Analysis of Genetic Diversity in Polymers of Saccharum spontaneum L. and Their Hybrid Progenies

Abstract

Saccharum spontaneum L. (wild sugarcane) possesses advantages such as strong perenniality, high stress resistance, and broad adaptability, making it the most successfully utilized wild species in sugarcane hybrid breeding. However, previous exploitation of S. spontaneum has been limited. To further explore its breeding potential, this study employed recurrent selection to improve the population of S. spontaneum (S0) before its application in germplasm innovation. Subsequently, S1 (containing two S. spontaneum bloodlines) were developed and optimized. Using S1 as dual parents, S2 (containing three or more S. spontaneum bloodlines) were further created and selected. Genetic diversity among 199 materials from seven populations (S0, S1 and S2) was evaluated using simple sequence repeat (SSR) markers. The results showed that an unweighted pair-group method with arithmetic means (UPGMA) cluster analysis based on genetic distance classified the 199 S. spontaneum materials into seven groups, largely consistent with their original population divisions. Compared to their parents, the S1 population generated an average of 18.79 novel loci (mutation rate: 25.00%), while the S2 population produced an average of 15.40 novel loci (mutation rate: 19.00%). The polymer of S. spontaneum exhibited rich genetic diversity, with Nei’s gene diversity index of 0.3390 and Shannon information index of 0.5082. Due to the increased number of original parents and trait pyramiding, the polymer of S. spontaneum demonstrated expanded genetic backgrounds and enhanced heterogeneity. Furthermore, hybridization and recombination generated novel elite loci compared to their parents, further enriching the overall genetic background and diversity of the polymer of S. spontaneum.

1. Introduction

Saccharum spontaneum L., also called thin-stemmed wild sugarcane or sweet-root grass [1], is a perennial herb in the genus Saccharum L., tribe Andropogoneae, family Poaceae. It exhibits an exceptionally wide geographic distribution [2] and possesses numerous advantageous traits, including vigorous growth, profuse tillering, strong ratooning ability, rapid early growth, and excellent stress resistance [3]. S. spontaneum plays a critically important role in sugarcane breeding. Throughout the history of sugarcane genetic improvement, the utilization of S. spontaneum resources has driven significant advancements in breeding. In the 1890s, Dutch and British sugarcane breeders initiated the era of sugarcane hybrid breeding by crossing Javanese S. spontaneum with Saccharum officinarum. This pioneering work led to the formulation of the “nobilization” breeding theory, establishing a crucial theoretical foundation for sugarcane genetics and breeding [4], and yielded ‘POJ 2878’, the world’s first commercial sugarcane variety, ushering in a new era in sugarcane production [5]. Presently, over 90% of modern sugarcane cultivars contain genetic ancestry from ‘POJ 2878’ [6]. Subsequent sugarcane breeding has focused on continuous recombination of genetic material from 3–5 ancestral Saccharum species, leading to severe inbreeding among varieties. Consequently, new varieties struggle to achieve significant breakthroughs in yield, sugar content, and resistance traits [7]. The narrow genetic base constitutes a major challenge confronting the global sugarcane breeding community.

To broaden the genetic base and enhance the genetic diversity of sugarcane, the sugarcane breeding community places significant emphasis on the collection, research, and utilization of sugarcane germplasm resources. Besides S. spontaneum, species such as Erianthus arundinaceus [8,9], Erianthus rockii [10], and Erianthus fulvus [11,12], as close relatives of sugarcane, possess valuable traits including strong adaptability and stress tolerance. These species serve as important progenitor materials for sugarcane variety improvement, and the introgression of some wild genetic material has been successfully achieved. However, their hybridization efficiency remains low, and progress is slow, and no commercial sugarcane varieties containing their genetic ancestry have been developed to date.

Studies show that S. spontaneum has rich genetic diversity, with China as one of its significant centers of origin and diversity [13]. Huang et al. [14] evaluated phenotypic trait diversity of S. spontaneum from different Chinese regions, revealing substantial genetic variation across multiple traits, with the highest diversity found in Yunnan accessions. Liu Jianle et al. [15] confirmed rich DNA-level genetic diversity of Chinese S. spontaneum resources using inter simple sequence repeat (ISSR) markers. Evaluations and analyses of phenotypic traits by Qi [16] similarly indicated its abundant genetic diversity. Aitken et al. [17] used amplified fragment length polymorphism (AFLP) markers to analyze the genetic diversity of 430 S. spontaneum accessions from 21 countries and 255 sugarcane cultivars, confirmed that Chinese S. spontaneum accessions have significantly greater genetic diversity than others globally. This underscores the considerable breeding value of Chinese S. spontaneum resources.

Furthermore, S. spontaneum has a wide range of chromosome number types. Cai et al. [18], Li et al. [19], Wen et al. [20], and Wang et al. [21] conducted cytological studies on S. spontaneum materials from regions including Yunnan, Sichuan, Fujian, Guangdong, Guizhou, Jiangxi, and Myanmar. Their results identified 17 distinct chromosome number types: 2n = 48, 56, 60, 64, 70, 72, 76, 78, 80, 84, 88, 90, 92, 96, 102, 104, and 108. As cytological investigations continue on more diverse S. spontaneum materials, more chromosome number types are being discovered. This extensive cytogenetic diversity further confirms its rich genetic variation and suggests that S. spontaneum has likely undergone a complex evolutionary history.

Genomic studies of S. spontaneum show its genome harbors many key genes valuable for breeding. For instance, Dijoux et al. [22] did a genome-wide association study (GWAS) on 568 modern sugarcane hybrids (Saccharum officinarum × S. spontaneum) and identified six quantitative trait loci (QTLs) associated with resistance to orange rust, five of which carried resistance alleles directly derived from S. spontaneum, highlighting its prominent value in genetic improvement for disease resistance. Regarding quality traits, Zhao et al. [23] confirmed through subgenome-level annotated full-length transcriptome studies that the S. spontaneum subgenome significantly contributes to sucrose accumulation. Furthermore, Jiang et al. [24] analyzed differentially expressed genes (DEGs) along leaf developmental gradients and diurnal rhythms to construct gene co-expression networks. Their findings revealed that, compared to S. officinarum, S. spontaneum exhibits not only significant enrichment of photosynthesis-related genes but also a more complex regulatory network, demonstrating its superior photosynthetic efficiency. Collectively, these studies illustrate the critical role of S. spontaneum as a vital genetic resource in modern sugarcane breeding, spanning multiple dimensions such as disease resistance, sucrose accumulation, and photosynthetic capability.

S. spontaneum is the most successfully utilized wild species in sugarcane hybrid breeding. In the 1920s, Indian breeders developed varieties such as CO281, CO290, and CO213 by crossing Indian S. spontaneum with Saccharum officinarum, which were subsequently cultivated extensively in the region [25]. By the mid-20th century, Chinese breeders had developed foundational parental lines like Yacheng, Yunrui, and Yunzhe using S. spontaneum accessions from Yacheng and Yunnan provinces. These parental lines have contributed to the development of 32 commercial sugarcane varieties, making significant contributions to progress in China’s sugarcane breeding [26,27,28].

However, the utilization of S. spontaneum resources remains limited. Firstly, only a very small number of accessions have been exploited. Liu et al. [29] analyzed the pedigree of 20 key parental lines used in mainland China’s sugarcane hybrid breeding, revealing that only four Indian and four Chinese S. spontaneum accessions have been utilized. Yet over 1000 such accessions are currently conserved in the China National Sugarcane Germplasm Nursery, leaving most unexploited. Secondly, The historical utilization efficiency of S. spontaneum has been low. The current primary strategy involves crossing S. spontaneum with sugarcane, screening the progeny for superior materials, and performing repeated backcrosses to sugarcane to develop elite parental lines introgressed with genetic contributions from S. spontaneum. Due to the difficulty of natural flowering in sugarcane, artificial photoperiod induction is often required. This induction process is protracted (approximately one year), and is coupled with the brief flowering periods of parental lines (typically no longer than one week). Consequently, each hybridization event demands substantial time, labor, and resources. Furthermore, each breeding cycle typically introgresses only one S. spontaneum accession’s genetic contribution, severely limiting utilization numbers. This limitation has prevented the full exploitation of the immense breeding potential inherent in S. spontaneum for sugarcane improvement. Finally, the traditional utilization approach directly employs naturally selected S. spontaneum accessions in hybridization without prior improvement. These wild accessions represent the outcome of natural selection; their trait levels have not been subjected to systematic enhancement. In contrast, modern sugarcane cultivars have undergone progressive trait integration and improvement through hybridization and artificial selection. This century-old direct utilization paradigm may be a key factor constraining the realization of its vast breeding potential.

We hypothesize that by aggregating different S. spontaneum resources through multi-generation recurrent hybridization, a new type of S. spontaneum population with a broader genetic base and aggregated favorable traits can be developed, thereby significantly enhancing its utilization efficiency and potential in sugarcane breeding. This approach is grounded in the core principle of nobilization—the introgression of wild S. spontaneum genes into commercial sugarcane—but extends it through a critical pre-breeding phase focused on enhancing the wild progenitor itself. To overcome these limitations, our research group adopted a novel strategy distinct from traditional methods. We first carried out the improvement of S. spontaneum through cyclic hybridization selection technology prior to its use in interspecific crossing, creating S. spontaneum polymer populations that contain bloodlines from multiple S. spontaneum accessions and exhibit enhanced genetic characteristics. These enhanced pools are then crossed with sugarcane to develop elite parental lines introgressed with multiple S. spontaneum ancestries for sugarcane genetic improvement. Through preliminary research, our group has successfully developed several populations of S. spontaneum polymer introgressed with genetic material from four wild accessions. To further evaluate the genetic diversity level within these newly developed populations, this study employed 20 SSR markers to genotype 199 S. spontaneum polymer materials. Population genetic diversity parameters were analyzed to assess the diversity across different generations of the S. spontaneum polymer populations. This evaluation provides valuable insights to support the further exploration and innovative utilization of S. spontaneum’s breeding potential.

2. Materials and Methods

2.1. Plant Materials

A base population was established using six wild S. spontaneum accessions with high biomass yield from diverse habitats. Hybridizations generated three populations: Yunnan 82-1 × 2017-22 (Population A), Yenan 2 hao × 2017-12-165 (Population B), and Yunnan 8 hao × 2017-41 (Population C). Superior individuals (A1, B1, B2, C1, C2) were selected from the F₁ generation to establish the first-cycle selection population. Subsequent crosses produced advanced populations A1 × B1, A1 × C1, and B2 × C2 (Figure 1). Thirty individuals from F₁/F₂ S. spontaneum polymer were randomly sampled per population (29 from Population C), supplemented with 6 F₁ parents, 5 F₂ parents, and 9 wild S. spontaneum accessions, totaling 199 materials. All accessions were container-grown at Yunnan Academy of Agricultural Sciences Sugarcane Research Institute (February–November 2022). Fresh leaves collected at the tillering stage were stored at −25 °C. Material characteristics are shown in

Table 1. Basic information of 199 S. spontaneum accessions.

Parent	F1			F2
	A	B	C	A1 × B1	A1 × C1	B2 × C2
A1Q	A1	B6	C1	A1 × B1-2	A1 × C1-1	B2 × C2-1
A2Q	A2	B3	C3	A1 × B1-3	A1 × C1-2	B2 × C2-2
B1Q	A3	B4	C5	A1 × B1-4	A1 × C1-3	B2 × C2-3
B2Q	A4	B8	C6	A1 × B1-5	A1 × C1-4	B2 × C2-4
C1Q	A5	B9	C7	A1 × B1-6	A1 × C1-5	B2 × C2-5
C2Q	A7	B12	C8	A1 × B1-7	A1 × C1-6	B2 × C2-6
Yunnan82-1	A8	B16	C9	A1 × B1-8	A1 × C1-7	B2 × C2-7
Yuenan 2 hao	A9	B21	C11	A1 × B1-9	A1 × C1-8	B2 × C2-8
2017-12-165	A10	B22	C12	A1 × B1-10	A1 × C1-9	B2 × C2-9
2017-26	A11	B28	C14	A1 × B1-11	A1 × C1-10	B2 × C2-10
Yunnan 8 hao	A12	B39	C15	A1 × B1-12	A1 × C1-11	B2 × C2-11
YND 2015-83	A15	B44	C16	A1 × B1-13	A1 × C1-12	B2 × C2-12
Yuenan 1 hao	A17	B47	C17	A1 × B1-14	A1 × C1-13	B2 × C2-13
Ye114	A18	B50	C18	A1 × B1-15	A1 × C1-14	B2 × C2-14
Yunnan 82-114	A19	B53	C19	A1 × B1-16	A1 × C1-15	B2 × C2-15
Laowo 2 hao	A21	B54	C20	A1 × B1-17	A1 × C1-16	B2 × C2-16
Ruili 06-7-2	A23	B58	C21	A1 × B1-18	A1 × C1-17	B2 × C2-17
2017-41	A25	B59	C22	A1 × B1-19	A1 × C1-18	B2 × C2-18
Yunnan 76-3-18	A26	B60	C23	A1 × B1-20	A1 × C1-19	B2 × C2-19
2017-22	A27	B61	C24	A1 × B1–21	A1 × C1-20	B2 × C2-20
	A29	B66	C25	A1 × B1-22	A1 × C1-21	B2 × C2-21
	A30	B71	C26	A1 × B1-23	A1 × C1-22	B2 × C2-22
	A31	B74	C27	A1 × B1-24	A1 × C1-23	B2 × C2-23
	A33	B75	C28	A1 × B1-25	A1 × C1-24	B2 × C2-24
	A34	B77	C29	A1 × B1-26	A1 × C1-25	B2 × C2-25
	A39	B87	C30	A1 × B1-27	A1 × C1-26	B2 × C2-26
	A40	B89	C31	A1 × B1-28	A1 × C1-27	B2 × C2-27
	A42	B90	C33	A1 × B1-29	A1 × C1-28	B2 × C2-28
	A43	B92	C34	A1 × B1-30	A1 × C1-29	B2 × C2-29
	A60	B99		A1 × B1-31	A1 × C1-30	B2 × C2-30

.

2.2. Experimental Methods

2.2.1. DNA Extraction

The leaves of the S. spontaneum were ground in liquid nitrogen, and DNA extracted using the Tiangen Fast Plant Genomic DNA Extraction System (DP321) kit (Tiangen Biotech (Beijing) Co., Ltd., Beijing, China). The DNA samples were subjected to quality control and concentration estimation using agarose electrophoresis along with a One Drop™ OD-1000+ spectrophotometer (Nanjing Wuyi Technology Co., Ltd., Nanjing, China), with sample quality requirements as follows: A260/A280 = 1.6~2.2, A260/A230 = 1.5~2.0. DNA samples meeting the standards will be used for subsequent experiments.

2.2.2. PCR Amplification and Product Detection

Based on the SSR primer information published by the International Consortium of Sugarcane Biotechnology and with reference to relevant literature [30], 30 pairs of highly polymorphic SSR primers were selected for this study. Capillary electrophoresis was performed using these 30 SSR primer pairs to analyze DNA extracted from 19 S. spontaneum polymer materials representing different populations. By comprehensively comparing the polymorphism information content (PIC, >0.75), stability, and reproducibility of each primer pair, 20 pairs of well-performing SSR primers were ultimately selected (

Table 2. Name and sequence of 20 pairs of SSR primer.

Names of Primers	Forward Primer Sequence (5′-3′)	Reverse Primer Sequence (5′-3′)	Tm (°C)
mSSCIR3	ATAGCTCCCACACCAAATGC	GGACTACTCCACAATGATGC	54
mSSCIR9	TCTCTATGCACCCTATCGT	TAACTTGACCCCCTCTTGA	50
mSSCIR16	TGGGGAGGGCTGACTAGA	GGCGGTATATATGCTGTG	54
mSSCIR19	GGTTCCAAAATACACAAA	CAATCTTATCTACGCACTT	52
mSSCIR21	CGCCAGCCACATAAAAGG	CGACCAGGAGTTCATCAA	54
mSSCIR26	AAAATCAGACAAACAGCAT	AGAAGAAGCAGATACAGGT	48
mSSCIR34	ATCGCCTCCACTAAATAAT	TTGTCTTTGCTTCCTCCTC	54
mSSCIR36	CAACAATAACTTAACTGGTA	CTGTCCTTTTTATTCTCTTT	54
mSSCIR47	GCAATGGAGGTAGGAATG	TAGAATCACCCAAAAATAAA	48
mSSCIR53	TGGTCTACTGAAGTTCGTG	TGCTTCTAAGTCAACCAAA	50
mSSCIR56	ATTTGACGCTACGATGGTG	ATCCGTTTTTCAGCAGAGC	52
SMC1047	TGAGCCTAAGCCAGAAAGAAG	GGAACTAATTTCCTACGAGAACAC	50
SMC119CG	TTCATCTCTAGCCTACCCCAA	AGCAGCCATTTACCCAGGA	54
SMC1237	TTCACGAACACCCCACCTA	GCGCCAGGTAACCTACTGAA	58
SMC1752	GGCTGATTTACATGAAACTGTTCT	AAAGCTGGTATCCCAGCATACT	64
SMC1814	GGTTGACGATGAGAAGGACGTG	CACCCACATAGTGCCCAACG	64
SMC22	CCATTCGACGAAAGCGTCCT	CAAGCGTTGTGCTGCCGAGT	62
SMC278	TTCTAGTGCCAATCCATCTCAGA	CATGCCAACTTCCAAACAGACT	50
SMC640	TTAAGAGACCCGCCTTTGGAA	TGCCAGAAGTGGTTGTGCTCA	62
SMC720BS	CGCACCGACGCACGTCT	GCCAATGGAACGGGTCTA	58

). The primers were commercially synthesized by General Biol (Anhui) Co., Ltd. (Chuzhou, China).

M13F-FAM was used as a fluorescent modification label, and SSR loci were detected based on the fluorescence color. PCR amplification was performed using a LongGene ArtGene™ A100 PCR thermal cycler (LongGene, Hangzhou, China) with a heating rate of 5 °C/s. T5 DNA Polymerase (Tsingke Biotechnology, Beijing, China) was used for all amplification reactions.

PCR reaction system: 1 µL template DNA, 1.5 µL 10 buffer, 1.5 µL MgCl₂ (25 mmol/L), 0.3 µL DNTP (10 mmol/L), 0.15 µL per primer (10 µmol/L), 0.3 µL Taq enzyme (5 µ/µL), and ddH₂O to 15 µL.

PCR amplification procedure: 94 °C pre-denaturation for 3 min; 94 °C denaturation for 15 s, 55 °C annealing for 15 s, and 72 °C extension for 30 s, for a total of 35 cycles; 72 °C for 3 min.

2.2.3. Detection by Capillary Electrophoresis

The concentration of the PCR product was estimated based on the agarose gel electrophoresis results, and the product was diluted 10 times and mixed with Salmon 500 internal standard (sizes 65, 75, 90, 100, 115, 135, 150, 160, 180, 200, 225, 250, 275, 300, 340, 350, 380, 400, 425, 450, 475, 490, 500). The product was placed on the sample rack of the ABI 3730XL sequencing machine (Applied Biosystems, Foster City, CA, USA) for capillary electrophoresis detection, and the SSR gene typing file was exported after completion.

HIDI	9.75 µL
Salmon 500 internal standard	0.75 µL
Diluted PCR product	1.00 µL

The mixture was treated at 95 °C for 5 min, followed by immediate ice bath for 2 min, then place on the sample rack of the ABI 3730XL sequencer for detection.

2.3. Data Statistics and Analysis

Use GeneMarker2.7 to genotype SSR loci and conduct secondary manual review [31], counting the total number of locis amplified by each pair of primers and the number of polymorphic locis. The PIC of SSR primers was calculated according to the method of Wu et al. [32]. The formula for calculating the PIC is: PIC = 1 − ∑P_i², where P_i is the frequency of the i-th allele.

Using NTSYS 2.11, calculate the Nei’72 genetic distance between different S. spontaneum materials, and construct a UPGMA cluster diagram using MEGA 10.0.5 software. Then annotate it using iTOL. Using Excel 2019 for Visual Analysis of Genetic Distance and Genetic Analysis of SSR Loci. The number of polymorphic loci (NPB), percentage of polymorphic alleles (PPB), number of observed alleles (Na), effective number of alleles (Ne) [33], Nei’s (1973) genetic diversity index (H) and Shannon information index (I) [34] were calculated using Popgen32 for each population. Use SPSS 23 software to perform a one-way analysis of variance (ANOVA) on the genetic diversity parameters among populations.

3. Results

3.1. SSR Primer Polymorphism Analysis

According to

Table 3. 20 pairs of SSR detection results of sugarcane primer.

Primer Name	Total Loci	Number of Polymorphic Locis	PPB/%	PIC
mSSCIR1	10	10	100.00	0.8507
mSSCIR3	9	9	100.00	0.8409
mSSCIR9	9	9	100.00	0.7909
mSSCIR16	8	8	100.00	0.8261
mSSCIR19	17	17	100.00	0.9605
mSSCIR21	16	16	100.00	0.9749
mSSCIR26	12	12	100.00	0.9149
mSSCIR34	7	7	100.00	0.8162
mSSCIR36	13	13	100.00	0.9096
mSSCIR52	15	15	100.00	0.8971
mSSCIR53	9	9	100.00	0.8752
mSSCIR56	19	19	100.00	0.8989
SMC1047	13	13	100.00	0.8977
SMC1752	10	9	90.00	0.8656
SMC22	12	12	100.00	0.8898
SMC119CG	21	21	100.00	0.9451
SMC278	12	11	91.67	0.8704
SMC286	13	13	100.00	0.8615
SMC851	10	10	100.00	0.8783
SMC2055	12	12	100.00	0.8884
total	247	245
average	12.35	12.25	99.08	0.8826

Note: PIC = 1 − ∑P_i², where P_i is the frequency of the i-th allele.

, the 20 SSR primers collectively amplified 247 loci across 199 S. spontaneum accessions, with 245 polymorphic loci detected. Primer amplification capacity ranged from 7 to 21 loci per pair (mean = 12.35), while polymorphic loci averaged 12.25 per primer. Eighteen primers exhibited a 100% polymorphism rates; exceptions included SMC1752 (90.00%) and SMC278 (91.67%). PIC values spanned 0.7909–0.9749 with a mean of 0.8826, confirming the primers’ effectiveness in capturing the germplasm’s genetic diversity.

3.2. Cluster Analysis

3.2.1. Genetic Distance Analysis

Genetic distance analysis using NTSYS 2.11 software on SSR marker data from 199 S. spontaneum accessions yielded 19,701 pairwise Nei’s (1972) genetic distance values among 191 accessions (Figure 2). These values ranged from 0.0961 to 2.2038, with a mean of 0.8429. The highest individual genetic distance (GD = 2.2038) was observed between accession B92 and A1 × C1-5, followed by B92 and A1 × C1-22 (GD = 2.1065). Subsequent maximum values occurred between B21 and Yunnan 82-114 (GD = 2.0807), A7 (GD = 2.0676), Yunnongda 2015-83 (GD = 2.0331), and B16 and A1 × B1-31 (GD = 2.0266). Notably, all six highest genetic distances involved accessions from Population B paired with accessions other different populations. At the population level, the greatest mean genetic distance existed between Population B and Population A (GD = 1.1984), followed by Population B and the A1 × B1 population (GD = 1.1327), and Population B and the A1 × C1 population (GD = 1.1216). These results demonstrate that accessions within Population B generally exhibit substantial genetic distances from those in other populations, indicating significant genetic divergence.

3.2.2. Cluster Analysis Based on SSR Molecular Markers

UPGMA clustering analysis (Figure 3) showed that all accessions segregated into seven clusters, consistent with their original population affiliations: Original Parent Cluster, Cluster A, Cluster B, Cluster C, Cluster A1 × B1, Cluster A1 × C1, and Cluster B2 × C2. Clusters A, B, A1 × B1, and A1 × C1 exclusively comprised accessions from their corresponding populations. Accession B39 clustered with the B2 × C2 population in Cluster B2 × C2, while B3 and accessions from Population C grouped within Cluster C. A1Q, A2Q, A1, A10, B4, B6, C1, C3, A1 × B1-2, A1 × B1-3, A1 × B1-4, A1 × C1-1, A1 × C1-30, B2 × C2-1, B2 × C2-2, B2 × C2-3 and accessions from original parent population coalesced into the Original parent cluster.

Further analysis (

Table 4. Statistics of accessions distribution in cluster graph.

Population	Number of Population	Number of Cluster	Same Number	Similarity Rate
original parent	14	31	14	100.00
Progeny population parent	6		2	30.00
A	30	28	28	93.33
B	30	28	26	86.67
C	29	30	28	96.55
A1 × B1	30	28	27	90.00
A1 × C1	30	26	26	86.67
B2 × C2	30	28	27	90.00

) revealed cluster composition fidelity: The Original parent Cluster contained 100% of original S. spontaneum accessions (S0); Cluster A comprised 93.33% of Population A accessions; Cluster B encompassed 86.67% of Population B; Cluster C included 96.55% of Population C; Cluster A1 × B1 incorporated 90.00% of the A1 × B1 population; Cluster A1 × C1 contained 86.67% of the A1 × C1 population; Cluster B2 × C2 represented 90.00% of the B2 × C2 population.

3.3. Genetic Diversity Analysis

The effective number of alleles (Ne), Nei’s gene diversity (H), and Shannon’s information index (I) were employed to assess genetic diversity levels, reflecting allele abundance and evenness within populations [35]. As presented in

Table 5. Index of genetic diversity for 199 S. spontaneum accessions.

Population	Number of Accessions	NPB	PPB (%)	Na	Ne	H	I
parent	14	225	88.93%	1.8893	1.5163	0.3041 a	0.4578 a
A	32	223	88.14%	1.8814	1.4226	0.2568 b	0.3969 b
B	32	211	83.40%	1.8340	1.3821	0.2329 bc	0.3624 bc
C	31	221	83.40%	1.8340	1.4030	0.2423 bc	0.374 bc
A1 × B1	30	186	73.52%	1.7352	1.3043	0.1931 d	0.3061 d
A1 × C1	30	223	88.14%	1.8814	1.3554	0.223 cd	0.3536 c
B2 × C2	30	226	89.33%	1.8933	1.4977	0.2910 a	0.4390 a
total	199	253	100.00%	2.0000	1.5787	0.3390	0.5082

Note: Different lowercase letters within the same column indicate significant differences (p < 0.05) according to the statistical analysis.

, across the seven S. Spontaneum populations, the number of polymorphic loci (NPB) ranged from 186 to 226, with the percentage of polymorphic alleles (PPB) spanning 73.52% to 89.33%. The mean effective allele number per SSR locus was 1.3573. Nei’s genetic diversity index (H) varied between 0.1931 and 0.3041, while Shannon’s information index (I) ranged from 0.3061 to 0.4578. Among which, the Nei’s diversity index and Shannon information index of the parental population and the B2 × C2 population were significantly higher than those of the other populations.

3.4. Genetic Analysis of SSR Loci

Electrophoretic profiles of Populations A, B, C, A1 × B1, A1 × C1, and B2 × C2 were comparatively analyzed against their parental lines (S1 population vs. founder accessions; S2 population vs. S1 parental lines). Key findings (

Table 6. Statistical analysis of the number and proportion of mutations in each population and their parents.

Population	ML	No. SPL	No. MIL	No. PIL	APL	TPL	MR (%)	MH (%)	PH (%)
A	17.22	18.66	17.84	21.94	75.66	150.00	22.61 ± 1.71	48.67	36.24
B	16.13	24.31	6.75	12.66	59.84	121.00	26.81 ± 2.19	37.42	38.91
C	23.03	25.00	31.94	11.13	91.10	144.00	23.62 ± 1.42	49.94	45.16
average	18.79	22.66	18.84	15.24	75.53	138.33	24.35	45.34	40.11
A1 × B1	11.97	27.27	30.53	5.53	75.30	150.00	16.52 ± 1.82	46.61	42.60
A1 × C1	9.80	29.37	35.60	5.20	79.97	150.00	12.02 ± 1.58	52.39	49.38
B2 × C2	24.43	23.60	18.53	18.17	84.73	122.00	28.51 ± 1.51	52.67	52.21
average	15.40	26.75	28.22	9.630	80.00	140.67	19.02	50.56	48.06

Note: ML (Mutation Loci) refers to the number of loci present in the offspring that are not present in the parents. No. SPL (Number of Shared Parental Loci) refer to the number of loci shared by parents and offspring. No. M/PIL (Number of Maternally/Paternally Inherited Loci) refer to the number of loci that are inherited from only the male or female parent in the offspring. APL (Average Population Loci) refers to the average number of loci per population. TPL (Total Parental Loci) refers to the total number of loci amplified from the parents. MR (Mutation rate) refers to the ratio of mutation loci to the total number of loci in the population. MP/H (Paternal/maternal heritability) refers to the ratio of paternal/maternal locus to offspring.

) revealed:

Population A averaged 75.66 loci with 17.22 novel mutations (mutation rate: 22.76%) and 150 loci shared between parents. Population B exhibited 59.84 loci containing 16.13 novel mutations (26.95%) and 121 shared parental loci. Population C demonstrated 91.10 loci featuring 23.03 novel mutations (25.28%) with 144 shared parental loci. The S1 population inherited 18.84 loci maternally (45.34% transmission rate) and 15.24 paternally (40.11% transmission rate). Population A1 × B1 displayed 75.30 loci including 11.97 novel mutations (15.89%) and 150 shared parental loci. Population A1 × C1 contained 79.97 loci with 9.80 novel mutations (12.26%) and 150 shared parental loci. Population B2 × C2 averaged 84.73 loci comprising 24.43 novel mutations (28.84%) and 122 loci shared with original parent. The S2 population inherited 28.22 loci maternally (50.56% transmission rate) and 9.63 paternally (48.06% transmission rate).

4. Discussion

As a critical genetic parameter, PIC serves as a key metric for evaluating primer discriminatory power and assessing marker informativeness in genetic diversity studies. Previous studies have indicated that when the PIC > 0.5, the primer is considered highly polymorphic and can serve as a polymorphic marker for genetic studies [36]. In a study by Parthiban et al. [37] utilizing 25 pairs of SSR primers to assess the genetic diversity of 59 sugarcane materials, the average PIC value was 0.72. In another study by Luzaran et al. [38] employing 21 pairs of SSR primers to evaluate the genetic diversity of 61 sugarcane materials, the average PIC value was 0.80. In our study, all 20 SSR primers exhibited PIC values ranging from 0.7909 to 0.9749 (mean PIC = 0.8826), substantially exceeding the 0.5 threshold. These results confirm the high polymorphism level of the primer set, demonstrating its capacity to provide rich genetic information for revealing diversity patterns within S. spontaneum polymer.

During the development of S. spontaneum polymer, novel mutations emerged in the polymer compared to their parental lines. Analysis revealed that the S1 population generated an average of 18.79 novel mutations versus its parents (mutation rate: 25.00%). Subsequently, the S2 population exhibited 15.40 novel mutations relative to its parents (mutation rate: 19.00%). This mutation rate is significantly higher than the 0–21.1% SSR locus mutation rate reported by Wu Jinfeng [39] in novel Brassica napus varieties (F1 hybrids between synthetic and cultivated rapeseed) and the 1.9% SSR locus mutation rate observed in a doubled haploid (DH) line of cabbage by Ellegren et al. [40], indicating that S. spontaneum exhibits a strong capacity for genetic variation during hybridization, substantially enriching its genetic background. The appearance of novel electrophoretic locis in hybrid progenies was postulated by Wu Xuewei et al. [41] to result from unequal chromosomal exchanges during gametogenesis. Ayliffe [42] experimentally demonstrated that these novel mutations originate from heteroduplex formation between allelic nucleotide sequences of divergent lengths. Hybridization-induced genetic introgression facilitates novel genotypic combinations and ecotype formation [43], enhancing genetic variation and thereby elevating S. spontaneum diversity. Subsequent phenotypic analyses showed that the S. spontaneum polymer significantly outperformed the original S. spontaneum in key traits such as plant height, stalk diameter, number of valid stalks per clump, brix, leaf width, single stalk weight, number of valid stalks per acre, and yield per acre. These improvements are likely associated with the introduction of new mutation loci, though the specific genetic mechanisms require further investigation. We observed a decrease in the mutation rate from 25.00% in the S1 population to 19.00% in the S2 population, which may hold several biological implications. First, the parental materials used for S1 were sourced from different habitats (while S2 parents were selected from the same habitat), resulting in greater genetic background divergence that likely predisposed the genome to structural variations and a higher rate of new mutation loci. The change in mutation rate may also suggest that the S2 population is gradually achieving genetic stability. The high mutation rate in the early stage (S1) facilitates rapid generation of genetic variation, providing a foundation for screening superior traits; the subsequent decline in the mutation rate (S2) may help preserve beneficial alleles already acquired, reduce the incidence of deleterious mutations, and thereby promote overall improvement in agronomic traits in the polymer population. Furthermore, across six populations, both the mean number of maternally inherited loci and maternal transmission rates exceeded paternal counterparts, indicating maternal inheritance bias—consistent with Tian Chunyan et al.’s findings [44]. Thus, parental selection for germplasm utilization should prioritize accessions exhibiting superior comprehensive agronomic traits as the maternal parent to more efficiently aggregate favorable alleles and enhance breeding efficiency.

Cluster analysis, based on genetic similarity coefficients or genetic distances, reflects phylogenetic relationships among accessions. All materials can be divided into seven groups based on genetic distance, which is consistent with the population division of the tested materials, and significant genetic differences exist between populations. Further examination revealed: the Original parent Cluster comprised 100% of original S. spontaneum accessions (S0); Cluster A encompassed 93.30% of Population A individuals; Cluster B included 87.00% of Population B; Cluster C contained 93.10% of Population C; Cluster A1 × B1 incorporated 90.00% of the A1 × B1 population; Cluster A1 × C1 represented 87.00% of the A1 × C1 population; Cluster B2 × C2 accounted for 90.00% of the B2 × C2 population. These results demonstrate that the polymer development strategy—through systematic incorporation and recombination of the original parent—effectively broadened the genetic background of progeny, increasing heterozygosity relative to parental lines and enhancing overall genetic variability.

Genetic diversity parameters can reflect the level of genetic variation between different populations within a species and between different individuals within a population [45]. Nei’s genetic diversity (H) index and Shannon information (I) index reflect the evenness and genetic richness of a population. Higher values of these indices indicate a greater capacity for genetic variation and richer diversity within a population. In studies related to Saccharum and its closely related species, these indices are widely used for the genetic evaluation of germplasm resources. For example, Zheng Yifeng [46] found that the Nei’s genetic diversity index and Shannon information index of 116 sugarcane parent materials were 0.178 and 0.288, respectively. You Qian [47] analyzed the genetic diversity of 181 sugarcane germplasm and found that its Nei’s genetic diversity index was 0.2078 and Shannon information index was 0.3252. Huang Yuxin et al. [48] studied 183 E. arundinaceus germplasm resources from Guangxi and found an average Shannon information index of 0.3070. Ali et al. [49] also reported Shannon information indices ranging from 0.28 to 0.50 for S. officinarum, S. robustum, S. barberi, S. sinense, and E. arundinaceus. In this study, the Nei’s genetic diversity index and Shannon information index for 199 S. spontaneum accessions were 0.3390 and 0.5082, respectively, significantly higher than those of most aforementioned sugarcane and related germplasm resources. This indicates that this S. spontaneum polymer possesses extremely rich genetic diversity. As an important wild parent in sugarcane breeding, this result highlights the great potential of S. spontaneum in broadening the genetic base of cultivated varieties. Therefore, selecting individuals with superior comprehensive traits from this population as parents will help introduce new favorable alleles, providing important resources for the genetic improvement of sugarcane varieties.

5. Conclusions

In summary, the development of S. spontaneum polymer has substantially expanded the genetic background of hybrid progeny through systematic incorporation and recombination of the original parents, thereby increasing the genetic heterogeneity between the offspring and the parents lines. Moreover, due to hybridization and recombination, the polymer produced new prominent loci compared to its parents. It can be said that the overall genetic background and diversity of the polymer populations have been further enriched compared to the original parents, and the genetic diversity and genetic background of the hybrid offspring of the polymers and commercial parents will also be further enriched and expanded.