vs. nitroglycerin (NTG).
Cells 11 03092 g006
Cells 11 03092 g007 550
Figure 7. Expression levels of miR-155-5p (A–C), miR-34a-5p (D–F), and miR-382-5p (G–I) in the cervical spinal cord (CSC), medulla–pons, and trigeminal ganglion (TG). microRNA expression is expressed as relative quantification (RQ). Data are expressed as mean ± SEM; one-way ANOVA followed by Tukey’s multiple comparisons test. * p < 0.05, ** p < 0.01, and *** p < 0.001 vs. control (CT) and olcegepant 2 mg; ° p < 0.05, °° p < 0.01, and °°° p < 0.001 vs. nitroglycerin (NTG).
Figure 7. Expression levels of miR-155-5p (A–C), miR-34a-5p (D–F), and miR-382-5p (G–I) in the cervical spinal cord (CSC), medulla–pons, and trigeminal ganglion (TG). microRNA expression is expressed as relative quantification (RQ). Data are expressed as mean ± SEM; one-way ANOVA followed by Tukey’s multiple comparisons test. * p < 0.05, ** p < 0.01, and *** p < 0.001 vs. control (CT) and olcegepant 2 mg; ° p < 0.05, °° p < 0.01, and °°° p < 0.001 vs. nitroglycerin (NTG).
Cells 11 03092 g007
Cells 11 03092 g008 550
Figure 8. TRPA1 gene expression levels in (A) cervical spinal cord (CSC), (B) medulla–pons, and (C) trigeminal ganglion (TG). mRNA levels are expressed as relative quantification (RQ). Data are expressed as mean ± SEM; one-way ANOVA followed by Tukey’s multiple comparisons test. *** p < 0.001 vs. control (CT) and olcegepant 2 mg; °°° p < 0.001 vs. nitroglycerin (NTG); # p < 0.05 vs. CT.
Figure 8. TRPA1 gene expression levels in (A) cervical spinal cord (CSC), (B) medulla–pons, and (C) trigeminal ganglion (TG). mRNA levels are expressed as relative quantification (RQ). Data are expressed as mean ± SEM; one-way ANOVA followed by Tukey’s multiple comparisons test. *** p < 0.001 vs. control (CT) and olcegepant 2 mg; °°° p < 0.001 vs. nitroglycerin (NTG); # p < 0.05 vs. CT.
Cells 11 03092 g008
Cells 11 03092 g009 550
Figure 9. Potential interaction of CGRP with other pain/inflammatory mediators relevant for neuronal sensitization in an animal model of chronic migraine. Nitroglycerin (NTG), by releasing nitric oxide (NO), may induce an inflammatory response within the dura mater and the trigeminal ganglion (TG), potentiated by CGRP release, with an increase in pro-inflammatory cytokines interleukin (IL)-1beta and tumor necrosis factor alpha (TNF-alpha) levels by nuclear factor kappa B (NF-κB) activation [62,63]. In addition, NTG may activate transient receptor potential ankyrin 1 channels (TRPA1) receptors contributing to a further release of CGRP. This response may induce an upregulation of miRNAs, not only at the peripheral level but indirectly at the central level.
Figure 9. Potential interaction of CGRP with other pain/inflammatory mediators relevant for neuronal sensitization in an animal model of chronic migraine. Nitroglycerin (NTG), by releasing nitric oxide (NO), may induce an inflammatory response within the dura mater and the trigeminal ganglion (TG), potentiated by CGRP release, with an increase in pro-inflammatory cytokines interleukin (IL)-1beta and tumor necrosis factor alpha (TNF-alpha) levels by nuclear factor kappa B (NF-κB) activation [62,63]. In addition, NTG may activate transient receptor potential ankyrin 1 channels (TRPA1) receptors contributing to a further release of CGRP. This response may induce an upregulation of miRNAs, not only at the peripheral level but indirectly at the central level.
Cells 11 03092 g009
Table
Table 1. Experimental groups.
Table 1. Experimental groups.
Experimental GroupsI SET: OFT (n)II SET: rt-PCR; ELISA (n)
Acute
migraine model		CT (NTG vehicle + olcegepant vehicle)8-
NTG (NTG 10 mg/kg + olcegepant vehicle)9-
NTG + olcegepant 1 mg (NTG 10 mg/kg + olcegepant 1 mg/kg)6-
olcegepant 1 mg (NTG vehicle + olcegepant 1 mg/kg)6-
NTG + olcegepant 2 mg (NTG 10 mg/kg + olcegepant 2 mg/kg)6-
olcegepant 2 mg (NTG vehicle + olcegepant 2 mg/kg)6-
Chronic
migraine model		CT (NTG vehicle + olcegepant vehicle)66
NTG (NTG 5 mg/kg + olcegepant vehicle)66
NTG + olcegepant 2 mg (NTG 5 mg/kg + olcegepant 2 mg/kg) 66
olcegepant 2 mg (NTG vehicle + olcegepant 2 mg/kg)66
CT: control; ELISA: enzyme-linked immunosorbent assay; n: number of animals per group; NTG: nitroglycerin; OFT: orofacial formalin test; rt-PCR: real time polymerase chain reaction.
Table
Table 2. Primer sequences used in rt-PCR analysis.
Table 2. Primer sequences used in rt-PCR analysis.
GeneForward PrimerReverse Primer
GAPDHAACCTGCCAAGTATGATGACGGAGTTGCTGTTGAAGTCA
TNF-alphaCCTCACACTCAGATCATCTTCTCCGCTTGGTGGTTTGCTAC
IL-1betaTCTTCCTTGTGCAAGTGTCTGCAGGTCATTCTCCTCACTGTC
Calca (α-CGRP)CAGTCTCAGCTCCAAGTCATCTTCCAAGGTTGACCTCAAAG
TRPA1CTCCCCGAGTGCATGAAAGTTGCATATACGCGGGGATGTC
U6TGCGGGTGCTCGCTTCGGCAGCCCAGTGCAGGGTCCGAGGT
miR-155-5pTTGAATTCTAACACCTTCGTGGCTACAGAGTTAGATCTCATTTATCGAGGGAAGGATTG
miR-382-5pGGCTGTGAGTAATTCTTTGGCAGGGCAGTATACTTGCTGATTGCT
miR-34a-5pGCAGTGTCTTAGCTGGTTGTTGTGCAGCACTTCTAGGGCAGT
GAPDH: glyceraldehyde 3-phosphate dehydrogenase; TNF-alpha: tumor necrosis factor alpha; IL-1beta: interleukin 1beta; Calca: calcitonin related polypeptide alpha; TRPA1: transient receptor potential ankyrin 1 channels.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Greco, R.; Demartini, C.; Francavilla, M.; Zanaboni, A.M.; Tassorelli, C. Antagonism of CGRP Receptor: Central and Peripheral Mechanisms and Mediators in an Animal Model of Chronic Migraine. Cells 2022, 11, 3092. https://doi.org/10.3390/cells11193092

AMA Style

Greco R, Demartini C, Francavilla M, Zanaboni AM, Tassorelli C. Antagonism of CGRP Receptor: Central and Peripheral Mechanisms and Mediators in an Animal Model of Chronic Migraine. Cells. 2022; 11(19):3092. https://doi.org/10.3390/cells11193092

Chicago/Turabian Style

Greco, Rosaria, Chiara Demartini, Miriam Francavilla, Anna Maria Zanaboni, and Cristina Tassorelli. 2022. "Antagonism of CGRP Receptor: Central and Peripheral Mechanisms and Mediators in an Animal Model of Chronic Migraine" Cells 11, no. 19: 3092. https://doi.org/10.3390/cells11193092

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop