Developing Elite Rice ZH381 and ZLY381 by Pyramiding badh2, Pi2, and Wx^b

Abstract

The enhancement of rice yield, quality, and disease resistance plays a crucial role in determining food security. However, there is often a negative correlation among these traits. This study developed elite restorer line Zhonghui381 (ZH381) and two-line hybrid rice Zhongliangyou381 (ZLY381). ZH381 is a restorer line selected from F₇ obtained by crossbreeding Yuenongsimiao (YNSM) and Jiuxiangzhan (JXZ). ZLY381 is a two-line hybrid rice obtained by crossbreeding Z767S and ZH381. The Kompetitive Allele Specific PCR (KASP) shows ZH381 contains badh2, Pi2, and Wx^b. ZLY381 exhibits excellent traits of high yield, high quality, and resistance to rice blast disease in some areas. This study has developed variety has higher yield and high disease resistance, which helps address food security.

1. Introduction

Rice is the staple food crop of China with an annual production of 200 mt in the past fifteen years. Improvements in crop yield are getting smaller each year; with the outbreak of extreme climate and limited water, in addition to the decreasing availability of arable land, the goal of ending global hunger by 2030 is a gigantic task [1]. Therefore, high yield remains the primary goal of rice breeding in China at present. Dwarf breeding has increased the yield of rice by about 20%, and subsequent hybrid rice technology has further increased its yield by 20% on this basis [2]. At present, the main products promoted in production are three-line and two-line hybrid rice. Three-line male sterile lines need the maintainer line for breeding. Two-line male sterile lines can be used as a sterile line at high temperatures and can be used for self-breeding at low temperatures. Compared with the three-line hybrid rice, the advantages of two-line hybrid rice are free combination, a simplified breeding process, a shortened breeding cycle, and diversified male sterile lines. However, two-line hybrid rice still faces many challenges, such as low resistance to rice blast disease, poor quality, and so on.

Rice blast, caused by the Magnaporthe oryzae, is a devastating disease that limits rice cultivation worldwide, causing annual losses of up to 10–30% [3]. Developing resistant varieties using rice blast resistance (R) genes is an effective way of addressing this constraint. To date, more than 80 blast R genes or QTLs have been identified, and at least 25 R genes have been cloned [4]. Pi2 has been identified on chromosome 6 and is an allele of Pi9, Pi50, Pigm, Pizh, Piz, and Piz-t [5]. Pi2 belongs to the NBS-LRR class of genes and possesses one of the widest resistance spectra [6]. It exhibits resistance to the vast majority of 792 rice blast races collected from China [7], which indicates that Pi2 can be utilized to enhance rice blast resistance. For example, importing Pi2 into the restorer line Zhonghui261 significantly enhanced its resistance to rice blast disease [8].

Wx has been identified on chromosome 6 and encodes granule-bound starch synthase (GBSS), which is the main gene controlling the synthesis of amylose content (AC) in rice endosperm and pollen. In non-glutinous varieties, the Wx gene is differentiated into two alleles, Wx^a and Wx^b. Among them, wild rice is all Wx^a, while indica rice is mainly Wxa with higher AC; Japonica rice is mainly Wx^b with lower AC [9,10]. Sequence analysis showed that compared with Wx^a, a mutation from GT to TT occurred at the first intron in Wx^b, resulting in reduced splicing efficiency and abnormal splicing of the first intron, leading to a decrease in AC [11,12]. Therefore, using Wx^b to improve the rice quality of indica hybrid rice is a direct and effective method.

BADH2 is located on chromosome 8 and encodes a betaine aldehyde dehydrogenase with aldehyde dehydrogenase activity, which may catalyze the oxidation of betaine aldehyde, 4-aminobutyraldehyde, and 3-aminopropanal [13]. In non-fragrant rice varieties, the BADH2 protein catalyzes the oxidation of 4-aminobutyraldehyde, which is the main component of the aroma of fragrant rice varieties and a precursor for the synthesis of 2-acetyl-1-pyrroline (2-AP). When 4-aminobutyraldehyde is oxidized by BADH2, the synthesis of 2-AP is inhibited, resulting in the loss of aroma in rice. On the contrary, in fragrant rice varieties, due to a loss of function mutation in the BADH2, the BADH2 protein loses its function and cannot catalyze the oxidation of 4-aminobutyraldehyde, leading to the accumulation of 4-aminobutyraldehyde and promoting the synthesis of 2-AP, resulting in the aroma of rice [13]. Based on this, a large number of recent studies have shown that BADH2 can be knocked out or inhibited to create germplasm resources with aroma [14,15,16,17].

Although each of these genes (Pi2, badh2 and Wx^b) has been extensively studied individually and incorporated into breeding programs, reports combining all three genes in a single breeding program appear to be limited. To address the numerous challenges faced by two-line hybrid rice, this study used marker-assisted selection (MAS) technology to pyramid badh2, Pi2, and Wx^b to create an excellent restorer line ZH381. Then, it combined ZH381 and Z767S to create the hybrid rice ZLY381, and evaluated its yield, rice quality, and resistance to rice blast disease in multiple regional trials over the years. ZLY381 exhibits higher yield, better quality, and more stable resistance to rice blast disease compared to commercially available hybrid rice.

2. Materials and Methods

2.1. Plant Materials

YNSM, a conventional indica rice variety carrying Pi2 and Wx^b, was used as the female parent for ZH381; JXZ, a conventional indica rice variety carrying badh2 and Wx^b, was used as the male parent for ZH381. Fyou498 and Yixiangyou2115 were used as the control. All materials were planted according to the standard planting method of the planting site.

Each experimental site was tested in accordance with the “Implementation Plan for the 2023 National Rice Science and Enterprise Rice Joint Venture Late Ripening Group Test of Middle Indica in the Upper Yangtze River” and the “Technical Specification for Regional Crop Variety Testing of Rice”.

The district trial adopts a completely randomized block arrangement, with 3 replicates and a community area of 13.3 m².

All varieties in the same experiment were sown and transplanted at the same time, with a moderate to high level of fertilization. Other cultivation and management measures were the same as those used in local field production.

The observation and recording items and standards shall be implemented in accordance with the requirements of the “Technical Specification for Regional Testing of Crop Varieties—Rice”, the “National Rice Variety Testing Observation and Recording Items, Methods, and Standards”, and the “Record Table for National Rice Variety Regional Testing and Production Testing in Southern Rice Regions”.

2.2. Molecular Marker Analysis

KASP marker sequences of BADH2, Pi2, and Wx^b genes are presented in

Table 1. Sequence of molecular markers.

Gene	Sequence Name	Sequence
BADH2	FAM sequence	GAAGGTGACCAAGTTCATGCTTAACCATAGGAGCAGCTGAAG
	Hex sequence	GAAGGTCGGAGTCAACGGATTACCTTAACCATAGGAGCAGCTGAAA
	Reverse sequence	TGCATTTACTGGGAGTTATGAAACTGGTA
Pi2	FAM sequence	GAAGGTGACCAAGTTCATGCTAGTTATGTATTTAAAACACAGCATGGTG
	Hex sequence	GAAGGTCGGAGTCAACGGATTAGTTATGTATTTAAAACACAGCATGGTA
	Reverse sequence	ACAAGTCTCCATGCATGTATCGAT
Wxb	FAM sequence	GAAGGTGACCAAGTTCATGCTTCATCAGGAAGAACATCTGCAAGG
	Hex sequence	GAAGGTCGGAGTCAACGGATTGTTCATCAGGAAGAACATCTGCAAGT
	Reverse sequence	CGATCTGAATAAGAGGGGAAACAAAGAAT

. DNA isolation was carried out using CTAB buffer solution (2% CTAB, 1.0 mM EDTA (pH 8.0), 100 mM Tris-HCl, and 0.2% β-Mercaptoethanol). The PCR reaction system is as follows: DNA 50 ng, KASP master mix 5 μL, KASP assay mix 0.14 μL, add water to 10 μL. Use an IntelliQube instrument (LGC Group, London, UK) for PCR reaction; the specific procedure is as follows: Activation, 94 °C, 15 min; Denaturation, 94 °C, 20 s; Annealing/Elongation, 58 °C, 60 s, 46 cycles; Denaturation, 94 °C, 20 s; Annealing/Elongation, 55 °C, 60 s, 26 cycles.

After amplification, fluorescence quantitative PCR is uesd to read the bands: 25 °C for 5 s + Plate Read. After completing the tape reading, the fluorescence types FAM, HEX, and ROX are selected, and Allegic Discrimination is chosen for analysis.

2.3. Rice Quality Testing

The rice quality testing was entrusted to the Rice and Product Quality Testing Center of the Ministry of Agriculture and Rural Affairs of the China Rice Research Institute. The rice quality evaluation of the tested varieties was conducted in accordance with the agricultural industry standard “Quality of Edible Rice Varieties” (NY/T593-2021).

2.4. Identification of Resistance to Rice Blast Disease

Resistance to rice blast disease was identified using a combination of natural infection and artificial inoculation induction. The fungus source comes from the rice blast disease standard sample rice stem of the identification area.

During the peak tillering stage, leaf blast is investigated by examining 10 leaves per variety. A survey is conducted on neck blast during the yellow ripening period, with 100 panicles per variety investigated. The comprehensive evaluation and grading criteria for rice blast resistance are shown in

Table 2. Comprehensive evaluation and grading standards for resistance to rice blast disease.

Disease Level	Resistance Comprehensive Index	Disease-Resistant Type
0	≤0.1	High resistance (HR)
1	0.1–2.0	Resistance (R)
3	2.1–4.0	Moderate resistance (MR)
5	4.1–6.0	Moderate susceptibility (MS)
7	6.1–7.5	Susceptibility (S)
9	7.6–9.0	High susceptibility (HS)

Resistance comprehensive index = Leaf blast level × 25% + Neck blast level × 25% + Loss due to neck blast × 50%.

.

When the leaf blast of the susceptible variety does not reach level 7 (the leaf blast test is invalid), and the neck blast reaches level 7 or above, the calculation of the resistance comprehensive index is publicly announced as follows:

$$\mathrm{Resistance} \mathrm{comprehensive} \mathrm{index}={\displaystyle \frac{\mathrm{Neck} \mathrm{blast} \mathrm{level}\times 25\%+\mathrm{Loss} \mathrm{due} \mathrm{to} \mathrm{neck} \mathrm{blast}\times 50\%}{75\%}}$$

2.5. Statistical Analysis

Data analysis results from three biological replicates. IBM SPSS Statistics software (v25) was used for Student’s t test. Data are presented as the mean ± SD, and p values are indicated by a two-tailed Student’s t test.

3. Results

3.1. The Breeding Process of Zhongliangyou381

In order to obtain the restorer line ZH381, in the spring of 2015, an F₁ hybrid was obtained by crossbreeding JXZ (as the female parent) and YNSM (as the male parent). Then, after six generations of self-pollination, combined with phenotype selection (high yield, high quality, resistance to lodging, good leaf color transition, high seed setting rate, and resistance to rice blast disease), and molecular marker selection (badh2, Pi2, and Wx^b), ZH381 was ultimately selected in F₇ (Figure 1A).

In 2018, we selected ZH381 as the male parent and seven sterile line varieties as the female parent for cross testing (Figure 1B). We discovered that ZLY381, a hybrid of ZH381 and Z767S, demonstrated outstanding performance (Figure 1C). Then, from 2019 to 2020, ZH381 participated in the Joint Variety Comparison Experiment, which resulted in a 4.25% increase in yield compared to Feng Liangyou number 4, and a 0.4 day delay in maturity compared to the control throughout the entire growth duration. Seed production was carried out in the summer of 2020, and a comparison test was conducted in the middle and lower reaches of the Yangtze River in 2021 and 2022. ZLY381 showed good resistance, high yield, and superior rice quality in each of the experimental sites. ZLY381 continued to participate in the China National regional trial in 2023 and 2024 (Figure 1D).

3.2. Molecular Marker Detection

In order to detect the excellent alleles carried by ZLY381, the types of BADH2, Pi2, and Wx^b were detected using KASP markers (Figure 2A). The test results showed that the restoration line ZH381 carried excellent allele types of three genes (Figure 2B–D). The sterile line Z767S only carries the excellent allele type Wx^b (Figure 2B–D). ZLY381 carries a heterozygous type of BADH2 and Pi2 and a homozygous type of Wx^b (Figure 2B–D).

3.3. Yield Performance of ZLY381 in Comparative and Regional Tests

In order to evaluate the high yield, stability, adaptability, resistance, rice quality and other important traits of ZLY381 in the double cropping rice planting areas in the upper reaches of the Yangtze River, a comparative experiment was conducted in 17 experimental sites in Yunnan, Guizhou, Chongqing, Sichuan and Shaanxi provinces from 2021 to 2022 (Figure 3A,B). The yield results showed that in 2021, the average yield per plot of ZLY381 was 644.01 kg, an increase of 4.05% compared to the control FY498. There are 16 experimental sites that show an increase in yield, accounting for 94%. The highest yield increase site is in Wenshan, with an increase in yield of 7.13% (Figure 4). In 2022, the average yield per plot was 644.16 kg, an increase of 4.01% compared to FY498. There are 15 experimental sites that show an increase in yield, accounting for 88%. The highest yield increase site is in Xinpuxinqu, with an increase in yield of 7.86% (Figure 4).

Furthermore, ZLY381 participated in the China National regional trial in 2023–2024 (according to the “Regulations on Crop Variety Testing and Information Technology for Rice” (NY/T1300-2022) for experimental evaluation). There are 17 or 16 regional experimental sites distributed in the following five provinces: Guizhou, Shaanxi, Sichuan, Yunnan, and Chongqing (Figure 3C,D). In the initial trial of 2023, the average yield per plot was 642.37 kg, an increase of 4.75% compared to FY498 (CK), reaching an extremely significant level. There are 16 experimental sites with increased yield, accounting for 94%. The highest yield increase site is in Guiyang, with a yield increase of 11.7% (Figure 5A). The average yield per plot in the 2024 trial is 626.09 kg, which is 2.16% higher than that of FY498 (CK1) and 4.58% higher than that of YXY2115 (CK2), reaching an extremely significant level. There are 14 experimental sites with increased yield, accounting for 87.5%. ZLY381 has a maximum yield increase of 10.4% compared to CK1 and 12.3% compared to CK2 (Figure 5B).

3.4. Quality Performance of ZLY381 in Two-Year Regional Trials

The quality of most of the ZLY381 was either on par or superior to the FY498 (CK1) in three test sites (

Table 3. Quality performance of ZLY381 in 2023.

	I		II		III
	FY498 (CK)	ZLY381	FY498 (CK)	ZLY381	FY498 (CK)	ZLY381
HRR	38.7 ± 0.6	68.1 ± 2.0 **	52.1 ± 2.0	60.0 ± 2.0 **	35.2 ± 2.0	50.2 ± 2.0 **
CH	4.9 ± 0.3	0.5 ± 0.0 **	7.0 ± 0.2	1.6 ± 0.2 **	6.6 ± 0.3	0.6 ± 0.1 **
TR	2 ± 0	1 ± 0	2 ± 0	2 ± 0	3 ± 0	2 ± 0
ASV	6.3 ± 0.1	6.7 ± 0.0	6.4 ± 0.1	7 ± 0.0	5.8 ± 0.1	6.8 ± 0.0 **
GC	80 ± 0	70 ± 2	78 ± 2	82 ± 2	80 ± 1	77 ± 2
AC	25.2 ± 0.2	18.0 ± 0.3 **	25.4 ± 0.2	18.3 ± 0.3 **	24.7 ± 0.2	15.7 ± 0.2 **
GL	7.2 ± 0.2	7.0 ± 0.2	7.0 ± 0.2	6.8 ± 0.1	6.8 ± 0.1	6.6 ± 0.1
LWR	3.1 ± 0.1	3.2 ± 0.1	3.0 ± 0.1	3.2 ± 0.1	3.0 ± 0.2	3.3 ± 0.1
BRP	81.9 ± 2.0	81.1 ± 1.0	80.1 ± 2.0	80.2 ± 2.1	79.6 ± 1.9	78.7 ± 2.1
PRR	70.5 ± 1.1	73.6 ± 2.2	69.3 ± 1.9	69.8 ± 1.9	66.3 ± 0.9	67.0 ± 1.0
CRR	31 ± 1	4 ± 0 **	48 ± 2	10 ± 1 **	40 ± 1	4 ± 0 **

I: Honghe Hani and Yi Autonomous Prefecture Academy of Agricultural Sciences; II: Shaanxi Huasheng Seed Industry Co., Ltd.; III: Dazhou Zhaoxin Agricultural Technology Co., Ltd.; HRR: head rice rate (%); CH: chalkiness (%); TR: transparency (level); ASV: alkali spreading value (level); GC: gel consistency (mm); AC: amylose content (%); GL: grain length (mm); LWR: length–width ratio; BRP: brown rice percentage (%); PRR: precision rice rate (%); CRR: chalky rice rate (%). **: p < 0.01.

) in 2023. Compared with FY498 (CK), ZLY381 significantly increased the average Head rice rate (HRR) and Alkali spreading value (ASV) by 17.3% and 0.67 levels, respectively, at the three experimental sites. However, Chalkiness (CH), Amylose content (AC), and Chalky rice rate (CRR) significantly decreased by 5.3%, 7.8%, and 33.7%, respectively. In the three experimental sites in 2024, the average ASV of ZLY381 significantly increased by 0.97 levels compared to FY498 (CK1), while there was no significant difference compared to YXY2115 (CK2). However, the average CH, AC and CRR of ZLY381 decreased by 7.8%, 7.2%, and 39.3% compared to FY498 (CK1), and decreased by 1.9%, 0%, and 9% compared to YXY2115 (CK2), respectively (

Table 4. Quality performance of ZLY381 in 2024.

	I			II			III
	FY498 (CK1)	YXY2115 (CK2)	ZLY381	FY498 (CK1)	YXY2115 (CK2)	ZLY381	FY498 (CK1)	YXY2115 (CK2)	ZLY381
HRR	32.4 ± 1.1	41.8 ± 1.2 **	36.3 ± 1.0	61.7 ± 0.9 **	67.4 ± 1.5	66.7 ± 1.4	50.5 ± 1.1 **	46.1 ± 1.4 **	57.5 ± 1.2
CH	12.7 ± 0.7 **	3.2 ± 0.4 **	1.7 ± 0.2	5.9 ± 0.5 **	1.9 ± 0.1 **	0.6 ± 0.1	8.7 ± 0.6 **	4.4 ± 0.1 **	1.6 ± 0.1
TR	3 ± 0	2 ± 0	2 ± 0	2 ± 0	1 ± 0	1 ± 0	2 ± 0	1 ± 0	1 ± 0
ASV	6.0 ± 0.2	6.7 ± 0.3	6.8 ± 0.2	6.2 ± 0.4	7.0 ± 0.0	7.0 ± 0.0	5.9 ± 0.4 **	7.0 ± 0.0	7.0 ± 0.0
GC	78.0 ± 3.0	82.0 ± 2.0	78.0 ± 0.0	76.0 ± 3.0 **	84.0 ± 2.0 **	70.0 ± 2.0	78.0 ± 1.0	82.3 ± 2.5	80.0 ± 2.0
AC	21.6 ± 0.6 **	13.7 ± 0.4	13.9 ± 0.4 **	23.1 ± 0.6 **	16.7 ± 0.3	16.3 ± 0.3	21.7 ± 0.6 **	14.7 ± 0.5	14.6 ± 0.5
GL	6.8 ± 0.2	7.4 ± 0.3 **	6.7 ± 0.0	7.0 ± 0.0	7.6 ± 0.3 **	6.8 ± 0.4	6.9 ± 0.3	7.5 ± 0.2 **	6.7 ± 0.2
LWR	2.8 ± 0.3	3.0 ± 0.0	3.2 ± 0.3	2.9 ± 0.3	3.1 ± 0.1	3.1 ± 0.2	2.9 ± 0.0	3.0 ± 0.3	3.2 ± 0.1
BRP	78.6 ± 1.7	76.3 ± 2.3	77.7 ± 2.3	82.0 ± 2.0	80.7 ± 2.7	80.4 ± 1.9	80.5 ± 2.0	78.4 ± 2.1	79.3 ± 2.2
PRR	66.7 ± 1.9	68.8 ± 1.1	65.8 ± 0.7	73.1 ± 2.1	72.8 ± 2.0	72.5 ± 0.6	69.8 ± 1.3	70.7 ± 1.6	70.1 ± 2.0
CRR	57.0 ± 2.0 **	19.7 ± 1.5 **	9.0 ± 0.0	29.3 ± 1.5 **	12.0 ± 0.0 **	4.7 ± 0.6	52.3 ± 2.5 **	15.0 ± 1.0 **	6.0 ± 0.0

I: Biqiao Village, Shaping Town, Dianjiang County, Chongqing City; II: Honghe Hani and Yi Autonomous Prefecture Academy of Agricultural Sciences; III: Shaanxi Huasheng Seed Industry Co., Ltd.; HRR: head rice rate (%); CH: chalkiness (%); TR: transparency (level); ASV: alkali spreading value (level); GC: gel consistency (mm); AC: amylose content (%); GL: grain length (mm); LWR: length–width ratio; BRP: brown rice percentage (%); PRR: precision rice rate (%); CRR: chalky rice rate (%). **: p < 0.01.

).

3.5. Disease Reaction of ZLY381

Two years and three regions of rice blast resistance identification experiments showed that the resistance level of ZLY381 to rice blast was between 2 and 5 grades, belonging to the moderate resistance or susceptibility level (

Table 5. Resistance of ZLY381 to rice blast disease in 2023.

	Sichuan				Chongqing				Guizhou				d
	a	b	c	d	a	b	c	d	a	b	c	d
L (CK)	8	9	9	8.8	8	9	9	8.8	6	9	7	7.7
FY498 (CK)	7	9	9	8.5	6	9	9	8.3	4	9	7	8.1	9
ZLY381	3	3	1	2	4	7	3	4.3	3	7	5	4	5

a: grade of leaf blast disease; b: occurrence of neck blast; c: loss due to neck blast; d: resistance comprehensive index. L: local varieties.

and

Table 6. Resistance of ZLY381 to rice blast disease in 2024.

	Sichuan				Chongqing				Guizhou				d
	a	b	c	d	a	b	c	d	a	b	c	d
L (CK)	8	9	9	8.8	7	9	9	8.5	5	9	7	7.7
FY498 (CK1)	7	9	9	8.5	6	9	9	8.3	4	9	5	6.3	7.7
YXY2115 (CK2)	5	5	1	3	4	5	3	3.8	3	7	5	5.7	4.2
ZLY381	4	3	1	2.3	4	7	3	4.3	3	7	5	5.7	4.1

a: grade of leaf blast disease; b: occurrence of neck blast; c: loss due to neck blast; d: resistance comprehensive index. L: local varieties.

). In the two-year appraisal, ZLY381 showed a moderate resistance level in Sichuan, moderate susceptibility level in Chongqing and Guizhou, while L (CK) and FY498 (CK) both showed a high susceptibility level (Table 5 and Table 6).

3.6. Agronomic Performance of ZLY381

In order to clarify the reasons for the increased yield of ZLY381 compared to the control variety, we conducted an investigation of agronomic traits. Among the 17 experimental sites in 2023, ZLY381 had 12 sites showing an increase in tiller number (TN) compared to the CK, accounting for 70.6%; there were 10 sites with an increase in the number of filled grains per panicle (NFGPP) compared to the CK, accounting for 58.8%. However, there were 16 sites with a decrease in thousand grain weight (TGW) compared to the CK, accounting for 94.1% (Figure 6A–C). Among the 16 experimental sites in 2024, ZLY381 showed an increase in TN compared to CK1 and CK2 in 16 and 12 sites, accounting for 100% and 75%, respectively. Additionally, four and 10 sites increased in the NFGPP compared to CK1 and CK2, accounting for 25.0% and 62.5%, respectively. On the TGW, there were 16 sites that decreased compared to CK1 and CK2, accounting for 100% (Figure 6D–F).

4. Discussion

Over the past 40 years, breeders have employed various molecular markers in crop breeding. Molecular markers have evolved through three generations, starting from low-flux Restriction Fragment Length Polymorphism (RFLP) and recently reaching Single Nucleotide Polymorphism (SNP) markers based on Next-Generation Sequencing (NGS) technology. The use of molecular markers has been successfully reported in sorghum [18], maize [19], rice [20], wheat [21], and barley [22], for several traits that improve the efficiency of traditional breeding. KASP is a fluorescence-based genotyping technique that can detect tens of thousands of genes per day, without involving steps such as electrophoresis, enzyme digestion, or sequencing, and without the use of toxic and harmful substances such as polypropylene, EB, and formaldehyde. It greatly improved detection efficiency and accelerated the breeding process. In the present study, we developed ZH381 and ZLY381 through pyramiding of Pi2, Wx^b, and BADH2 through KASP technology.

Improving food productivity is a crucial priority for sustainable agriculture due to the current harsh climate and increasing energy demand [23]. In the present study, we found that ZLY381 can significantly increase yield in most plots compared to CK, and a yield maximum increase of 12.3% is observed (Figure 5B). Therefore, the cultivation of ZLY381 has been determined to increase grain yield. Yield is usually broken down into the following three components: grain number per spike, number of spikes per area, and thousand grain weight [24]. The relationship between components of yield structure is quite complex, and they are always interrelated and mutually constrained. An increase in one factor inevitably leads to a decrease in other factors to varying degrees. For example, Ideal Plant Architecture 1 (IPA1) can increases grains per panicle but reduce tillers [25]. In the present study, over two years of trials in multiple regions, in more than three-quarters of the regions, the TN of ZLY381 was higher than that of the control; in more than half of the regions, the NFGPP of ZLY381 was higher than that of the control; and in almost all regions, the TGW of ZLY381 was lower than that of the control (Figure 6). The distribution of photosynthetic energy may be concentrated on TN and NFGPP, resulting in a decrease in TGW.

Balancing the yield, resistance to disease, and quality is a challenge in rice breeding due to the negative relationship among these traits [26]. In recent years, there have been some breakthroughs in resolving the contradictions among these traits. Pyramiding Pita, Pib, and Pid2 to Yanfeng47 not only enhances resistance to rice blast disease, but also improves yield and quality [27]. Dof transcriptional factor OsDes1 can enhance grain yield and disease resistance via activating OsPetC and OsPR1b [28]. Although ZLY381 carrying pi2 did not show resistance to rice blast disease in some areas (Table 5 and Table 6), this may be related to the climate and physiological races in the experimental area. However, overall, ZLY381 exhibits characteristics such as wide adaptability, high and stable yield, good plant shape, excellent rice quality, and disease resistance. This indicates that pyramiding BADH2, Pi2, and Wx^b may reconcile the contradiction between yield and resistance. In summary, our work has cultivated a high-quality restorer line and a new high-quality two-line hybrid rice variety, providing a foundation for ensuring food security.

5. Conclusions

This study developed elite rice varieties ZH381 and ZLY381 by pyramiding BADH2, Pi2, and Wx^b. The main advantages of ZLY381 include wide adaptability, high and stable yield, excellent plant type, and excellent rice quality. ZLY381 is suitable for planting mid to late rice in the middle and lower reaches of the Yangtze River, meeting the current demand for high-quality rice. However, ZLY381 also has some limitations, and attention should be paid to the prevention and control of rice blast disease when planting in some places.

In future research, we will comprehensively evaluate the potential applications of ZLY381 and delve deeper into the mechanisms by which gene pyramiding affects excellent phenotypes.