Brassinin Inhibits Proliferation in Human Liver Cancer Cells via Mitochondrial Dysfunction
Abstract
:1. Introduction
2. Materials and Methods
2.1. Chemicals and Antibodies
2.2. Cell Maintenance of Huh7 and Hep3B
2.3. Cell Proliferation Assay
2.4. Immunofluorescence Microscopy Analysis
2.5. Detection of Cell Cycle Arrest
2.6. Detection of Intramitochondrial Intracellular Calcium Level
2.7. Detection of Depolarization of the Mitochondrial Membrane
2.8. Measurement of Cellular ROS
2.9. Immunoblotting
2.10. Quantitative Real-Time PCR
2.11. Statistical Analysis
3. Results
3.1. Brassinin Regulates Proliferation and Cell Cycle in HCC Cells
3.2. Brassinin Hampers Mitochondrial Homeostasis in Huh7 and Hep3B Cells
3.3. ROS Generation is Induced by Brassinin in Huh7 and Hep3B Cells
3.4. Brassinin Regulates PI3K and MAPK Signaling Pathway in HCC Cell Lines
3.5. Effects of MAPKs Pharmacological Inhibitors on the Proliferation of HCC Cells with or without Brassinin
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Kim, E.; Viatour, P. Hepatocellular carcinoma: Old friends and new tricks. Exp. Mol. Med. 2020, 52, 1898–1907. [Google Scholar] [CrossRef]
- Xue, K.X. Molecular genetic and epigenetic mechanisms of hepatocarcinogenesis. Ai Zheng 2005, 24, 757–768. [Google Scholar]
- Ding, B.; Lou, W.; Xu, L.; Fan, W. Non-coding RNA in drug resistance of hepatocellular carcinoma. Biosci. Rep. 2018, 38. [Google Scholar] [CrossRef]
- Lin, S.R.; Chang, C.H.; Hsu, C.F.; Tsai, M.J.; Cheng, H.; Leong, M.K.; Sung, P.J.; Chen, J.C.; Weng, C.F. Natural compounds as potential adjuvants to cancer therapy: Preclinical evidence. Br. J. Pharmacol. 2020, 177, 1409–1423. [Google Scholar] [CrossRef] [Green Version]
- Zhang, R.; Chen, Z.; Wu, S.S.; Xu, J.; Kong, L.C.; Wei, P. Celastrol Enhances the Anti-Liver Cancer Activity of Sorafenib. Med. Sci. Monit. 2019, 25, 4068–4075. [Google Scholar] [CrossRef] [PubMed]
- Chripkova, M.; Zigo, F.; Mojzis, J. Antiproliferative effect of indole phytoalexins. Molecules 2016, 21, 1626. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pilatova, M.; Ivanova, L.; Kutschy, P.; Varinska, L.; Saxunova, L.; Repovska, M.; Sarissky, M.; Seliga, R.; Mirossay, L.; Mojzis, J. In vitro toxicity of camalexin derivatives in human cancer and non-cancer cells. Toxicol. Vitro 2013, 27, 939–944. [Google Scholar] [CrossRef] [PubMed]
- Sohn, E.-H.; Koo, H.J.; Hang, D.T.T.; Jang, S.-A.; Namkoong, S.; Lim, J.D.; Kang, S.C. Protective effects of ellagic acid on ethanol-induced toxicity in hepatic HepG2 cells. Mol. Cell Toxicol. 2013, 9, 249–256. [Google Scholar] [CrossRef]
- Hu, Y.; Wang, S.; Wu, X.; Zhang, J.; Chen, R.; Chen, M.; Wang, Y. Chinese herbal medicine-derived compounds for cancer therapy: A focus on hepatocellular carcinoma. J. Ethnopharmacol. 2013, 149, 601–612. [Google Scholar] [CrossRef]
- Chripkova, M.; Drutovic, D.; Pilatova, M.; Mikes, J.; Budovska, M.; Vaskova, J.; Broggini, M.; Mirossay, L.; Mojzis, J. Brassinin and its derivatives as potential anticancer agents. Toxicol. Vitro 2014, 28, 909–915. [Google Scholar] [CrossRef]
- Kim, S.M.; Oh, E.Y.; Lee, J.H.; Nam, D.; Lee, S.G.; Lee, J.; Kim, S.H.; Shim, B.S.; Ahn, K.S. Brassinin combined with capsaicin enhances apoptotic and anti-metastatic effects in PC-3 human prostate cancer cells. Phytother. Res. 2015, 29, 1828–1836. [Google Scholar] [CrossRef]
- Gaspari, P.; Banerjee, T.; Malachowski, W.P.; Muller, A.J.; Prendergast, G.C.; DuHadaway, J.; Bennett, S.; Donovan, A.M. Structure-activity study of brassinin derivatives as indoleamine 2,3-dioxygenase inhibitors. J. Med. Chem. 2006, 49, 684–692. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ogiso, H.; Ito, H.; Kanbe, A.; Ando, T.; Hara, A.; Shimizu, M.; Moriwaki, H.; Seishima, M. The inhibition of indoleamine 2,3-dioxygenase accelerates early liver regeneration in mice after partial hepatectomy. Dig. Dis. Sci. 2017, 62, 2386–2396. [Google Scholar] [CrossRef]
- Yang, D.; Li, T.; Li, Y.; Zhang, S.; Li, W.; Liang, H.; Xing, Z.; Du, L.; He, J.; Kuang, C.; et al. H2S suppresses indoleamine 2, 3-dioxygenase 1 and exhibits immunotherapeutic efficacy in murine hepatocellular carcinoma. J. Exp. Clin. Cancer Res. 2019, 38, 88. [Google Scholar] [CrossRef]
- Lim, W.; Park, S.; Bazer, F.W.; Song, G. Apigenin Reduces survival of choriocarcinoma cells by inducing apoptosis via the PI3K/AKT and ERK1/2 MAPK pathways. J. Cell Physiol. 2016, 231, 2690–2699. [Google Scholar] [CrossRef]
- Bae, H.; Yang, C.; Lee, J.Y.; Park, S.; Bazer, F.W.; Song, G.; Lim, W. Melatonin improves uterine-conceptus interaction via regulation of SIRT1 during early pregnancy. J. Pineal. Res. 2020, 69, e12670. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Karakhanova, S.; Hartwig, W.; D’Haese, J.G.; Philippov, P.P.; Werner, J.; Bazhin, A.V. Mitochondria and mitochondrial ros in cancer: Novel targets for anticancer therapy. J. Cell Physiol. 2016, 231, 2570–2581. [Google Scholar] [CrossRef]
- Aggarwal, V.; Tuli, H.S.; Varol, A.; Thakral, F.; Yerer, M.B.; Sak, K.; Varol, M.; Jain, A.; Khan, M.A.; Sethi, G. Role of reactive oxygen species in cancer progression: Molecular mechanisms and recent advancements. Biomolecules 2019, 9, 735. [Google Scholar] [CrossRef] [Green Version]
- Kutlu, O.; Kaleli, H.N.; Ozer, E. Molecular Pathogenesis of nonalcoholic steatohepatitis- (NASH-) related hepatocellular carcinoma. Can. J. Gastroenterol. Hepatol. 2018, 2018, 8543763. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Z.; Zhang, C.; Ding, Y.; Zhao, Q.; Yang, L.; Ling, J.; Liu, L.; Ji, H.; Zhang, Y. The activation of p38 and JNK by ROS, contribute to OLO-2-mediated intrinsic apoptosis in human hepatocellular carcinoma cells. Food Chem. Toxicol. 2014, 63, 38–47. [Google Scholar] [CrossRef] [PubMed]
- Raza, M.H.; Siraj, S.; Arshad, A.; Waheed, U.; Aldakheel, F.; Alduraywish, S.; Arshad, M. ROS-modulated therapeutic approaches in cancer treatment. J. Cancer Res. Clin. Oncol. 2017, 143, 1789–1809. [Google Scholar] [CrossRef]
- Geng, Y.D.; Zhang, C.; Lei, J.L.; Yu, P.; Xia, Y.Z.; Zhang, H.; Yang, L.; Kong, L.Y. Walsuronoid B induces mitochondrial and lysosomal dysfunction leading to apoptotic rather than autophagic cell death via ROS/p53 signaling pathways in liver cancer. Biochem. Pharmacol. 2017, 142, 71–86. [Google Scholar] [CrossRef]
- Kello, M.; Drutovic, D.; Chripkova, M.; Pilatova, M.; Budovska, M.; Kulikova, L.; Urdzik, P.; Mojzis, J. ROS-dependent antiproliferative effect of brassinin derivative homobrassinin in human colorectal cancer Caco2 cells. Molecules 2014, 19, 10877–10897. [Google Scholar] [CrossRef] [Green Version]
- Liou, A.T.; Chen, M.F.; Yang, C.W. Curcumin induces p53-null hepatoma cell line Hep3B Apoptosis through the AKT-PTEN-FOXO4 pathway. Evid. Based Complement. Alternat. Med. 2017, 2017, 4063865. [Google Scholar] [CrossRef] [Green Version]
- Trepiana, J.; Meijide, S.; Navarro, R.; Hernandez, M.L.; Ruiz-Sanz, J.I.; Ruiz-Larrea, M.B. Influence of oxygen partial pressure on the characteristics of human hepatocarcinoma cells. Redox Biol. 2017, 12, 103–113. [Google Scholar] [CrossRef] [PubMed]
- Lemasters, J.J.; Theruvath, T.P.; Zhong, Z.; Nieminen, A.L. Mitochondrial calcium and the permeability transition in cell death. Biochim. Biophys. Acta 2009, 1787, 1395–1401. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Williams, G.S.; Boyman, L.; Chikando, A.C.; Khairallah, R.J.; Lederer, W.J. Mitochondrial calcium uptake. Proc. Natl. Acad. Sci. USA 2013, 110, 10479–10486. [Google Scholar] [CrossRef] [Green Version]
- Ren, T.; Wang, J.; Zhang, H.; Yuan, P.; Zhu, J.; Wu, Y.; Huang, Q.; Guo, X.; Zhang, J.; Ji, L.; et al. MCUR1-mediated mitochondrial calcium signaling facilitates cell survival of hepatocellular carcinoma via reactive oxygen species-dependent p53 degradation. Antioxid. Redox Signal. 2018, 28, 1120–1136. [Google Scholar] [CrossRef] [PubMed]
- Lemasters, J.J.; Qian, T.; He, L.; Kim, J.S.; Elmore, S.P.; Cascio, W.E.; Brenner, D.A. Role of mitochondrial inner membrane permeabilization in necrotic cell death, apoptosis and autophagy. Antioxid. Redox Signal. 2002, 4, 769–781. [Google Scholar] [CrossRef]
- Choi, H.D.; Kim, K.-Y.; Park, K.I.; Kim, S.-H.; Park, S.-G.; Yu, S.-N.; Kim, Y.-W.; Kim, D.S.; Chung, K.T.; Ahn, S.-C. Dual role of reactive oxygen species in autophagy and apoptosis induced by compound PN in prostate cancer cells. Mol. Cell Toxicol. 2021, 17, 41–50. [Google Scholar] [CrossRef]
- Bikas, A.; Jensen, K.; Patel, A.; Costello, J.; Kaltsas, G.; Hoperia, V.; Wartofsky, L.; Burman, K.; Vasko, V. Mitotane induces mitochondrial membrane depolarization and apoptosis in thyroid cancer cells. Int. J. Oncol. 2019, 55, 7–20. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, W.H.; Park, W.B.; Gao, B.; Jung, M.H. Critical role of reactive oxygen species and mitochondrial membrane potential in Korean mistletoe lectin-induced apoptosis in human hepatocarcinoma cells. Mol. Pharmacol. 2004, 66, 1383–1396. [Google Scholar] [CrossRef] [Green Version]
- Pearson, G.; Robinson, F.; Beers Gibson, T.; Xu, B.E.; Karandikar, M.; Berman, K.; Cobb, M.H. Mitogen-activated protein (MAP) kinase pathways: Regulation and physiological functions. Endocr. Rev. 2001, 22, 153–183. [Google Scholar] [CrossRef] [Green Version]
- Woo, C.C.; Hsu, A.; Kumar, A.P.; Sethi, G.; Tan, K.H. Thymoquinone inhibits tumor growth and induces apoptosis in a breast cancer xenograft mouse model: The role of p38 MAPK and ROS. PLoS ONE 2013, 8, e75356. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shang, X.Y.; Guo, R.; Yu, X.Q.; Lin, B.; Huang, X.X.; Yao, G.D.; Song, S.J. Enantiomeric 8-O-4’-type neolignans from Crataegus pinnatifida exhibit cytotoxic effect via apoptosis and autophagy in Hep3B cells. Bioorg. Chem. 2020, 104, 104267. [Google Scholar] [CrossRef] [PubMed]
- Shi, J.; Wang, X.; Lyu, L.; Jiang, H.; Zhu, H.J. Comparison of protein expression between human livers and the hepatic cell lines HepG2, Hep3B and Huh7 using SWATH and MRM-HR proteomics: Focusing on drug-metabolizing enzymes. Drug Metab. Pharmacokinet. 2018, 33, 133–140. [Google Scholar] [CrossRef]
- Choi, J.B.; Kim, J.H.; Lee, H.; Pak, J.N.; Shim, B.S.; Kim, S.H. Reactive oxygen species and p53 mediated activation of p38 and caspases is critically involved in kaempferol induced apoptosis in colorectal cancer cells. J. Agric. Food Chem. 2018, 66, 9960–9967. [Google Scholar] [CrossRef]
- Win, S.; Than, T.A.; Zhang, J.; Oo, C.; Min, R.W.M.; Kaplowitz, N. New insights into the role and mechanism of c-Jun-N-terminal kinase signaling in the pathobiology of liver diseases. Hepatology 2018, 67, 2013–2024. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tewari, D.; Patni, P.; Bishayee, A.; Sah, A.N.; Bishayee, A. Natural products targeting the PI3K-Akt-mTOR signaling pathway in cancer: A novel therapeutic strategy. In Seminars in Cancer Biology; Academic Press: Cambridge, MA, USA, 2019. [Google Scholar] [CrossRef]
- Gong, C.; Ai, J.; Fan, Y.; Gao, J.; Liu, W.; Feng, Q.; Liao, W.; Wu, L. NCAPG Promotes the proliferation of hepatocellular carcinoma through PI3K/AKT signaling. Onco Targets Ther. 2019, 12, 8537–8552. [Google Scholar] [CrossRef] [Green Version]
- Calvisi, D.F.; Wang, C.; Ho, C.; Ladu, S.; Lee, S.A.; Mattu, S.; Destefanis, G.; Delogu, S.; Zimmermann, A.; Ericsson, J.; et al. Increased lipogenesis, induced by AKT-mTORC1-RPS6 signaling, promotes development of human hepatocellular carcinoma. Gastroenterology 2011, 140, 1071–1083. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jung, K.H.; Choi, M.J.; Hong, S.; Lee, H.; Hong, S.W.; Zheng, H.M.; Lee, H.S.; Hong, S.; Hong, S.S. HS-116, a novel phosphatidylinositol 3-kinase inhibitor induces apoptosis and suppresses angiogenesis of hepatocellular carcinoma through inhibition of the PI3K/AKT/mTOR pathway. Cancer Lett. 2012, 316, 187–195. [Google Scholar] [CrossRef] [PubMed]
- Izutani, Y.; Yogosawa, S.; Sowa, Y.; Sakai, T. Brassinin induces G1 phase arrest through increase of p21 and p27 by inhibition of the phosphatidylinositol 3-kinase signaling pathway in human colon cancer cells. Int. J. Oncol. 2012, 40, 816–824. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Antibodies | Catalog No. | Sources |
---|---|---|
p-P70S6K (Thr421/Ser424) | 9204 | Cell signaling Technology (Danvers, MA, USA) |
p-S6 (Ser235/236) | 2211 | Cell signaling Technology |
p-P38 (Thr180/Tyr182) | 4511 | Cell signaling Technology |
p-JNK (Thr183/Tyr185) | 4668 | Cell signaling Technology |
p-ERK1/2 (Thr202/Tyr204) | 9101 | Cell signaling Technology |
p-P90RSK (Thr573) | 9346 | Cell signaling Technology |
t-P70S6K | 9202 | Cell signaling Technology |
p-CCND1 (Thr286) | 3300 | Cell signaling Technology |
t-S6 | 2217 | Cell signaling Technology |
t-P38 | 9212 | Cell signaling Technology |
t-JNK | 9252 | Cell signaling Technology |
t-ERK1/2 | 4695 | Cell signaling Technology |
RSK1/RSK2/RSK3 | 9355 | Cell signaling Technology |
p-BAD (Ser112) | 5284 | Cell signaling Technology |
p-BCL-2 (Ser70) | 2827 | Cell signaling Technology |
BAK | 12105 | Cell signaling Technology |
BAX | 2772 | Cell signaling Technology |
TUBA | Sc-32293 | Santa Cruz Biotechnology |
Genes | Accession Number | Primer | Sequence (5′-3′) |
---|---|---|---|
CDK2 | BT006821.1 | Forward | AAATTCATGGATGCCTCTGC |
Reverse | GCCCCCTCTGTGTTAATAAGC | ||
P21 | NM_000389.5 | Forward | GACTCTCAGGGTCGAAAACG |
Reverse | GGATTAGGGCTTCCTCTTGG | ||
GAPDH | NM_001256799.3 | Forward | ACCCAGAAGACTGTGGATGG |
Reverse | TGACAAAGTGGTCGTTGAGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hong, T.; Ham, J.; Song, J.; Song, G.; Lim, W. Brassinin Inhibits Proliferation in Human Liver Cancer Cells via Mitochondrial Dysfunction. Cells 2021, 10, 332. https://doi.org/10.3390/cells10020332
Hong T, Ham J, Song J, Song G, Lim W. Brassinin Inhibits Proliferation in Human Liver Cancer Cells via Mitochondrial Dysfunction. Cells. 2021; 10(2):332. https://doi.org/10.3390/cells10020332
Chicago/Turabian StyleHong, Taeyeon, Jiyeon Ham, Jisoo Song, Gwonhwa Song, and Whasun Lim. 2021. "Brassinin Inhibits Proliferation in Human Liver Cancer Cells via Mitochondrial Dysfunction" Cells 10, no. 2: 332. https://doi.org/10.3390/cells10020332
APA StyleHong, T., Ham, J., Song, J., Song, G., & Lim, W. (2021). Brassinin Inhibits Proliferation in Human Liver Cancer Cells via Mitochondrial Dysfunction. Cells, 10(2), 332. https://doi.org/10.3390/cells10020332