Aging-Associated Changes in Cognition, Expression and Epigenetic Regulation of Chondroitin 6-Sulfotransferase Chst3
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Experimental Design
2.3. Behavioral Analysis
2.4. Open Field
2.5. Novel Object Location Test
2.6. Novel Object Recognition Task
2.7. Tissue Isolation
2.8. RNA Extraction, cDNA Conversion, and QPCR
2.9. FACS Sorting for Neuronal and Glial Nuclei Extraction
2.10. Chromatin Immunoprecipitation and qPCR
2.11. cDNA Preparation from Sorted Nuclear RNA and qPCR
2.12. CHST3 Antibody Validation
2.13. Immunohistochemistry
2.14. Data Acquisition, Processing, and Analysis
2.15. Statistical Analysis
3. Results
3.1. Expression of CSPGs Core Proteins and Enzymes Regulating Synthesis and Sulfation of GAG Chains in the Hippocampus of >30 M-Old Mice and 22-24 M-Old Mice
3.2. Relationships between the Expression of ECM-Related Genes in Three Studied Aged Groups
3.3. Cognitive Functions Are Impaired in >30 M and 22-24 M-Old Mice
3.4. Relationships between the Expression of ECM-Related Genes and Cognitive Performance
3.5. Age-dependent Epigenetic Changes of the Chst3 Promoter in Non-Neuronal Cells
3.6. Age-Dependent Changes in the Expression and Function of CHST3 Protein
3.7. Cross-Species and Cross-Tissue Analysis of Chst3 Expression
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Burke, S.N.; Barnes, C.A. Neural plasticity in the ageing brain. Nat. Rev. Neurosci. 2006, 7, 30–40. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sengpiel, F. The critical period. Curr. Biol. 2007, 17, R742–R743. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Galván, A. Neural plasticity of development and learning. Hum. Brain Mapp. 2010, 31, 879–890. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Attardo, A.; Lu, J.; Kawashima, T.; Okuno, H.; Fitzgerald, J.E.; Bito, H.; Schnitzer, M.J. Long-Term Consolidation of Ensemble Neural Plasticity Patterns in Hippocampal Area CA1. Cell Rep. 2018, 25, 640–650.e2. [Google Scholar] [CrossRef] [Scilit]
- Ribic, A.; Crair, M.C.; Biederer, T. Synapse-Selective Control of Cortical Maturation and Plasticity by Parvalbumin-Autonomous Action of SynCAM 1. Cell Rep. 2019, 26, 381–393.e6. [Google Scholar] [CrossRef] [Scilit]
- Dityatev, A.; Fellin, T. Extracellular matrix in plasticity and epileptogenesis. Neuron Glia Biol. 2008, 4, 235–247. [Google Scholar] [CrossRef] [Scilit]
- Vegh, M.J.; Rausell, A.; Loos, M.; Heldring, C.M.; Jurkowski, W.; van Nierop, P.; Paliukhovich, I.; Li, K.W.; del Sol, A.; Smit, A.B.; et al. Hippocampal extracellular matrix levels and stochasticity in synaptic protein expression increase with age and are associated with age-dependent cognitive decline. Mol. Cell. Proteom. 2014, 13, 2975–2985. [Google Scholar] [CrossRef] [Scilit]
- Dityatev, A.; Schachner, M. Extracellular matrix molecules and synaptic plasticity. Nat. Rev. Neurosci. 2003, 4, 456–468. [Google Scholar] [CrossRef] [Scilit]
- Dityatev, A.; Brückner, G.; Dityateva, G.; Grosche, J.; Kleene, R.; Schachner, M. Activity-dependent formation and functions of chondroitin sulfate-rich extracellular matrix of perineuronal nets. Dev. Neurobiol. 2007, 67, 570–588. [Google Scholar] [CrossRef] [Scilit]
- Miyata, S.; Komatsu, Y.; Yoshimura, Y.; Taya, C.; Kitagawa, H. Persistent cortical plasticity by upregulation of chondroitin 6-sulfation. Nat. Neurosci. 2012, 15, 414–422. [Google Scholar] [CrossRef] [Scilit]
- Carulli, D.; Kwok, J.C.; Pizzorusso, T. Perineuronal Nets and CNS Plasticity and Repair. Neural Plast. 2016, 2016, 4327082. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Richard, A.D.; Lu, X.H. “Teaching old dogs new tricks”: Targeting neural extracellular matrix for normal and pathological aging-related cognitive decline. Neural Regen. Res. 2019, 14, 578–581. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Weigel, P.H. Hyaluronan Synthase: The Mechanism of Initiation at the Reducing End and a Pendulum Model for Polysaccharide Translocation to the Cell Exterior. Int. J. Cell Biol. 2015, 2015, 367579. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mikami, T.; Kitagawa, H. Biosynthesis and function of chondroitin sulfate. Biochim. Et Biophys. Acta (BBA)—Gen. Subj. 2013, 1830, 4719–4733. [Google Scholar] [CrossRef] [Scilit]
- Miyata, S.; Kitagawa, H. Formation and remodeling of the brain extracellular matrix in neural plasticity: Roles of chondroitin sulfate and hyaluronan. Biochim. Biophys. Acta Gen. Subj. 2017, 1861, 2420–2434. [Google Scholar] [CrossRef] [Scilit]
- Sugahara, K.; Mikami, T.; Uyama, T.; Mizuguchi, S.; Nomura, K.; Kitagawa, H. Recent advances in the structural biology of chondroitin sulfate and dermatan sulfate. Curr. Opin. Struct. Biol. 2003, 13, 612–620. [Google Scholar] [CrossRef] [Scilit]
- Uyama, T.; Ishida, M.; Izumikawa, T.; Trybala, E.; Tufaro, F.; Bergström, T.; Sugahara, K.; Kitagawa, H. Chondroitin 4-O-Sulfotransferase-1 Regulates E Disaccharide Expression of Chondroitin Sulfate Required for Herpes Simplex Virus Infectivity. J. Biol. Chem. 2006, 281, 38668–38674. [Google Scholar] [CrossRef] [Scilit]
- Prinz, R.D.; Willis, C.M.; van Kuppevelt, T.H.; Klüppel, M. Biphasic Role of Chondroitin Sulfate in Cardiac Differentiation of Embryonic Stem Cells through Inhibition of Wnt/β-Catenin Signaling. PLoS ONE 2014, 9, e92381. [Google Scholar] [CrossRef] [Scilit]
- Thiele, H.; Sakano, M.; Kitagawa, H.; Sugahara, K.; Rajab, A.; Höhne, W.; Ritter, H.; Leschik, G.; Nürnberg, P.; Mundlos, S. Loss of chondroitin 6-O-sulfotransferase-1 function results in severe human chondrodysplasia with progressive spinal involvement. Proc. Natl. Acad. Sci. USA 2004, 101, 10155–10160. [Google Scholar] [CrossRef] [Scilit]
- Srivastava, P.; Pandey, H.; Agarwal, D.; Mandal, K.; Phadke, S.R. Spondyloepiphyseal dysplasia Omani type: CHST3 mutation spectrum and phenotypes in three Indian families. Am. J. Med. Genet. Part A 2017, 173, 163–168. [Google Scholar] [CrossRef] [Scilit]
- Hermanns, P.; Unger, S.; Rossi, A.; Perez-Aytes, A.; Cortina, H.; Bonafé, L.; Boccone, L.; Setzu, V.; Dutoit, M.; Sangiorgi, L.; et al. Congenital Joint Dislocations Caused by Carbohydrate Sulfotransferase 3 Deficiency in Recessive Larsen Syndrome and Humero-Spinal Dysostosis. Am. J. Hum. Genet. 2008, 82, 1368–1374. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Song, Y.-Q.; Karasugi, T.; Cheung, K.M.C.; Chiba, K.; Ho, D.W.H.; Miyake, A.; Kao, P.Y.P.; Sze, K.L.; Yee, A.; Takahashi, A.; et al. Lumbar disc degeneration is linked to a carbohydrate sulfotransferase 3 variant. J. Clin. Investig. 2013, 123, 4909–4917. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Deyo, R.A.; Weinstein, J.N. Low back pain. N. Engl. J. Med. 2001, 344, 363–370. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Smith-Thomas, L.C.; Stevens, J.; Fok-Seang, J.; Faissner, A.; Rogers, J.H.; Fawcett, J.W. Increased axon regeneration in astrocytes grown in the presence of proteoglycan synthesis inhibitors. J. Cell Sci. 1995, 108 Pt 3, 1307–1315. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.; Katagiri, Y.; McCann, T.E.; Unsworth, E.; Goldsmith, P.; Yu, Z.-X.; Tan, F.; Santiago, L.; Mills, E.M.; Wang, Y.; et al. Chondroitin-4-sulfation negatively regulates axonal guidance and growth. J. Cell Sci. 2008, 121, 3083–3091. [Google Scholar] [CrossRef] [Scilit]
- Carulli, D.; Pizzorusso, T.; Kwok, J.C.F.; Putignano, E.; Poli, A.; Forostyak, S.; Andrews, M.R.; Deepa, S.S.; Glant, T.T.; Fawcett, J.W. Animals lacking link protein have attenuated perineuronal nets and persistent plasticity. Brain 2010, 133, 2331–2347. [Google Scholar] [CrossRef] [Scilit]
- Foscarin, S.; Raha-Chowdhury, R.; Fawcett, J.W.; Kwok, J.C.F. Brain ageing changes proteoglycan sulfation, rendering perineuronal nets more inhibitory. Aging 2017, 9, 1607–1622. [Google Scholar] [CrossRef] [Scilit]
- Godbout, J.P.; Chen, J.; Abraham, J.; Richwine, A.F.; Berg, B.M.; Kelley, K.W.; Johnson, R.W. Exaggerated neuroinflammation and sickness behavior in aged mice following activation of the peripheral innate immune system. FASEB J. 2005, 19, 1329–1331. [Google Scholar] [CrossRef] [Scilit]
- Lynch, M.A. Age-related neuroinflammatory changes negatively impact on neuronal function. Front. Aging Neurosci. 2010, 1, 6. [Google Scholar] [CrossRef] [Scilit]
- Pluvinage, J.V.; Haney, M.S.; Smith, B.A.H.; Sun, J.; Iram, T.; Bonanno, L.; Li, L.; Lee, D.P.; Morgens, D.W.; Yang, A.C.; et al. CD22 blockade restores homeostatic microglial phagocytosis in ageing brains. Nature 2019, 568, 187–192. [Google Scholar] [CrossRef] [Scilit]
- George, N.; Geller, H.M. Extracellular matrix and traumatic brain injury. J. Neurosci. Res. 2018, 96, 573–588. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lyons, A.; Lynch, A.M.; Downer, E.J.; Hanley, R.; O’Sullivan, J.B.; Smith, A.; Lynch, M.A. Fractalkine-induced activation of the phosphatidylinositol-3 kinase pathway attentuates microglial activation in vivo and in vitro. J. Neurochem. 2009, 110, 1547–1556. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ito, D.; Tanaka, K.; Suzuki, S.; Dembo, T.; Fukuuchi, Y. Enhanced expression of Iba1, ionized calcium-binding adapter molecule 1, after transient focal cerebral ischemia in rat brain. Stroke 2001, 32, 1208–1215. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Beggah, A.T.; Dours-Zimmermann, M.T.; Barras, F.M.; Brosius, A.; Zimmermann, D.R.; Zurn, A.D. Lesion-induced differential expression and cell association of Neurocan, Brevican, Versican V1 and V2 in the mouse dorsal root entry zone. Neuroscience 2005, 133, 749–762. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cregg, J.M.; DePaul, M.A.; Filous, A.R.; Lang, B.T.; Tran, A.; Silver, J. Functional regeneration beyond the glial scar. Exp. Neurol. 2014, 253, 197–207. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fawcett, J.W.; Asher, R.A. The glial scar and central nervous system repair. Brain Res. Bull. 1999, 49, 377–391. [Google Scholar] [CrossRef] [Scilit]
- Holter, S.M.; Einicke, J.; Sperling, B.; Zimprich, A.; Garrett, L.; Fuchs, H.; Gailus-Durner, V.; Hrabe de Angelis, M.; Wurst, W. Tests for Anxiety-Related Behavior in Mice. Curr. Protoc. Mouse Biol. 2015, 5, 291–309. [Google Scholar] [CrossRef] [Scilit]
- Kaushik, R.; Morkovin, E.; Schneeberg, J.; Confettura, A.D.; Kreutz, M.R.; Senkov, O.; Dityatev, A. Traditional Japanese Herbal Medicine Yokukansan Targets Distinct but Overlapping Mechanisms in Aged Mice and in the 5xFAD Mouse Model of Alzheimer’s Disease. Front. Aging Neurosci. 2018, 10, 411. [Google Scholar] [CrossRef] [Scilit]
- Vogel, C.; Marcotte, E.M. Insights into the regulation of protein abundance from proteomic and transcriptomic analyses. Nat. Rev. Genet. 2012, 13, 227–232. [Google Scholar] [CrossRef] [Scilit]
- Antunes, M.; Biala, G. The novel object recognition memory: Neurobiology, test procedure, and its modifications. Cogn. Process. 2012, 13, 93–110. [Google Scholar] [CrossRef] [Scilit]
- Ventura Ferreira, M.S.; Bienert, M.; Müller, K.; Rath, B.; Goecke, T.; Opländer, C.; Braunschweig, T.; Mela, P.; Brümmendorf, T.H.; Beier, F.; et al. Comprehensive characterization of chorionic villi-derived mesenchymal stromal cells from human placenta. Front. Aging Neurosci. 2018, 10, 411. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Meldgaard, M.; Fenger, C.; Lambertsen, K.L.; Pedersen, M.D.; Ladeby, R.; Finsen, B. Validation of two reference genes for mRNA level studies of murine disease models in neurobiology. J. Neurosci. Methods 2006, 156, 101–110. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Halder, R.; Hennion, M.; Vidal, R.O.; Shomroni, O.; Rahman, R.U.; Rajput, A.; Centeno, T.P.; van Bebber, F.; Capece, V.; Garcia Vizcaino, J.C.; et al. DNA methylation changes in plasticity genes accompany the formation and maintenance of memory. Nat. Neurosci. 2016, 19, 102–110. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Penna, I.; Vella, S.; Gigoni, A.; Russo, C.; Cancedda, R.; Pagano, A. Selection of candidate housekeeping genes for normalization in human postmortem brain samples. Int. J. Mol. Sci. 2011, 12, 5461–5470. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dityatev, A.; Dityateva, G.; Sytnyk, V.; Delling, M.; Toni, N.; Nikonenko, I.; Muller, D.; Schachner, M. Polysialylated neural cell adhesion molecule promotes remodeling and formation of hippocampal synapses. J. Neurosci. 2004, 24, 9372–9382. [Google Scholar] [CrossRef] [Scilit]
- Minge, D.; Senkov, O.; Kaushik, R.; Herde, M.K.; Tikhobrazova, O.; Wulff, A.B.; Mironov, A.; van Kuppevelt, T.H.; Oosterhof, A.; Kochlamazashvili, G.; et al. Heparan Sulfates Support Pyramidal Cell Excitability, Synaptic Plasticity, and Context Discrimination. Cereb. Cortex. 2017, 27, 903–918. [Google Scholar] [CrossRef] [Scilit]
- Strackeljan, L.; Baczynska, E.; Cangalaya, C.; Baidoe-Ansah, D.; Wlodarczyk, J.; Kaushik, R.; Dityatev, A. Microglia Depletion-Induced Remodeling of Extracellular Matrix and Excitatory Synapses in the Hippocampus of Adult Mice. Cells 2021, 10, 1862. [Google Scholar] [CrossRef] [Scilit]
- Kang, H.J.; Kawasawa, Y.I.; Cheng, F.; Zhu, Y.; Xu, X.; Li, M.; Sousa, A.M.M.; Pletikos, M.; Meyer, K.A.; Sedmak, G.; et al. Spatiotemporal transcriptome of the human brain. Nature 2011, 478, 483–489. [Google Scholar] [CrossRef] [Scilit]
- Tabula Muris Consortium; Overall Coordination; Logistical Coordination; Organ Collection and Processing; Library Preparation and Sequencing; Computational Data Analysis; Cell Type Annotation; Writing Group; Supplemental Text Writing Group. Principal investigators: Single-cell transcriptomics of 20 mouse organs creates a Tabula Muris. Nature 2018, 562, 367–372. [Google Scholar] [CrossRef] [Scilit]
- Koskinen, M.-K.; van Mourik, Y.; Smit, A.B.; Riga, D.; Spijker, S. From stress to depression: Development of extracellular matrix-dependent cognitive impairment following social stress. Sci Rep. 2020, 10, 17308. [Google Scholar] [CrossRef] [Scilit]
- Sochocka, M.; Diniz, B.S.; Leszek, J. Inflammatory Response in the CNS: Friend or Foe? Mol. Neurobiol. 2017, 54, 8071–8089. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bonnans, C.; Chou, J.; Werb, Z. Remodelling the extracellular matrix in development and disease. Nat. Rev. Mol. Cell Biol. 2014, 15, 786–801. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cruz, C.; Della Rosa, M.; Krueger, C.; Gao, Q.; Horkai, D.; King, M.; Field, L.; Houseley, J. Tri-methylation of histone H3 lysine 4 facilitates gene expression in ageing cells. Elife 2018, 7, 34081. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kerimoglu, C.; Sakib, M.S.; Jain, G.; Benito, E.; Burkhardt, S.; Capece, V.; Kaurani, L.; Halder, R.; Agís-Balboa, R.C.; Stilling, R.; et al. KMT2A and KMT2B Mediate Memory Function by Affecting Distinct Genomic Regions. Cell Rep. 2017, 20, 538–548. [Google Scholar] [CrossRef] [Scilit]
- Mei, Q.; Xu, C.; Gogol, M.; Tang, J.; Chen, W.; Yu, X.; Workman, J.L.; Li, S. Set1-catalyzed H3K4 trimethylation antagonizes the HIR/Asf1/Rtt106 repressor complex to promote histone gene expression and chronological life span. Nucleic Acids Res. 2019, 47, 3434–3449. [Google Scholar] [CrossRef] [Scilit]
- Pu, X.; Xiao, Q.; Kiechl, S.; Chan, K.; Ng, F.L.; Gor, S.; Poston, R.N.; Fang, C.; Patel, A.; Senver, E.C.; et al. ADAMTS7 cleavage and vascular smooth muscle cell migration is affected by a coronary-artery-disease-associated variant. Am. J. Hum. Genet. 2013, 92, 366–374. [Google Scholar] [CrossRef] [Scilit]
- Howe, F.S.; Fischl, H.; Murray, S.C.; Mellor, J. Is H3K4me3 instructive for transcription activation? Bioessays 2017, 39, 1521–1878. [Google Scholar] [CrossRef] [Scilit]
- Santos-Rosa, H.; Schneider, R.; Bannister, A.J.; Sherriff, J.; Bernstein, B.E.; Emre, N.C.; Schreiber, S.L.; Mellor, J.; Kouzarides, T. Active genes are tri-methylated at K4 of histone H3. Nature 2002, 419, 407–411. [Google Scholar] [CrossRef] [Scilit]
- Chelini, G.; Durning, P.; O’Donovan, S.; Klengel, T.; Balasco, L.; Berciu, C.; Boyer-Boiteau, A.; Bozzi, Y.; McCullumsmith, R.; Ressler, K.J.; et al. Proteoglycan Clusters as a Site of Coordinated, Multi-Dendritic Plasticity. 2021. Available online: https://www.biorxiv.org/content/10.1101/2021.10.04.462691v1 (accessed on 10 October 2021).
- Yang, S.; Gigout, S.; Molinaro, A.; Naito-Matsui, Y.; Hilton, S.; Foscarin, S.; Nieuwenhuis, B.; Tan, C.L.; Verhaagen, J.; Pizzorusso, T.; et al. Chondroitin 6-sulphate is required for neuroplasticity and memory in ageing. Mol. Psychiatry 2021, 26, 5658–5668. [Google Scholar] [CrossRef] [Scilit]
- Williams, M.E.; de Wit, J.; Ghosh, A. Molecular Mechanisms of Synaptic Specificity in Developing Neural Circuits. Neuron 2010, 68, 9–18. [Google Scholar] [CrossRef] [Scilit]
- Urbán, N.; Guillemot, F. Neurogenesis in the embryonic and adult brain: Same regulators, different roles. Front. Cell Neurosci. 2014, 8, 396. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mencio, C.P.; Hussein, R.K.; Yu, P.; Geller, H.M. The Role of Chondroitin Sulfate Proteoglycans in Nervous System Development. J. Histochem. Cytochem. 2021, 69, 61–80. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Young, N.M.; Williams, R.E. Assignment of lectins specific for D-galactose or N-acetyl-D-galactosamine to two groups, based on their circular dichroism. Can. J. Biochem. Cell Biol. 1985, 63, 268–271. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ajmo, J.M.; Eakin, A.K.; Hamel, M.G.; Gottschall, P.E. Discordant localization of WFA reactivity and brevican/ADAMTS-derived fragment in rodent brain. BMC Neurosci. 2008, 9, 14. [Google Scholar] [CrossRef] [Scilit]
- Miyata, S.; Nadanaka, S.; Igarashi, M.; Kitagawa, H. Structural Variation of Chondroitin Sulfate Chains Contributes to the Molecular Heterogeneity of Perineuronal Nets. Front. Integr. Neurosci. 2018, 12, 3. [Google Scholar] [CrossRef] [Scilit]
- Slaker, M.L.; Harkness, J.H.; Sorg, B.A. A standardized and automated method of perineuronal net analysis using Wisteria floribunda agglutinin staining intensity. IBRO Rep. 2016, 1, 54–60. [Google Scholar] [CrossRef] [Scilit]
- Miyata, S.; Kitagawa, H. Chondroitin 6-Sulfation Regulates Perineuronal Net Formation by Controlling the Stability of Aggrecan. Neural Plast. 2016, 2016, e1305801. [Google Scholar] [CrossRef] [Scilit]
- Bowman, K.G.; Bertozzi, C.R. Carbohydrate sulfotransferases: Mediators of extracellular communication. Chem. Biol. 1999, 6, R9–R22. [Google Scholar] [CrossRef] [Scilit]
- Li, X.; Tu, L.; Murphy, P.G.; Kadono, T.; Steeber, D.A.; Tedder, T.F. CHST1 and CHST2 sulfotransferase expression by vascular endothelial cells regulates shear-resistant leukocyte rolling via L-selectin. J. Leukoc. Biol. 2001, 69, 565–574. [Google Scholar]
- Pudelko, A.; Wisowski, G.; Olczyk, K.; Kozma, E.M. The dual role of the glycosaminoglycan chondroitin-6-sulfate in the development, progression and metastasis of cancer. FEBS J. 2019, 286, 1815–1837. [Google Scholar] [CrossRef] [Scilit]
- Widagdo, J.; Anggono, V. The m6A-epitranscriptomic signature in neurobiology: From neurodevelopment to brain plasticity. J. Neurochem. 2018, 147, 137–152. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shafik, A.M.; Zhang, F.; Guo, Z.; Dai, Q.; Pajdzik, K.; Li, Y.; Kang, Y.; Yao, B.; Wu, H.; He, C.; et al. N6-methyladenosine dynamics in neurodevelopment and aging, and its potential role in Alzheimer’s disease. Genome Biol. 2021, 22, 17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fawcett, J.W.; Oohashi, T.; Pizzorusso, T. The roles of perineuronal nets and the perinodal extracellular matrix in neuronal function. Nat. Rev. Neurosci. 2019, 20, 451–465. [Google Scholar] [CrossRef] [Scilit]
- Dzyubenko, E.; Gottschling, C.; Faissner, A. Neuron-Glia Interactions in Neural Plasticity: Contributions of Neural Extracellular Matrix and Perineuronal Nets. Neural Plast. 2016, 2016, 5214961. [Google Scholar] [CrossRef] [Scilit]
- Song, I.; Dityatev, A. Crosstalk between glia, extracellular matrix and neurons. Brain Res. Bull. 2018, 136, 101–108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bonneh-Barkay, D.; Wiley, C.A. Brain Extracellular Matrix in Neurodegeneration. Brain Pathol. 2009, 19, 573–585. [Google Scholar] [CrossRef] [Scilit]
- Clarke, L.E.; Liddelow, S.A.; Chakraborty, C.; Munch, A.E.; Heiman, M.; Barres, B.A. Normal aging induces A1-like astrocyte reactivity. Proc. Natl. Acad. Sci. USA 2018, 115, E1896–E1905. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bok, E.; Jo, M.; Lee, S.; Lee, B.R.; Kim, J.; Kim, H.J. Dietary Restriction and Neuroinflammation: A Potential Mechanistic Link. Int. J. Mol. Sci. 2019, 20, 464. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cahoy, J.D.; Emery, B.; Kaushal, A.; Foo, L.C.; Zamanian, J.L.; Christopherson, K.S.; Xing, Y.; Lubischer, J.L.; Krieg, P.A.; Krupenko, S.A.; et al. A transcriptome database for astrocytes, neurons, and oligodendrocytes: A new resource for understanding brain development and function. J. Neurosci. 2008, 28, 264–278. [Google Scholar] [CrossRef] [Scilit]
- Sun, W.; Cornwell, A.; Li, J.; Peng, S.; Osorio, M.J.; Aalling, N.; Wang, S.; Benraiss, A.; Lou, N.; Goldman, S.A.; et al. SOX9 Is an Astrocyte-Specific Nuclear Marker in the Adult Brain Outside the Neurogenic Regions. J. Neurosci. 2017, 37, 4493–4507. [Google Scholar] [CrossRef] [Scilit]
- Pan, H.; Xue, W.; Zhao, W.; Schachner, M. Expression and function of chondroitin 4-sulfate and chondroitin 6-sulfate in human glioma. FASEB J. 2020, 34, 2853–2868. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kai, Y.; Tomoda, K.; Yoneyama, H.; Yoshikawa, M.; Kimura, H. RNA interference targeting carbohydrate sulfotransferase 3 diminishes macrophage accumulation, inhibits MMP-9 expression and promotes lung recovery in murine pulmonary emphysema. Respir. Res. 2015, 16, 146. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| Gene | Full Description | Dye | Reference Sequence |
|---|---|---|---|
| Acan | Mouse_Aggrecan_Mm00545794_m1 | FAM | NM_007424.2 |
| Vcan | Mouse_Versican_Mm01283063_m1 | FAM | NM_001081249.1 |
| Ncan | Mouse_Neurocan_Mm00484007_m1 | FAM | NM_007789.3 |
| Bcan | Mouse_Brevican_Mm00476090_m1 | FAM | NM_001109758.1 |
| Pcan | Mouse_PTPRZ1_Phosphacan_Mm00478484_m1 | FAM | NM_001081306.1 |
| Hapln1 | Mouse_HAPLN1_Mm00488952_m1 | FAM | NM_013500.4 |
| TnR | Mouse_TenascinR_Mm00659075_m1 | FAM | NM_022312.3 |
| Has2 | Mouse_Hyaluronan Synthase 2 _Mm00515089_m1 | FAM | NM_008216.3 |
| Chsy1 | Mouse_Chondroitin sulfate synthase 1_ Mm01319178_m1 | FAM | NM_001081163.1 |
| Chsy3 | Mouse_ Chondroitin sulfate synthase 3_ Mm01545329_m1 | FAM | NM_001081328.1 |
| Chpf2 | Mouse_Chondroitin polymerizing factor 2_Mm00659795_m1 | FAM | NM_133913.2 |
| Chst3 | Mouse_Chst3_Mm00489736_m1 | FAM | NM_016803.3 |
| Chst7 | Mouse_Chst7_Mm00491466_m1 | FAM | NM_021715.1 |
| Chst11 | Mouse_Chst11_Mm00517562_m1 | FAM | NM_021439.2 |
| Chst13 | Mouse_Chst13_Mm01186255_s1 | FAM | NM_027928.1 |
| Aldh1l1 | Aldehyde Dehydrogenase 1 Family, Member L1_Mm03048957_m1 | FAM | NM_027406.1 |
| Gfap | Glial Fibrillary Acidic Protein _Mm01253033_m1 | FAM | NM_001131020.1 |
| Iba1 | Allograft Inflammatory Factor 1_Iba1_Mm00479862_g1 | FAM | NM_019467.2 |
| Il6 | Interleukin 6_IL6_Mm00446190_m1 | FAM | NM_031168.1 |
| Tnf | TNF-Alpha_Mm00443258_m1 | FAM | NM_001278601.1 |
| Gapdh | Mouse_GAPDH_Mm99999915_g1 | FAM | NM_001289726.1 |
| Gene | Species | Reference Sequence | Sequence (5′ to 3′) | |
|---|---|---|---|---|
| Chst3 | Mus musculus | NM_007424.2 | Fw | CCACAGCAGCCAGATCTTC |
| Rv | TGGGGGACACTCTGATCCT | |||
| Top1 | Mus musculus | NM_009408.2 | Fw | TGCCTCCATCACACTACAGC |
| Rv | CGCTGGTACATTCTCATCAGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Baidoe-Ansah, D.; Sakib, S.; Jia, S.; Mirzapourdelavar, H.; Strackeljan, L.; Fischer, A.; Aleshin, S.; Kaushik, R.; Dityatev, A. Aging-Associated Changes in Cognition, Expression and Epigenetic Regulation of Chondroitin 6-Sulfotransferase Chst3. Cells 2022, 11, 2033. https://doi.org/10.3390/cells11132033
Baidoe-Ansah D, Sakib S, Jia S, Mirzapourdelavar H, Strackeljan L, Fischer A, Aleshin S, Kaushik R, Dityatev A. Aging-Associated Changes in Cognition, Expression and Epigenetic Regulation of Chondroitin 6-Sulfotransferase Chst3. Cells. 2022; 11(13):2033. https://doi.org/10.3390/cells11132033
Chicago/Turabian StyleBaidoe-Ansah, David, Sadman Sakib, Shaobo Jia, Hadi Mirzapourdelavar, Luisa Strackeljan, Andre Fischer, Stepan Aleshin, Rahul Kaushik, and Alexander Dityatev. 2022. "Aging-Associated Changes in Cognition, Expression and Epigenetic Regulation of Chondroitin 6-Sulfotransferase Chst3" Cells 11, no. 13: 2033. https://doi.org/10.3390/cells11132033
APA StyleBaidoe-Ansah, D., Sakib, S., Jia, S., Mirzapourdelavar, H., Strackeljan, L., Fischer, A., Aleshin, S., Kaushik, R., & Dityatev, A. (2022). Aging-Associated Changes in Cognition, Expression and Epigenetic Regulation of Chondroitin 6-Sulfotransferase Chst3. Cells, 11(13), 2033. https://doi.org/10.3390/cells11132033

