Dynamics of Avirulence Genes and Races in the Population of Magnaporthe oryzae in Jilin Province, China
Abstract
1. Introduction
2. Materials and Methods
2.1. Monoconidial Isolation and Preservation of M. oryzae
2.2. DNA Preparation and Extraction
2.3. The Avirulence Gene Detection
2.4. Pathogenicity Analysis
2.5. Race Coding
2.6. Statistics and Analysis of Data
3. Results
3.1. Avr Gene Analysis
3.2. Race Structure
3.3. Resistance and Pathogenicity Profiles
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Cruz, C.D.; Valent, B. Wheat blast disease: Danger on the move, Trop. Plant Pathol. 2017, 42, 210–222. [Google Scholar] [CrossRef] [Scilit]
- Baudin, M.; Le Naour-Vernet, M.; Gladieux, P.; Tharreau, D.; Lebrun, M.H.; Lambou, K.; Leys, M.; Fournier, E.; Césari, S.; Kroj, T. Pyricularia oryzae: Lab star and field scourge. Mol. Plant Pathol. 2024, 25, e13449. [Google Scholar] [CrossRef] [Scilit]
- Fernandez, J.; Orth, K. Rise of a Cereal Killer: The Biology of Magnaporthe oryzae Biotrophic Growth. Trends Microbiol. 2018, 26, 582–597. [Google Scholar] [CrossRef] [Scilit]
- Eseola, A.B.; Ryder, L.S.; Osés-Ruiz, M.; Findlay, K.; Yan, X.; Cruz-Mireles, N.; Molinari, C.; Garduño-Rosales, M.; Talbot, N.J. Investigating the cell and developmental biology of plant infection by the rice blast fungus Magnaporthe oryzae. Fungal Genet. Biol. 2021, 154, 103562. [Google Scholar] [CrossRef] [Scilit]
- Sahu, P.K.; Sao, R.; Choudhary, D.K.; Thada, A.; Kumar, V.; Mondal, S.; Das, B.K.; Jankuloski, L.; Sharma, D. Advancement in the Breeding, Biotechnological and Genomic Tools towards Development of Durable Genetic Resistance against the Rice Blast Disease. Plants 2022, 11, 2386. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.; Jia, Y.; Wamishe, Y.; Jia, M.; Valent, B. Dynamic changes in the rice blast population in the USA over six decades. Mol. Plant-Microbe Interact. 2017, 30, 803–812. [Google Scholar] [CrossRef] [Scilit]
- Flor, H.H. Current status of the gene-for-gene concept. Annu. Rev. Phytopathol. 1971, 9, 275–296. [Google Scholar] [CrossRef] [Scilit]
- Devanna, B.N.; Jain, P.; Solanke, A.U.; Das, A.; Thakur, S.; Singh, P.K.; Kumari, M.; Dubey, H.; Jaswal, R.; Pawar, D. Understanding the Dynamics of Blast Resistance in Rice-Magnaporthe oryzae Interactions. J. Fungi 2022, 8, 584. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Younas, M.U.; Qasim, M.; Ahmad, I.; Feng, Z.; Iqbal, R.; Jiang, X.; Zuo, S. Exploring the molecular mechanisms of rice blast resistance and advances in breeding for disease tolerance. Mol. Biol. Rep. 2024, 51, 1093. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Q.; Li, J.; Lu, L.; He, C.; Li, C. Novel Variation and Evolution of AvrPiz-t of Magnaporthe oryzae in Field Isolates. Front. Genet. 2020, 11, 746. [Google Scholar] [CrossRef] [Scilit]
- Wu, W.; Wang, L.; Cheng, G.; Zhu, Y.; Pan, Q. Molecular genetic studies on the rice blast fungus population: Comparison of genetic and pathotypic structures of two rice blast fungus populations derived from Guangdong and Yunnan provinces of China. Sci. Agri. Sin. 2004, 675–680. (In Chinese) [Google Scholar]
- Tian, D.; Deng, Y.; Yang, X.; Li, G.; Li, Q.; Zhou, H.; Chen, Z.; Guo, X.; Su, Y.; Luo, Y.; et al. Association analysis of rice resistance genes and blast fungal avirulence genes for effective breeding resistance cultivars. Front. Microbiol. 2022, 13, 1007492. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, Z.; Wang, J.; Zhang, Y.; Yao, Y.; Huang, L.; Yang, X.; Wang, L.; Pan, Q. Dynamics of Race Structures of Pyricularia oryzae Populations Across 18 Seasons in Guangdong Province, China. Plant Dis. 2021, 105, 144–148. [Google Scholar] [CrossRef] [Scilit]
- Hao, B.; Li, C.; Meng, Z.W.; Yang, L.; Geng, Y.Q.; Wang, S.; Li, K.Z.; Dang, S.; Yang, G.Y.; Chen, D.Y. Development Status and Prospect of High-quality Rice industry in Jilin Province. North. Rice 2020, 50, 1–5+11. (In Chinese) [Google Scholar] [CrossRef]
- Hao, B.; Li, C.; Yao, L.; Wu, X.Y.; Chen, D.Y.; Yan, G.B.; Liu, Z.J. Analysis of Current Status and Development Strategies of Rice Seed Industry in Jilin Province. China Seed Ind. 2023, 12, 47–51+56. (In Chinese) [Google Scholar] [CrossRef]
- Wang, D.; Zhu, F.; Wang, J.; Ju, H.; Yan, Y.; Qi, S.; Ou, Y.; Tian, C. Pathogenicity Analyses of Rice Blast Fungus (Pyricularia oryzae) from Japonica Rice Area of Northeast China. Pathogens 2024, 13, 211. [Google Scholar] [CrossRef] [Scilit]
- Sirisathaworn, T.; Srirat, T.; Longya, A.; Jantasuriyarat, C. Evaluation of mating type distribution and genetic diversity of three Magnaporthe oryzae avirulence genes, PWL-2, AVR-Pii and Avr-Piz-t, in Thailand rice blast isolates. Agric. Nat. Resour. 2017, 51, 7–14. [Google Scholar] [CrossRef] [Scilit]
- Li, W.; Wang, B.; Wu, J.; Lu, G.; Hu, Y.; Zhang, X.; Zhang, Z.; Zhao, Q.; Feng, Q.; Zhang, H.; et al. The Magnaporthe oryzae avirulence gene AvrPiz-t encodes a predicted secreted protein that triggers the immunity in rice mediated by the blast resistance gene Piz-t. Mol. Plant-Microbe Interact. 2009, 22, 411–420. [Google Scholar] [CrossRef] [Scilit]
- Yoshida, K.; Saitoh, H.; Fujisawa, S.; Kanzaki, H.; Matsumura, H.; Yoshida, K.; Tosa, Y.; Chuma, I.; Takano, Y.; Win, J.; et al. Association genetics reveals three novel avirulence genes from the rice blast fungal pathogen Magnaporthe oryzae. Plant Cell 2009, 21, 1573–1591. [Google Scholar] [CrossRef] [Scilit]
- Ray, S.; Singh, P.K.; Gupta, D.K.; Mahato, A.K.; Sarkar, C.; Rathour, R.; Singh, N.K.; Sharma, T.R. Analysis of Magnaporthe oryzae Genome Reveals a Fungal Effector, Which Is Able to Induce Resistance Response in Transgenic Rice Line Containing Resistance Gene, Pi54. Front. Plant Sci. 2016, 7, 1140. [Google Scholar] [CrossRef] [Scilit]
- Farman, M.; Eto, Y.; Nakao, T.; Tosa, Y.; Nakayashiki, H.; Mayama, S.; Leong, S. Analysis of the structure of the AVR1-CO39 avirulence locus in virulent rice-infecting isolates of Magnaporthe grisea. Mol. Plant-Microbe Interact. 2002, 15, 6–16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, J.; Kou, Y.; Bao, J.; Li, Y.; Tang, M.; Zhu, X.; Ponaya, A.; Xiao, G.; Li, J.; Li, C.; et al. Comparative genomics identifies the Magnaporthe oryzae avirulence effector AvrPi9 that triggers Pi9-mediated blast resistance in rice. New Phytol. 2015, 206, 1463–1475. [Google Scholar] [CrossRef] [Scilit]
- Shimizu, M.; Hirabuchi, A.; Sugihara, Y.; Abe, A.; Takeda, T.; Kobayashi, M.; Hiraka, Y.; Kanzaki, E.; Oikawa, K.; Saitoh, H.; et al. A genetically linked pair of NLR immune receptors shows contrasting patterns of evolution. Proc. Natl. Acad. Sci. USA 2022, 119, e2116896119. [Google Scholar] [CrossRef] [Scilit]
- Zhang, S.; Wang, L.; Wu, W.; He, L.; Yang, X.; Pan, Q. Function and evolution of Magnaporthe oryzae avirulence gene AvrPib responding to the rice blast resistance gene Pib. Sci. Rep. 2015, 5, 11642. [Google Scholar] [CrossRef] [Scilit]
- Xu, Z.W. Distribution Characteristics and Pathogenicity Analysis of Avirulence Genes of Rice Blast Fungus in Jiangsu Rice Region. Ph.D. Thesis, The Yangzhou University, Yangzhou, China, 2023. (In Chinese) [Google Scholar] [CrossRef]
- Zhang, Y.; Zhu, Q.; Yao, Y.; Zhao, Z.; Correll, J.C.; Wang, L.; Pan, Q. The Race Structure of the Rice Blast Pathogen Across Southern and Northeastern China. Rice 2017, 10, 46. [Google Scholar] [CrossRef] [Scilit]
- All China Corporation of Research on Physiological Races of Pyricularia oryzae. Research on physiological races of rice blast fungus in China. Acta Phytopathol. Sin. 1980, 10, 71–82.
- Zhang, Y.; Wang, J.; Yao, Y.; Jin, X.; Correll, J.; Wang, L.; Pan, Q. Dynamics of Race Structures of the Rice Blast Pathogen Population in Heilongjiang Province, China From 2006 Through 2015. Plant Dis. 2019, 103, 2759–2763. [Google Scholar] [CrossRef] [Scilit]
- Oliveira-Garcia, E.; Yan, X.; Oses-Ruiz, M.; de Paula, S.; Talbot, N.J. Effector-triggered susceptibility by the rice blast fungus Magnaporthe oryzae. New Phytol. 2024, 241, 1007–1020. [Google Scholar] [CrossRef] [Scilit]
- Li, R.; Qiu, J.; Shi, H.; Jiang, N.; Lan, B.; Kou, Y. Variation of Avirulence Genes in the Blast Fungus from Jiangxi Province, China. Plant Dis. 2025, 109, 1211–1217. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Singh, P.K.; Ray, S.; Thakur, S.; Rathour, R.; Sharma, V.; Sharma, T.R. Co-evolutionary interactions between host resistance and pathogen avirulence genes in rice-Magnaporthe oryzae pathosystem. Fungal Genet. Biol. 2018, 115, 9–19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, J.C.; Zhang, J.H.; Ren, J.P.; Wen, J.W.; Li, L. Identification of rice blast resistance genes using international monogenic differentials. Crop Prot. 2013, 45, 109–116. [Google Scholar] [CrossRef] [Scilit]
- Li, L.; Sun, L.; Zhang, J.H.; Zou, X.W.; Sun, H.; Ren, J.P.; Liu, X.M.; Jiang, Z.Y. Evaluation of Resistance and Analysis of Utilization Value of the Major Japonica Rice Varieties in Jilin Province Based on the Physiological Race Variation of Magnaporthe oryzae. Chin. Agric. Sci. 2023, 56, 4441–4452. (In Chinese) [Google Scholar]
- Cao, G.M.; Li, C.D.; Jin, F.; Liu, H.T.; Han, R.T. A preliminary study on the physiological races of rice blast fungus in Jilin Province. Acta Phytopathol. Sin. 1983, 13, 13–19. (In Chinese) [Google Scholar]
- Liu, H.T.; Lu, Z.Z.; Han, R.T. A review of studies on physiological races of blast fungus in Jilin Province. J. Jilin Agric. Univ. 2002, 24, 34–38. (In Chinese) [Google Scholar]
- Liu, X.M.; Li, L.; Jiang, Z.Y.; Sun, H.; Ren, J.P. Variation of physiological race of rice blast in Jilin Province from 2002 to 2012. J. Jilin Agric. Sci. 2014, 39, 68–70+77. (In Chinese) [Google Scholar]
- Tsunematsu, H.; Yanoria, M.J.T.; Ebron, L.A.; Hayashi, N.; Ando, I.; Kato, H.; Imbe, T.; Khush, G.S. Development of Monogenic Lines of Rice for Blast Resistance. Breed. Sci. 2000, 50, 229–234. [Google Scholar] [CrossRef] [Scilit]


| Primer Name | Primer Sequence (5′-3′) | Expected Size (bp) |
|---|---|---|
| Avr-co39 F | AATTGCATAATCGCTGCGAT | 918 |
| Avr-co39 R | CTCAAGCTCACAGAACTTTGTT | |
| Avr-Pib F | GCCGACAATGCGAGGTATAC | 248 |
| Avr-Pib R | CGACAGGGAATAACACAGCG | |
| Avr-Pi9 F | GTGCCGTGAGTTTTCCATGT | 210 |
| Avr-Pi9 R | CCTTGGAATAGACGGCAGCAC | |
| Avr-Pizt F | AAACCAGGGCAGCCAAAGA | 153 |
| Avr-Pizt R | ATTCCCAATCGAGCCAACG | |
| Avr-Pik F | ACTTTGGGAACTGTCGCTGTC | 184 |
| Avr-Pik R | AGCTGTAACAGGTTCCAGCATC | |
| Avr-Pias F | ATGCGTTTTTCATCTATTCC | 270 |
| Avr-Pias R | TTATTCAGGATAACCAAAAAC | |
| Avr-Pi54 F | ATGCAGTTCACCGCCACC | 462 |
| Avr-Pi54 R | CTAGCAGCCATAGGTGAGGA |
| Gene | 2022 (60) a | 2023 (67) | 2024 (66) | Total Frequency of Detection/% | |||
|---|---|---|---|---|---|---|---|
| No. | Frequency/% | No. | Frequency/% | No. | Frequency/% | ||
| Avr-Pi9 | 60 | 100.00 | 67 | 100.00 | 66 | 100.00 | 100.00 |
| Avr-Pik | 28 | 46.67 | 23 | 34.33 | 27 | 40.91 | 40.41 |
| Avr-Pizt | 55 | 91.67 | 57 | 85.07 | 46 | 69.70 | 81.87 |
| Avr-Pib | 52 | 86.67 | 56 | 83.58 | 48 | 72.73 | 80.83 |
| Avr-co39 | 53 | 88.33 | 53 | 79.10 | 26 | 39.39 | 68.39 |
| Avr-Pias | 55 | 91.67 | 65 | 97.01 | 58 | 87.88 | 92.22 |
| Avr-Pi54 | 47 | 78.33 | 37 | 55.22 | 45 | 68.18 | 66.83 |
| Parameter | 2022 (60) a | 2023 (67) | 2024 (66) |
|---|---|---|---|
| No. of race group | 6 | 6 | 7 |
| No. of races | 13 | 19 | 23 |
| Race frequency (ftr) | 21.67 | 28.35 | 34.85 |
| Race/Parameter | 2022 (60) a | 2023 (67) | 2024 (66) | |||
|---|---|---|---|---|---|---|
| No. | fpcri | No. | fpcri | No. | fpcri | |
| ZA17 | 5 | 8.33 | 11 | 16.42 | 4 | 6.06 |
| ZA33 | 3 | 5.00 | 2 | 2.99 | 2 | 3.03 |
| ZA57 | 1 | 1.67 | 1 | 1.49 | 1 | 1.52 |
| ZA49 | 1 | 1.67 | 5 | 7.46 | 1 | 1.52 |
| ZB31 | 9 | 15.00 | 7 | 10.45 | 3 | 4.55 |
| ZD1 | 4 | 6.67 | 5 | 7.46 | 3 | 4.55 |
| ZF1 | 3 | 5.00 | 3 | 4.48 | 2 | 3.03 |
| ZG1 | 25 | 41.67 | 16 | 23.88 | 25 | 37.88 |
| fpcr | 61.54 | 42.11 | 34.78 | |||
| ∑/ftpcri | 51 | 85.00 | 50 | 74.63 | 41 | 62.12 |
| Population | Specific Races (No. of Isolates) a | Races | Isolates | ||
|---|---|---|---|---|---|
| No. | fpsr | No. | fpsr | ||
| 2022 (60) | ZB1 (2) | 1 | 7.69 | 2 | 3.33 |
| 2023 (67) | ZA59 (1), ZA63 (1), ZC13 (1) | 3 | 15.79 | 3 | 4.48 |
| 2024 (66) | ZA3 (1), ZA41 (1), ZA53 (1), ZB9 (1), ZB15 (1), ZB23 (2), ZC3 (1), ZD3 (3) | 8 | 34.78 | 10 | 15.15 |
| Top 3 Races and Their Frequencies | |||||||
|---|---|---|---|---|---|---|---|
| Population | First (Isolates) | ft3ri-1 | Second (Isolates) | ft3ri-2 | Third (Isolates) | ft3ri-3 | Top 3 ftt3ri |
| 2022 (60) | ZG1 (25) | 41.67 | ZB31 (9) | 15.00 | ZA17 (5) | 8.33 | 65.00 |
| 2023 (67) | ZG1 (16) | 23.88 | ZA17 (11) | 16.42 | ZB31 (7) | 10.45 | 50.75 |
| 2024 (66) | ZG1 (25) | 37.88 | ZA43 (6) | 9.09 | ZA17 (4) | 6.06 | 53.03 |
| Differential Cultivar | Race Code | Resistance Gene | Resistance Frequencies (fCR) | Total Resistance Frequency (fTCR) | ||
|---|---|---|---|---|---|---|
| 2022 | 2023 | 2024 | ||||
| Tetep | A64 | Pi1, Pi4, and Pi54 | 81.67 | 56.71 | 69.70 | 68.91 |
| Zhenlong 13 | B32 | Pik, Pia, β, and ε | 71.67 | 58.21 | 74,24 | 68.39 |
| Sifeng 43 | C16 | Pib, Pia, and α | 88.33 | 85.07 | 75.76 | 82.90 |
| Dongnong 363 | D8 | Pik, Pia, and β | 68.33 | 53.73 | 71.21 | 64.25 |
| Kando 51 | E4 | Pik and γ | 65.00 | 49.25 | 54.55 | 55.96 |
| Hejiang 18 | F2 | Pii, Pia, and δ | 60.00 | 43.28 | 71.21 | 58.03 |
| Lijiangxintuanheigu | G1 | Pik-l | 0.00 | 0.00 | 0.00 | 0.00 |
| Gene | No. | Disease Incidence (%) | Total Disease Incidence (%) | |||||
|---|---|---|---|---|---|---|---|---|
| Tetep | Zhenlong 13 | Sifeng 43 | Dongnong 363 | Kando 51 | Hejiang 18 | |||
| Avr-Pi9 | 193 | 32.64 | 32.12 | 16.58 | 35.75 | 44.04 | 41.97 | 33.85 |
| Avr-Pik | 78 | 2.56 | 0 | 2.56 | 2.56 | 2.56 | 12.82 | 3.85 |
| Avr-Pizt | 158 | 24.68 | 35.44 | 10.13 | 36.08 | 36.71 | 41.14 | 30.97 |
| Avr-Pib | 156 | 21.79 | 30.13 | 0.64 | 32.69 | 33.33 | 37.82 | 26.07 |
| Avr-co39 | 132 | 29.55 | 34.85 | 12.88 | 35.61 | 41.67 | 46.21 | 33.46 |
| Avr-Pias | 178 | 32.02 | 33.71 | 16.85 | 35.96 | 44.94 | 42.70 | 34.36 |
| Avr-Pi54 | 129 | 0.78 | 22.66 | 7.75 | 19.38 | 18.6 | 22.48 | 15.37 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Zhang, S.; Jiang, Z.; Liu, X.; Sun, L.; Sun, H.; Li, L.; Wu, S. Dynamics of Avirulence Genes and Races in the Population of Magnaporthe oryzae in Jilin Province, China. Agronomy 2026, 16, 41. https://doi.org/10.3390/agronomy16010041
Zhang S, Jiang Z, Liu X, Sun L, Sun H, Li L, Wu S. Dynamics of Avirulence Genes and Races in the Population of Magnaporthe oryzae in Jilin Province, China. Agronomy. 2026; 16(1):41. https://doi.org/10.3390/agronomy16010041
Chicago/Turabian StyleZhang, Shengjie, Zhaoyuan Jiang, Xiaomei Liu, Ling Sun, Hui Sun, Li Li, and Songquan Wu. 2026. "Dynamics of Avirulence Genes and Races in the Population of Magnaporthe oryzae in Jilin Province, China" Agronomy 16, no. 1: 41. https://doi.org/10.3390/agronomy16010041
APA StyleZhang, S., Jiang, Z., Liu, X., Sun, L., Sun, H., Li, L., & Wu, S. (2026). Dynamics of Avirulence Genes and Races in the Population of Magnaporthe oryzae in Jilin Province, China. Agronomy, 16(1), 41. https://doi.org/10.3390/agronomy16010041

