Next Article in Journal
Soil Hydraulic Properties Estimated from Evaporation Experiment Monitored by Low-Cost Sensors
Previous Article in Journal
The Development of a Transformation System for Four Local Rice Varieties and CRISPR/Cas9-Mediated Editing of the OsCCD7 Gene
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 15
Issue 8
10.3390/agronomy15082010
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Continuous Cropping Duration Alters Green Pepper Root Exudate Composition and Triggers Rhizosphere Feedback Inhibition

by
Zhou Li
1,
Dongmei Lian
1,
Shaoping Zhang
1,
Yunfa Yao
1,
Bizhen Lin
1,
Jianji Hong
1,
Songhai Wu
1,* and
Honghong Li
2,*
1
Institute of Subtropical Agriculture, Fujian Academy of Agricultural Sciences, Zhangzhou 363005, China
2
School of History and Geography, Minnan Normal University, Zhangzhou 363000, China
*
Authors to whom correspondence should be addressed.
Agronomy 2025, 15(8), 2010; https://doi.org/10.3390/agronomy15082010
Submission received: 20 June 2025 / Revised: 26 July 2025 / Accepted: 19 August 2025 / Published: 21 August 2025
(This article belongs to the Section Agricultural Biosystem and Biological Engineering)
Browse Figures
Versions Notes

Abstract

Continuous cropping poses a significant threat to sustainable pepper production by triggering soil degradation and growth inhibition, yet the role of root exudates in this process remains unclear. This study aimed to elucidate how continuous cropping duration (0, 1, 2, and 6 years) alters root exudate composition and drives rhizosphere feedback in green pepper. Pot experiments revealed that long-term continuous cropping (6 years) severely inhibited pepper growth, reducing photosynthetic rate (32.02%), chlorophyll content (12.26%), plant height (23.89%), and yield (42.37%). Critically, the relative abundance of 3,4-dimethylbenzaldehyde in root exudates increased progressively with cropping duration. Exogenous application of this compound or long-term monoculture extracts reduced soil pH and increased electrical conductivity, altered the rhizosphere microbial community (notably decreasing Proteobacteria abundance and fungal diversity while increasing Bacteroidota and Firmicutes), and significantly inhibited root development and vitality. Correlation analysis indicated that fungal communities were more responsive to soil property changes, while bacterial communities correlated more closely with root traits. This study demonstrates that the accumulation of specific root exudates, particularly 3,4-dimethylbenzaldehyde, is a key driver of continuous cropping obstacles in green pepper by disrupting rhizosphere microbial community structure and soil properties. This highlights the importance of managing root exudate dynamics, potentially through crop rotation or soil amendments, to mitigate these obstacles.

1. Introduction

Green pepper (Capsicum annuum L.) possesses a high nutritional value due to its rich content of polyphenols, capsaicin, and ascorbic acid [1]. This characteristic has established it as a widely cultivated vegetable crop of significant economic benefits. It has been reported that peppers constitute 11.36% of the total vegetable output value in China, with a contribution rate to farmers’ income of 1.14% [2]. However, with the expansion of green pepper production, the multiple cropping index has increased, leading to intensified challenges associated with long-term continuous cropping [3]. These challenges are manifested in soil degradation, a rise in soil-borne diseases, and a decline in both yield and quality [4,5,6]. Consequently, these factors pose a significant threat to the sustainable development of green pepper production. Thus, it is crucial to identify the key factors that impede the continuous cultivation of green pepper.
Continuous cropping obstacles refer to the decline in crop performance resulting from planting the same crop on the same land over successive years [7]. Continuous cropping obstacles were found in long-term multiple cropping of soybean (Glycine max (L.) Merr.) [8], medicinal plants [9,10], potato (Solanum tuberosum L.) [11], and tobacco (Nicotiana tabacum L.) [12]. Researchers observed that continuous cropping leads to a decline in soil pH, creating acidic conditions that promote the survival of root rot pathogens and increase soybean susceptibility to disease [8]. Continuous potato cropping shifted the rhizosphere microbial community toward conditions less conducive to plant growth [11]. Continuous cropping obstacles are complex and result from multiple stress factors within the plant–soil–microorganism system [9]. These can be summarized into three main aspects. First, a soil nutrient imbalance occurs, as long-term continuous cropping selectively depletes specific soil nutrients, resulting in nutrient deficiencies that further inhibit plant growth [13]. Second, autotoxicity arises when plants release chemical substances that inhibit the growth and development of conspecific plants [5,9]. Third, a soil microbial community imbalance develops; studies indicate that continuous cropping of potatoes for more than four years markedly altered the soil microbial communities, characterized by a significant decline in beneficial bacteria and an accumulation of pathogenic fungi [11]. These factors are interconnected and collectively contribute to the challenges associated with continuous cropping.
Root exudation processes serve as a significant carbon sink for plants, contributing up to 21% of net photosynthates, depending on species, growth stage, and nutrient availability [14]. Typically, root exudates consist of sugars, amino acids, organic acids, phenolic compounds, and high-molecular-weight compounds [15]. Furthermore, as a crucial medium for interactions between plants and the rhizosphere, root exudates have garnered considerable attention in studies associated with continuous cropping obstacles [16]. Previous studies have demonstrated significant differences in the root metabolites of sugar beets (Beta vulgaris L. var. saccharifera) under different continuous cropping years, with salicylaldehyde exhibiting progressive accumulation in root exudates as cropping duration increases [17]. Similarly, after five years of continuous peanut (Arachis hypogaea L.) cultivation, phenolic acid (aldehyde) allelochemicals, including p-hydroxybenzoic acid, phthalic acid, cinnamic acid, 2,5-dimethylbenzaldehyde, and 2,6-di-tert-butylphenol, showed a cumulative trend, with significant differences in total accumulation among different varieties [18]. Diallyl disulfide, secreted by garlic (Allium sativum L.) roots, enhances root activity and chlorophyll content in continuous tomato (Solanum lycopersicum L.) cropping plants, while inhibiting the release of fatty acid esters such as methyl palmitate and methyl oleate from tomato root exudates, thereby improving tomato resistance and promoting plant growth [19].
Root exudates are recognized as the main sources of carbon and energy for microbial growth in the rhizosphere and they can stimulate microorganisms to secrete extracellular proteases and hydrolases, thereby promoting the mineralization and decomposition of soil organic matter [20,21,22]. This process significantly influences nutrient uptake and utilization efficiency by both plants and associated microorganisms. On the other hand, through their distinct chemical components, root exudates exert selective recruitment or repellent effects, significantly shaping the structure, composition, and functional dynamics of rhizosphere microbial communities [23,24]. For example, the astaxanthin and L-proline in the root exudates of tomato inhibited biofilm formation and colonization by Ralstonia solanacearum on the root surface and root tissues [25]; in pigeon pea–maize intercropping systems, root exudate metabolites (including inositol, glycerol, proline, and arginine) regulate the cross-host migration of Ensifer fredii NGR234 [26]. This chemical recognition-based regulatory mechanism allows plants to actively shape their rhizospheric microecosystem, promoting growth and potentially enhancing protective functions [27].
The structure and composition of rhizosphere microbial communities serve as indicators of soil health, with shifts in their taxonomic abundance and diversity directly influencing soil microecological functions [28]. Long-term continuous cropping results in a decline in rhizosphere microbial diversity, marked by a reduction in beneficial microbial taxa and a proliferation of pathogenic microorganisms [11]. This imbalance disrupts soil nutrient cycling, resulting in diminished availability of readily absorbable nutrients [29]. It was reported that the soil in Fritillaria L. transitioned from a high-fertility “bacterial type” to a low-fertility “fungal type” as planting years increased [30]. This transition heightens the risk of pathogen infection, ultimately contributing to the onset of soil-borne diseases. The phenomenon of continuous cropping obstacles in pepper production is particularly prominent. Research shows that prolonged monoculture leads to a progressive decline in pepper yields, with reductions of up to 70% after ten years of continuous cropping; moreover, fruit quality deteriorates, disease incidence increases annually, and growers suffer substantial economic losses [31,32]. Continuous cropping also alters soil properties, including decreased pH and salinity levels, elevated nutrient content, increased mechanical stability of macroaggregates (but reduced water-stable aggregates), suppressed β-glucosidase activity, and enhanced nitrate reductase and alkaline phosphatase activities [33]. These changes in physical and chemical properties and enzyme activities indicate that continuous cropping can disrupt the soil ecological balance and affect its fertility. Despite these findings, the key factors driving these obstacles remain poorly understood. This study aims to (1) analyze changes in green pepper root exudates across different continuous cropping durations and (2) investigate the effects of key root exudate compounds on rhizosphere microbial dynamics through controlled pot experiments.

2. Materials and Methods

2.1. Study Location and Plant Cultivation

Two experiments were conducted in pots under greenhouse conditions at the experimental base of the Institute of Subtropical Agriculture, Fujian Academy of Agricultural Sciences (117°43′ E, 24°32′ N, altitude 18 m a.s.l.). The test material consisted of the widely cultivated, disease-resistant pepper variety in Fujian Province, “Hualong No. 5”. The experimental soil was collected from greenhouse pepper fields with different years of continuous cropping in Zhao’an County, Fujian Province, China (117°08′ E and 23°45′ N; 16 m a.s.l.), a typical green pepper production region. All sampling sites were located within a 200 m radius. The soil was classified as Stagnic Anthrosols according to the Chinese Soil Taxonomy, with a sandy loam texture. Detailed physical and chemical properties of the soils at each sampling site are provided in Supplementary Table S1. The pots, measuring 0.3 m in height, had inner diameters of 0.3 m at the top and 0.23 m at the bottom. Using pots allowed for better controlled irrigation and harvesting of the whole root system.

2.2. Different Years of Continuous Cropping Experiment

The experiment was conducted from September 2023 to April 2024, and four groups were set up and denoted as Y0 (first cropping), Y1 (1 year of continuous cropping), Y2 (2 years of continuous cropping), and Y6 (6 years of continuous cropping), with each group including 10 pots for replicates. Each pot was filled with 12 kg of sieved, air-dried soil, and two uniform seedlings of green pepper were transplanted at a spacing of 10 cm in 22 September 2023. Fertilization management followed recommendations from local farmers, with application rates adjusted for pot-scale conditions. Before transplanting, a basal dose was applied, consisting of 45 g of organic fertilizer (55% organic matter, 5% NPK) and 3 g of compound fertilizer (15-15-15) per pot. During the seedling stage, 0.7 g of compound fertilizer was top-dressed every 15 days. In the flowering and fruiting stages, weekly top-dressing included 0.7 g of compound fertilizer (15-15-15) and 0.4 g of high-potassium fertilizer (12-6-30) per pot. All management procedures are detailed in Supplementary Table S2.
During the full-fruit stage of pepper plants, leaf net photosynthetic rate was measured under sunny conditions using a portable photosynthesis meter (GFS-3000, Heinz Walz, Effeltrich, Germany) and leaf chlorophyll content was determined by using a chlorophyll meter (SPAD-502plus, Konica Minolta, Tokyo, Japan), while plant height, stem diameter, and leaf area were measured with a ruler, vernier caliper, and leaf area meter (YMJ-A, Tuopu Instrument Co., Ltd., Hangzhou, China), respectively. Fruit yield was calculated by harvesting and weighing all fruits throughout the growth period. Root exudate collection and GC-MS analysis followed the methodology outlined in previous studies [15,34]. The compounds were identified by comparing their mass spectra with those in the NIST library database. Metabolite identities were assigned to compounds exhibiting a similarity score >800 and a retention index (RI) deviation within ±30. Only annotated metabolites were included in the analysis, while unknown compounds were excluded.

2.3. Exogenous Addition of Root Exudate Experiment

2.3.1. Experimental Design

The pot experiment used the same sieved and air-dried soil as the Y0 treatment, which had never been planted with green peppers, and its cultivation management method referred to that described in Section 2.2. A total of four treatment groups were set up according to the different exogenous substances applied to the soil: CK (irrigated with distilled water), T1 (irrigated with soil extracts from 1-year continuously cropped pepper fields), T2 (irrigated with soil extracts from 6-year continuously cropped pepper fields), and T3 (irrigated with 3,4-dimethylbenzaldehyde solution). The preparation methods of the soil extracts were conducted as follows: rhizosphere soil samples of green pepper fields with different continuous cropping durations, collected from Zhao’an County, were mixed with sterile distilled water at a 1:2 ratio (soil/water, m/v), subjected to ultrasonic extraction for 2 h, and then placed in a shaker at 25 °C and 100 r·min−1 for 24 h. Subsequently, the mixture was centrifuged at 4000 rpm (RCF = 2500× g, R = 14.0 cm) for 20 min at 4 °C, and the supernatant was filtered through a 0.45 μm microporous membrane to obtain the stock solution of rhizosphere soil extract, which was subsequently stored at 4 °C. Based on the GC-MS quantitative analysis (Supplementary Figure S1), the concentration of 3,4-dimethylbenzaldehyde was highest in the soil extract from the long-term continuous cropping field (T2). To ensure comparability of the biological effects, the concentration of the stock solution for the T3 treatment was standardized to match that of T2 (151.5 mg·L−1). After transplanting green pepper seedlings into pots on 26 September 2024, each stock solution was diluted tenfold and applied as an irrigation solution at a rate of 100 mL per pot every 3–4 days until the onset of flowering (7 November 2024), resulting in a total of 12 irrigation events. Each treatment was replicated three times. Upon completion of the experiment, samples were collected for measurement and analysis.

2.3.2. Sampling and Analysis

We removed the pepper plants from the pots and, using a sterilized pointed blade, removed soil distal to the root system. We collected rhizosphere soil adhering to roots and stored it in labeled zip-lock bags for transport. We subdivided samples in the laboratory for physicochemical property analysis and microbial assays. Subsequently, we rinsed the plant roots with distilled water until all soil was removed, then transferred the cleaned roots into fresh bags containing distilled water for transport to the laboratory. We assessed root morphology (root length, surface area, diameter, and tip number) using an Epson root scanner (Epson Perfection V850 Pro, Seiko Epson Corporation, Tokyo, Japan) and WINRHIZO root analysis system (WinRhizo Pro 2013b, Regent Instruments Inc., Quebec, QC, Canada). We measured root activity via triphenyl tetrazolium chloride (TTC) reduction intensity. The remaining root samples were placed into an oven at 105 °C for 30 min, then dried at 70 °C until a constant weight was achieved to determine root dry weight. The soil pH was determined using a pH meter (PB-10, Sartorius, Goettingen, Germany), and electrical conductivity (EC) was determined using a conductivity meter (DDS-11C, San-Xin Instrumentation Inc., Shanghai, China). Soil ammonia nitrogen (NH4+-N) and nitrate nitrogen (NO3−-N) concentrations were determined by using the indophenol blue spectrophotometric method and UV spectrophotometry, respectively. The contents of available phosphorus (AP) and available potassium (AK) were determined using molybdenum-antimony colorimetry and flame atomic absorption spectrophotometry, respectively.

2.3.3. Extraction, Sequencing, Quantitative PCR, and Bioinformatics Analysis of Soil Total DNA

Total DNA was extracted from soil samples using the BioFast Soil Genomic DNA Extraction Kit (BioFlux, Hangzhou, China). DNA quality and concentration were assessed using a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). The extracted DNA was divided into two parts: one for bacterial 16S rRNA and fungal ITS region amplicon sequencing, and the other stored at −80 °C for subsequent microbial quantification. The full-length 16S rRNA gene was amplified using the universal bacterial primers 27F: AGRGTTTGATYNTGGCTCAG and 1492R: TASGGHTACCTTGTTASGACTT. Similarly, the full-length ITS rRNA gene was amplified with primers ITS1F: CTTGGTCATTTAGAGGAAGTAA and ITS4R: TCCTCCGCTTATTGATATGC. For sequencing, SMRTbell libraries were constructed and processed on the PacBio Sequel platform (Biomarker Technologies, Beijing, China) following established protocols [35]. To quantify Pseudomonas and Fusarium populations, quantitative PCR (qPCR) was performed using a LightCycler 96 real-time system (Roche, Basel, Switzerland), based on bacterial and fungal relative abundance data. The PCR primers and corresponding reaction conditions are detailed in Supplementary Tables S3 and S4 [36,37]. Each 20 μL qPCR reaction contained 0.5 μL of each primer (10 μM), 10 μL of 2× SYBR Green PCR Master Mix (TaKaRa Biotechnology, Dalian, China), and 1 μL of template DNA (10 ng of total soil DNA or serially diluted plasmid DNA for standard curves generation). All treatments were analyzed in quadruplicate.

2.4. Data Processing and Statistical Analysis

Data organization and statistical analyses were performed using Microsoft Excel 2019 (Microsoft, Redmond, WA, USA) and SPSS 19.0 (IBM, Armonk, NY, USA). Inter-group differences were assessed using the least significant difference (LSD) test, and data visualization was conducted using Origin 2024 software (OriginLab, Northampton, MA, USA).

3. Results

3.1. Effect of Continuous Cropping on Growth of Pepper Plants

As the duration of continuous cropping increased, the photosynthetic rate and SPAD value of pepper leaves exhibited a gradual decline (Figure 1A,B). Specifically, under the Y6 treatment, the photosynthetic rate and SPAD value decreased by 32.02% and 12.26%, respectively, compared to the Y0 treatment. Additionally, prolonged continuous cropping significantly inhibited the growth of pepper plants (Figure 1C–F). Under the Y6 treatment, plant height, stem circumference, leaf area, and yield decreased by 23.89%, 20.25%, 41.46%, and 42.37%, respectively, in comparison to Y0.

3.2. Effect of Continuous Cropping on Root Exudates of Pepper

In the root exudate solution, 22 compounds were analyzed by GC-MS (see Supplementary Table S5 for details), among which 8 key root exudate components exhibited a relative abundance >6% (Figure 2). Compared with the continuous cropping control (Y0 treatment), the relative abundance of 3,4-dimethylbenzaldehyde increased progressively with the increase in continuous cropping years. Conversely, the relative abundances of glycerol, pentacosane, and glycerol monostearate decreased as the continuous cropping years extended. No significant correlation was observed between the relative abundance of the other root exudates and the duration of continuous cropping. Notably, the accumulation pattern of 3,4-dimethylbenzaldehyde suggests its potential role in the continuous cropping system of green peppers, warranting further investigation.

3.3. Effect of Exogenous Addition of Root Exudates on Pepper Root Traits

The addition of three different root exudates significantly inhibited the root vitality, root weight, and root morphological indicators of peppers (Figure 3). The observed order of root weight, root length, root surface area, and number of root tips was as follows: CK > T1 > T3 > T2. The results from T1 and T2 indicate that certain substances present in the root exudates are associated with continuous cropping of peppers. Specifically, T3 resulted in reductions of 41.76% in root vitality, 45.50% in root weight, 48.83% in root length, 61.24% in root surface area, and 52.28% in the number of root tips. Further investigation confirmed that 3,4-dimethylbenzaldehyde in the root exudates is one of the key substances responsible for the continuous cropping obstacles in peppers.

3.4. Effect of Exogenous Addition of Root Exudates on Soil Physicochemical Properties

Compared to CK, the addition of root exudates significantly reduced the rhizosphere soil pH while increasing its electrical conductivity (EC) (Figure 4). The T1 treatment resulted in increases of 31.25%, 10.90%, and 32.87% in soil NO3−-N, AP, and AK content, respectively. The T2 treatment led to increases of 15.30% and 22.23% in soil AP and AK content, respectively, but also caused a decrease of 15.76% in soil NH4+-N. The T3 treatment increased soil NH4+-N and AP content by 37.30% and 11.92%, respectively, while decreasing soil NO3−-N content by 31.42%. Although the effects of each treatment on soil properties varied, all treatments were effective in enhancing the levels of AP and AK in the soil.

3.5. Effect of Exogenous Addition of Root Exudates on Soil Microbial Diversity and Composition

The diversity of rhizosphere soil bacterial communities under different treatments is illustrated in Figure 5A–C. Compared to the CK treatment, the Chao1 index significantly decreased under the T2 treatment (p < 0.05), while no significant differences were observed for the other treatments, indicating that the addition of root exudates from continuous cropping of bell peppers for six years reduces the richness of rhizosphere bacterial communities. However, the effects of T1 and T3 on the diversity of rhizosphere bacterial communities were not significant.
The Chao1 index, Shannon index, and OTUs of rhizosphere soil fungi are presented in Figure 5G–I. Compared to CK, the T2 treatment resulted in a 25.4% and 24.0% reduction in the Chao1 index and OTUs of soil fungi, respectively. Similarly, the T3 treatment decreased the Shannon index and Chao1 index by 21.4% and 11.0%, respectively, relative to CK. These results demonstrate that the addition of root exudates from six-year continuously cropped peppers and 3,4-dimethylbenzaldehyde substantially reduced the biodiversity of rhizosphere soil fungi.
At the phylum level of soil bacteria, all treatments involving the exogenous addition of root exudates significantly reduced the relative abundance of Proteobacteria (by 22.9–28.8%), while significantly increasing the relative abundances of Bacteroidota and Firmicutes, with increases of 8.6–22.6% and 3.8–9.2%, respectively (Figure 5E). At the genus level, the relative abundance of Pseudomonas in the T3 treatment significantly increased by 4.9% compared to CK, and the qPCR analysis confirmed a similar trend. Conversely, the relative abundance of Azoarcus under the exogenous addition of root exudates decreased by 4.6–7.1% compared to CK (Figure 5D,F).
Ascomycota is the most abundant phylum among soil fungi (average abundance of 81.4%), followed by Basidiomycota (average abundance of 14.3%). Compared to CK, the relative abundance of Ascomycota and Basidiomycota under the T2 treatment decreased by 13.7% and increased by 14.0%, respectively, while in the T3 treatment, their relative abundances increased by 10.0% and decreased by 11.0%, respectively (Figure 5K). At the genus level, the relative abundances of Fusarium, Apiotrichum, and Geotrichum exhibited the most pronounced changes across different treatments; of particular note is the significant decline in Fusarium relative abundance by 11.0–29.5% under the exogenous addition of root exudates compared to CK, which aligns with the qPCR results (Figure 5J,L).

3.6. Correlation Analysis of Soil, Microbial Communities, and Root Traits

Overall, compared to bacteria, the abundance of fungi at the phylum and genus levels shows a closer correlation with soil indicators (pH, EC, NO3−-N, and AK) (Figure 6B, Supplementary Table S7). In contrast, the abundance of bacteria at the phylum and genus levels is more strongly correlated with root indicators (root dry weight, root length, root surface area, and root tip number) (Figure 6A, Supplementary Table S6). The abundance of Proteobacteria is significantly positively correlated with soil pH, root vitality, root dry weight, root length, root surface area, and root tip number. The abundances of Bacteroidota and Firmicutes are positively correlated with soil available phosphorus but negatively correlated with root indicators. Pseudomonas shows a significant positive correlation with NH4+-N content, but no significant relationship with other indicators. Azoarcus is significantly positively correlated with root indicators (root vitality, dry weight, root length, root surface area, and root tip number). Ascomycota exhibits a significant positive correlation with soil NH4+-N content, whereas Basidiomycota shows a significant negative correlation with soil NH4+-N content but a significant positive correlation with root diameter. Fusarium is significantly positively correlated with NO3−-N and root indicators (root vitality, dry weight, root length, root surface area, and root tip number). Apiotrichum is significantly positively correlated with root diameter; Geotrichum is significantly positively correlated with NH4+-N but significantly negatively correlated with NO3−-N content and root diameter.

4. Discussion

4.1. Effects of Continuous Cropping on Green Pepper Plant Growth and Root Exudate Composition

Intensive crop monoculture is one of the most widely adopted models in modern agriculture, leading to significant homogenization and simplification of agroecosystems [12,38]. Over time, these practices heighten the risks associated with continuous cropping. In such cultivation systems, plants experience nutrient deficiencies, resulting in a prolonged state of “stress”, as evidenced by declines in nutrient accumulation, growth rates, and overall vitality [39]. Our study demonstrates that long-term continuous cropping significantly inhibited the growth and photosynthetic performance of peppers (Figure 1). Compared to the non-continuous cropping control, the six-year continuous cropping regimen significantly reduced photosynthetic rate, SPAD value, plant height, stem diameter, and leaf area, leading to a 42.37% reduction in yield. These findings indicate that continuous cropping obstacles impose cumulative detrimental effects on pepper physiological metabolism and productivity. Consistent with previous studies on continuous cropping of potatoes and Polygonatum odoratum, the results revealed significant reductions in photosynthetic rate and relative chlorophyll content (SPAD values), alongside decreases in biomass and yield [40,41]. These effects may stem from the degradation of soil health, which impairs crop growth and leads to diminished soil fertility and nutrient availability due to continuous cropping [42]. Notably, the continuous accumulation of root exudates may be the key mechanism driving this degradation process [11,17].
This study revealed that root exudate components exhibited significant specificity under continuous cropping stress, with the abundance of phenolic aldehydes—particularly 3,4-dimethylbenzaldehyde—gradually increased with prolonged duration (Figure 2). These findings are in accordance with previous reports on the accumulation of phenolic acids as allelopathic substances in continuous cropping systems of potato [10] and muskmelon [43]. Such secondary metabolites may further exacerbate soil nutrient cycling obstacles by suppressing soil phosphatase and urease activity [44] and disrupting rhizosphere microbial community structure [45]. Our research found that continuous cropping leads to an obvious downward trend in the levels of glycerol and its derivatives, which indicates the presence of intricate metabolic regulatory mechanisms. As a key intermediate in carbon metabolism, the reduction in glycerol levels may impair the plant’s capacity to synthesize osmoregulatory substances [46]. Concurrently, the depletion of glycerol monostearate suggests potential dysfunction in lipid signaling pathways [47]. The dynamic imbalance of these root exudates not only directly affects the physical stability of the rhizospheric soil [48], but may also generate negative feedback through synergistic and/or additive effects, resulting in abnormal plant growth and the initiation of programmed root death [49,50].

4.2. The Exogenous Addition of Root Exudates Disrupts the Equilibrium of the Plant–Soil Ecosystem

In the exogenous addition experiment, we observed that treatments with root exudates from 1-year (T1) and 6-year (T2) continuous cropping, as well as the single component 3,4-dimethylbenzaldehyde (T3), significantly inhibited the root development and vitality of pepper (Figure 3). These results confirmed that 3,4-dimethylbenzaldehyde is an important allelochemical contributing to the obstacles in green pepper continuous cropping, which is consistent with the results of peanut cropping studies [18]. Notably, the inhibitory effect of the T3 treatment on root growth was more pronounced than that of T1 but less severe than that of T2. This finding supports the hypothesis that, under long-term continuous cropping conditions, multiple allelopathic substances with synergistic effects may accumulate in root exudates, collectively exacerbating the inhibition of root growth. Similar findings have been reported in potatoes, another member of the Solanaceae family [51].
The input of root exudates exerts direct effects on root development but may also indirectly affect the ecological balance of the plant–soil system by reshaping the rhizosphere microenvironment [52]. In this study, we found that exogenous addition of root exudates significantly decreased the rhizosphere soil pH and increased the electrical conductivity (Figure 4). This shift likely arises from the hydrolysis of acidic compounds in root exudates, which elevates soil H+ concentration and thus lowers pH [53]. Concurrently, the observed increase in electrical conductivity suggests an accumulation of salt ions (e.g., K+, NO3−), a process that may compromise root cell integrity and disrupt plant physiological functions [54]. Compared with CK, treatments T1 to T3 significantly increased the levels of available phosphorus and available potassium in the soil. This nutrient accumulation primarily resulted from a substantial reduction in root absorption capacity. These findings are similar to observations by Lian et al. [21], which indicate that impaired root function leads to higher residual mineral nutrient levels in the rhizosphere and reduced nutrient use efficiency. Thus, the observed increase in soil nutrient content does not necessarily reflect improved soil fertility but rather indicates a relative nutrient surplus due to restricted root absorption. In addition, the imbalance of the ratio of NH4+-N and NO3−-N can inhibit the synergistic absorption of nitrogen by green pepper plants, thereby exacerbating the imbalance of intracellular ion homeostasis [55].
The reconstruction of the rhizosphere microbial community structure further demonstrated that root exudates significantly perturbed soil ecology. Specifically, exogenous addition treatments led to a substantial reduction in the relative abundance of key functional taxa within Proteobacteria, such as Azoarcus, which are crucial for nitrogen cycling and organic matter degradation [56,57]. Given the positive correlation between Proteobacteria abundance and root morphological characters, this reduction may directly compromise rhizosphere nutrient cycling efficiency. In contrast, the marked increases in Bacteroidota and Firmicutes suggest that these two bacterial phyla can selectively use phenolic and aldehyde allelochemicals as substrates for growth and reproduction, thereby altering the ratio of pathogenic bacteria to beneficial bacteria in the soil and leading to the deterioration of the soil micro-ecological environment [58]. Strikingly, only the T3 treatment induced a significant increase in Pseudomonas relative abundance compared to CK. We hypothesize that this reflects the genus’s ability to mitigate the toxicity of benzaldehyde compounds through siderophore secretion [59], enhancing its niche competitiveness. However, this localized adaptive response of Pseudomonas was insufficient to counterbalance the compound’s broader detrimental effects: the concurrent suppression of essential Proteobacteria, the degradation of soil properties (reduced pH, elevated EC), and direct impairment of root physiology (Figure 3) collectively prevailed. Consequently, despite Pseudomonas enrichment, the net impact of 3,4-dimethylbenzaldehyde remained strongly growth-inhibitory due to the overall disruption of microbiome functionality and root system integrity.
Regarding changes in fungal community structure, the T2 treatment significantly reduced the observed OTUs and Chao1 index, indicating that the input of root exudates under long-term continuous cropping directly diminished rhizospheric fungal species richness, potentially weakening niche complementarity and functional redundancy within the community [38,60]. Our findings demonstrate that the T2 treatment led to a 13.7% reduction in Ascomycota abundance alongside a 14.0% increase in Basidiomycota, whereas the T3 treatment exhibited the opposite trend (Figure 5K). This divergence may be explained by the differential tolerance of these fungal groups to allelochemicals [61]. The significant decline in Fusarium abundance under exogenous root exudate treatments (Figure 5L) may reflect functional diversity within the genus. Although Fusarium is often linked to pathogenicity, it comprises both pathogenic and non-pathogenic strains. Non-pathogenic Fusarium spp. (e.g., non-pathogenic F. oxysporum strains) serve as key biocontrol agents by competing for resources, producing antifungal volatiles, and inducing systemic resistance [62,63]. The observed reduction likely results from the sensitivity of these beneficial strains to allelochemicals such as 3,4-dimethylbenzaldehyde, which may impair their ecological functions. This selective inhibition could disrupt natural disease suppression, as the depletion of non-pathogenic Fusarium may create niches exploitable by true pathogens. Thus, while the decline initially appears beneficial, it may inadvertently increase disease risk by destabilizing microbial antagonism. Further functional characterization at the strain level is necessary to confirm pathogenicity and clarify this dynamic shift.
The correlation analysis reveals dual pathways through which systemic imbalance is mediated by root exudates. First, a strong direct association was observed between bacterial taxa and root morphological traits, suggesting that certain bacteria may rapidly respond to exudates (e.g., 3,4-dimethylbenzaldehyde) and directly impair root physiological functions. In contrast, the fungal community exhibited stronger associations with soil acidification, elevated electrical conductivity, and nutrient imbalances induced by root exudates, implying an indirect effect on plant health via alterations in the soil microenvironment. Crucially, these two mechanisms operate synergistically, forming a self-reinforcing cycle (negative feedback loop) that exacerbates continuous cropping obstacles [64]. We hypothesize that bacterial-mediated direct inhibition of root physiology (e.g., reduced root tip formation) diminishes root absorptive capacity and beneficial rhizodeposition (e.g., organic acids, phytohormones) [65]. This decline in root vitality and exudation indirectly accelerates soil degradation by weakening microbial priming effects [24]. Simultaneously, fungal-associated soil disturbances (e.g., acidification, salinity) directly damage root structures (e.g., cell membranes) and impair key functions such as H+-ATPase activity, reducing nutrient uptake efficiency independently of microbial shifts [66]. These soil changes further hinder root system recovery. Thus, root exudates initiate cascading effects: soil degradation directly compromises root integrity and function, while root dysfunction indirectly exacerbates soil deterioration. Microbial communities serve as both primary responders to initial exudate signals and critical amplifiers of systemic imbalance within this self-reinforcing cycle [67].

4.3. Limitations and Future Research

The pot experiment may not fully replicate the complex environmental conditions present in field settings, and the exclusive focus on a single allelochemical (3,4-dimethylbenzaldehyde) could overlook potential synergistic interactions with other root exudates. Future research should (1) include field validation under diverse agroecological conditions to assess the generalizability of these mechanisms across different soil–climate systems; (2) investigate the interplay among multiple allelochemicals and validate these mechanisms across pepper varieties to assess the interplay between genetic background and root exudate dynamics; (3) and elucidate the functional roles of key microorganisms (e.g., Pseudomonas and Fusarium) using advanced methodologies such as metatranscriptomics or culturomics. These refinements would enhance our understanding of the mechanisms underlying continuous cropping obstacles and provide a stronger theoretical foundation for developing effective field-based mitigation strategies.

5. Conclusions

In conclusion, our study demonstrates that continuous cropping of green pepper significantly alters root exudate composition, notably increasing the concentration of 3,4-dimethylbenzaldehyde—a change strongly correlated with declines in plant growth and soil health. The exogenous application of root exudates disrupts the plant–soil ecosystem equilibrium, adversely affecting soil physicochemical properties and microbial community structure. These findings enhance our understanding of the mechanisms driving continuous cropping obstacles in green peppers. Based on our findings, potential mitigation strategies could include implementing crop rotation/intercropping to disrupt autotoxin accumulation and applying adsorbent soil amendments (e.g., biochar, organic compost) to counteract the negative effects of specific root exudates.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agronomy15082010/s1, Table S1. Physicochemical properties of soil before experiment beginning in this study. Table S2. Cultivation managements practices for different treatments in this study. Table S3. Primers used for quantitative reverse transcription PCR (qRT-PCR) in this study. Table S4. Quantitative reverse transcription PCR (qRT-PCR) amplification procedure used in this study. Table S5. The potential allelochemicals in pepper root exudates identified by GC-MS. Table S6. Pearson correlation analysis of soil bacterial communities, soil physicochemical properties, and root traits in green peppers. Table S7. Pearson correlation analysis of soil fungal communities, soil physicochemical properties, and root traits in green peppers. Figure S1. GC-MS quantitative analysis of 3,4-dimethylbenzaldehyde concentrations in soil extracts before experimentation.

Author Contributions

Conceptualization, Z.L., J.H., and S.W.; methodology and software, D.L. and Y.Y.; investigation and data curation, Z.L., S.Z., and B.L.; formal analysis and visualization, D.L., S.Z., and H.L.; writing—original draft preparation, Z.L. and H.L.; writing—review and editing, S.W., H.L., and D.L.; supervision and project administration, J.H., S.W., and Z.L.; funding acquisition, Y.Y., B.L., and Z.L. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the Basic Research Special Foundation of Public Research Institutes of Fujian Province (2021R1030002, 2022R1030002, and 2023R1028004), the Fujian Provincial Science and Technology Department Public Welfare Competitive Research Program (2023R1094), the Natural Science Foundation of Fujian Province (2023J01373), and the Freely Explore Science and Technology Innovation Project of the Fujian Academy of Agricultural Sciences (ZYTS202207).

Data Availability Statement

The original contributions of this study are included in the article. For further inquiries, please contact the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Gao, J.; Pei, H.; Xie, H. Synergistic effects of organic fertilizer and corn straw on microorganisms of pepper continuous cropping soil in China. Bioengineered 2020, 11, 1258–1268. [Google Scholar] [CrossRef]
  2. Zou, X.; Ma, Y.; Dai, X.; Li, X.; Yang, S. Spread and industry development of pepper in china. Acta Hortic. Sin. 2020, 47, 1715–1726. (In Chinese) [Google Scholar]
  3. Xiong, W.; Li, Z.; Liu, H.; Xue, C.; Zhang, R.; Wu, H.; Li, R.; Shen, Q. The effect of long-term continuous cropping of black pepper on soil bacterial communities as determined by 454 pyrosequencing. PLoS ONE 2015, 10, e0136946. [Google Scholar] [CrossRef] [PubMed]
  4. Huang, X.Q.; Liu, S.Z.; Liu, X.; Zhang, S.R.; Li, L.; Zhao, H.T.; Zhao, J.; Zhang, J.B.; Cai, Z.C. Plant pathological condition is associated with fungal community succession triggered by root exudates in the plant-soil system. Soil Biol. Biochem. 2020, 151, 108046. [Google Scholar] [CrossRef]
  5. Li, Y.C.; Li, Z.; Li, Z.W.; Jiang, Y.H.; Weng, B.Q.; Lin, W.X. Variations of rhizosphere bacterial communities in tea (Camellia sinensis L.) continuous cropping soil by high-throughput pyrosequencing approach. J. Appl. Microbiol. 2016, 121, 787–799. [Google Scholar] [CrossRef]
  6. Zhang, Y.; Ye, C.; Su, Y.; Peng, W.; Lu, R.; Liu, Y.; Huang, H.; He, X.; Yang, M.; Zhu, S. Soil acidification caused by excessive application of nitrogen fertilizer aggravates soil-borne diseases: Evidence from literature review and field trials. Agric. Ecosyst. Environ. 2022, 340, 108176. [Google Scholar] [CrossRef]
  7. Zhou, R.; Wang, Y.; Tian, M.; Shah Jahan, M.; Shu, S.; Sun, J.; Li, P.; Ahammed, G.J.; Guo, S. Mixing of biochar, vinegar and mushroom residues regulates soil microbial community and increases cucumber yield under continuous cropping regime. Appl. Soil Ecol. 2021, 161, 103883. [Google Scholar] [CrossRef]
  8. Cui, X.; Yuan, J.; Yang, X.; Wei, C.; Bi, Y.; Sun, Q.; Meng, J.; Han, X. Biochar application alters soil metabolites and nitrogen cycle-related microorganisms in a soybean continuous cropping system. Sci. Total Environ. 2024, 917, 170522. [Google Scholar] [CrossRef]
  9. Liao, J.; Xia, P. Continuous cropping obstacles of medicinal plants: Focus on the plant-soil-microbe interaction system in the rhizosphere. Sci. Hortic. 2024, 328, 112927. [Google Scholar] [CrossRef]
  10. Zhao, L.; Xu, W.; Guan, H.; Wang, K.; Xiang, P.; Wei, F.; Yang, S.; Miao, C.; Ma, L.Q. Biochar increases Panax notoginseng’s survival under continuous cropping by improving soil properties and microbial diversity. Sci. Total Environ. 2022, 850, 157990. [Google Scholar] [CrossRef]
  11. Xing, Y.; Zhang, P.; Zhang, W.; Yu, C.; Luo, Z. Continuous cropping of potato changed the metabolic pathway of root exudates to drive rhizosphere microflora. Front. Microbiol. 2023, 14, 1318586. [Google Scholar] [CrossRef] [PubMed]
  12. Chen, D.; Zhou, Y.; Wang, G.; Dai, K.; Li, J.; Song, X.; Xu, Y.; Cui, Y.; Yang, X. Biochar-based organic fertilizer application promotes the alleviation of tobacco (Nicotiana tabacum L.) continuous cropping obstacles by improving soil chemical properties and microbial community structure. BMC Plant Biol. 2025, 25, 271. [Google Scholar] [CrossRef] [PubMed]
  13. Wu, H.; Wu, L.; Zhu, Q.; Wang, J.; Qin, X.; Xu, J.; Kong, L.; Chen, J.; Lin, S.; Umar Khan, M.; et al. The role of organic acids on microbial deterioration in the Radix pseudostellariae rhizosphere under continuous monoculture regimes. Sci. Rep. 2017, 7, 3497. [Google Scholar] [CrossRef] [PubMed]
  14. Chai, Y.N.; Schachtman, D.P. Root exudates impact plant performance under abiotic stress. Trends Plant Sci. 2021, 27, 80–91. [Google Scholar] [CrossRef]
  15. Liu, W.; Zhao, Q.; Zhang, Z.; Li, Y.; Xu, N.; Qu, Q.; Lu, T.; Pan, X.; Qian, H. Enantioselective effects of imazethapyr on Arabidopsis thaliana root exudates and rhizosphere microbes. Sci. Total Environ. 2020, 716, 137121. [Google Scholar] [CrossRef]
  16. Ma, J.Q.; Xie, Y.; Yang, Y.S.; Jing, C.L.; You, X.W.; Yang, J.; Sun, C.Y.; Qin, S.F.; Chen, J.H.; Cao, K.X.; et al. Amf colonization affects allelopathic effects of zea mays l. Root exudates and community structure of rhizosphere bacteria. Front. Plant Sci. 2022, 13, 1050104. [Google Scholar] [CrossRef]
  17. Huang, W.; Sun, D.; Wang, R.; An, Y. Integration of transcriptomics and metabolomics reveals the responses of sugar beet to continuous cropping obstacle. Front. Plant Sci. 2021, 12, 711333. [Google Scholar] [CrossRef]
  18. Liu, P.; Zhao, H.; Tang, C.; Zhang, Y.; Lin, H.; Shen, Y.; Wang, J.; Wan, S. Effects of continuous cropping on root exudates of different resistance peanut (Arachis hypogaea L.) varieties and allelochemicals content in soil. Chin. J. Oil Crop Sci. 2015, 37, 467–474. (In Chinese) [Google Scholar]
  19. Cheng, F.; Ali, M.; Liu, C.; Deng, R.; Cheng, Z.H. Garlic allelochemical diallyl disulfide alleviates autotoxicity in the root exudates caused by long-term continuous cropping of tomato. J. Agric. Food Chem. 2020, 68, 11684–11693. [Google Scholar] [CrossRef]
  20. Zhuang, Y.; Wang, H.; Tan, F.; Wu, B.; Liu, L.; Qin, H.; Yang, Z.; He, M. Rhizosphere metabolic cross-talk from plant-soil-microbe tapping into agricultural sustainability: Current advance and perspectives. Plant Physiol. Biochem. 2024, 210, 108619. [Google Scholar] [CrossRef]
  21. Lian, J.; Li, G.; Zhang, J.; Massart, S. Nitrogen fertilization affected microbial carbon use efficiency and microbial resource limitations via root exudates. Sci. Total Environ. 2024, 950, 174933. [Google Scholar] [CrossRef]
  22. Li, J.; Li, W.L.; Xu, X.L. Root exudates induce rhizosphere effect benefits for plant N use efficiency and fitness of relatives for Glycine max. Plant Soil. 2021, 469, 234–258. [Google Scholar] [CrossRef]
  23. Wang, H.W.; Ma, C.Y.; Xu, F.J.; Lu, F.; Zhang, W.; Dai, C.C. Root endophyte-enhanced peanut-rhizobia interaction is associated with regulation of root exudates. Microbiol. Res. 2021, 250, 126765. [Google Scholar] [CrossRef] [PubMed]
  24. Afridi, M.S.; Kumar, A.; Javed, M.A.; Dubey, A.; de Medeiros, F.H.V.; Santoyo, G. Harnessing root exudates for plant microbiome engineering and stress resistance in plants. Microbiol. Res. 2024, 279, 127564. [Google Scholar] [CrossRef] [PubMed]
  25. Liu, C.; Geng, H.-Y.; Li, W.-X.; Li, Y.-Y.; Lu, Y.-S.; Xie, K.-Z.; Sun, L.L.; Zhang, J.-X.; Peng, H.-L.; Shi, C.-H.; et al. Innate root exudates contributed to contrasting coping strategies in response to ralstonia solanacearum in resistant and susceptible tomato cultivars. J. Agric. Food Chem. 2023, 71, 20092–20104. [Google Scholar] [CrossRef]
  26. Vora, S.M.; Ankati, S.; Patole, C.; Podile, A.R.; Archana, G. Alterations of primary metabolites in root exudates of intercropped Cajanus Cajan-zea mays modulate the adaptation and proteome of Ensifer (Sinorhizobium) fredii NGR234. Microb. Ecol. 2022, 83, 1008–1025. [Google Scholar] [CrossRef]
  27. Zhu, S.; Zhao, W.; Sun, S.; Yang, X.; Mao, H.; Sheng, L.; Chen, Z. Community metagenomics reveals the processes of cadmium resistance regulated by microbial functions in soils with Oryza sativa root exudate input. Sci. Total Environ. 2024, 949, 175015. [Google Scholar] [CrossRef]
  28. Bertilsson, S.; Eisenhauer, N.; Scheu, S.; Jousset, A. Bacterial diversity stabilizes community productivity. PLoS ONE 2012, 7, e34517. [Google Scholar]
  29. Liu, L.; Wu, J.; Liu, M.; Wang, M.; Huo, Y.; Wei, F.; Wu, M. Microbial communities in continuous Panax notoginseng cropping soil. Agronomy 2025, 15, 486. [Google Scholar] [CrossRef]
  30. Zhou, N.; Mei, C.-M.; Zhu, X.-Y.; Zhao, J.-J.; Ma, M.-G.; Li, W.-D. Research progress of rhizosphere microorganisms in fritillaria l. Medicinal plants. Front. Bioeng. Biotech. 2022, 10, 1054757. [Google Scholar] [CrossRef]
  31. Peng, S.; Zhou, P.; Wu, K.; Xing, D.; He, J. Research progress on the response and regulatory measures of chili peppers to continuous cropping obstacles in China. J. Anhui Agric. Sci. 2023, 51, 15–17. [Google Scholar]
  32. Zhang, F.; Chen, Y.; Wu, C.; Wang, X.; Fan, S.; Wang, J. Investigation and analysis on current situation of continuous cropping obstacle of greenhouse pepper in jiangxi province. N. Hortic. 2018, 17, 75–81. (In Chinese) [Google Scholar]
  33. Chen, W.; Guo, X.; Guo, Q.; Tan, X.; Wang, Z. Long-term chili monoculture alters environmental variables affecting the dominant microbial community in rhizosphere soil. Front. Microbiol. 2021, 12, 681953. [Google Scholar] [CrossRef] [PubMed]
  34. Ankati, S.; Podile, A.R. Metabolites in the root exudates of groundnut change during interaction with plant growth promoting rhizobacteria in a strain-specific manner. J. Plant Physiol. 2019, 243, 153057. [Google Scholar] [CrossRef]
  35. Xu, L.; Ma, L.; Wei, R.; Ma, Y.; Ma, T.; Dang, J.; Chen, Z.; Li, S.; Ma, S.; Chen, G. Effect of continuous cropping on growth and lobetyolin synthesis of the medicinal plant Codonopsis pilosula (Franch.) Nannf. Based on the integrated analysis of plant-metabolite-soil factors. J. Agric. Food Chem. 2024, 72, 19604–19617. [Google Scholar] [CrossRef]
  36. Wu, H.; Qin, X.; Wang, J.; Wu, L.; Chen, J.; Fan, J.; Zheng, L.; Tangtai, H.; Arafat, Y.; Lin, W.; et al. Rhizosphere responses to environmental conditions in Radix pseudostellariae under continuous monoculture regimes. Agric. Ecosyst. Environ. 2019, 270–271, 19–31. [Google Scholar] [CrossRef]
  37. Abd-Elsalam, K.A.; Aly, I.N.; Abdel-Satar, M.A.; Khalil, M.S.; Verreet, J.A. PCR identification of fusarium genus based on nuclear ribosomal-DNA sequence data. Afric. J. Biotechnol. 2003, 2, 82–85. [Google Scholar]
  38. Tissier, M.L.; Kletty, F.; Handrich, Y.; Habold, C. Monocultural sowing in mesocosms decreases the species richness of weeds and invertebrates and critically reduces the fitness of the endangered European hamster. Oecologia 2018, 186, 589–599. [Google Scholar] [CrossRef]
  39. Guo, X.-X.; Tian, L.; Song, B.-Q.; Li, Y.-H.; Huang, C.-Y.; Li, Z.; Zhang, P.; Jian, C.-Y.; Han, K.; Xue, C.-L.; et al. Effects of continuous cropping and application of bio-organic fertilizer on photosynthetic performance, dry matter accumulation and distribution of sugar beet. Sci. Rep. 2025, 25, 2512. [Google Scholar] [CrossRef]
  40. Jiao, R.; Xu, X.; Yang, H.; Feng, H.; Zhang, S.; Zhang, J.; Li, C.; Li, J. Study on the effect and its mechanism of continuous cropping on potato growth and soil health. Agric. Res. Arid Areas 2018, 36, 94–100. (In Chinese) [Google Scholar]
  41. Wang, Y.; Zhou, Y.; Ye, J.; Jin, C.; Hu, Y. Continuous cropping inhibits photosynthesis of Polygonatum odoratum. Plants 2023, 12, 3374. [Google Scholar] [CrossRef] [PubMed]
  42. Chen, Y.; Du, J.; Li, Y.; Tang, H.; Yin, Z.; Yang, L.; Ding, X. Evolutions and managements of soil microbial community structure drove by continuous cropping. Front. Microbiol. 2022, 13, 839494. [Google Scholar] [CrossRef] [PubMed]
  43. Yang, R.; Liu, B.; Teng, A.; Zhang, L.; Wang, H.; Yang, Z.; Li, J.; Xia, Y.; Wang, J. The impact of continuous cropping on phenolic acids in muskmelon soil and the colonization of Trichoderma viride. Agronomy 2024, 14, 1344. [Google Scholar] [CrossRef]
  44. Song, H.; Gao, X.; Wang, X.; Xing, L.; Feng, B. Effects of exogenous phthalic and cinnamic acids on enzyme activities and microbial community structures in rhizosphere soil of adzuki bean. Agric. Sci. Technol. 2017, 18, 1935–1940+1954. [Google Scholar]
  45. Li, T.; Ge, L.; Zhao, R.; Peng, C.; Zhou, X.; Li, P.; Liu, Z.; Song, H.; Tang, J.; Zhang, C.; et al. Phenolic compounds weaken the impact of drought on soil enzyme activity in global wetlands. Front. Microbiol. 2024, 15, 1372866. [Google Scholar] [CrossRef]
  46. Aubert, S.; Gout, E.; Bligny, R.; Douce, R. Multiple effects of glycerol on plant cell metabolism. Phosphorus-31 nuclear magnetic resonance studies. J. Biol. Chem. 1994, 269, 21420–21427. [Google Scholar] [CrossRef]
  47. Oubohssaine, M.; Hnini, M.; Rabeh, K. Exploring lipid signaling in plant physiology: From cellular membranes to environmental adaptation. J. Plant Physiol. 2024, 300, 154295. [Google Scholar] [CrossRef]
  48. Wang, Z.H.; Fang, H.; Chen, M. Effects of root exudates of woody species on the soil anti-erodibility in the rhizosphere in a karst region, China. PeerJ 2017, 5, e3029. [Google Scholar] [CrossRef]
  49. Bouhaouel, I.; Richard, G.; Fauconnier, M.L.; Ongena, M.; Franzil, L.; Gfeller, A.; Amara, H.S.; du Jardin, P. Identification of barley (Hordeum vulgare L. subsp. vulgare) root exudates allelochemicals, their autoallelopathic activity and against Bromus diandrus Roth. Germination. Agronomy 2019, 9, 345. [Google Scholar] [CrossRef]
  50. Feng, F.J.; Yang, C.Y.; Li, M.J.; Zhan, S.Y.; Liu, H.Y.; Chen, A.G.; Wang, J.M.; Zhang, Z.Y.; Gu, L. Key molecular events involved in root exudates-mediated replanted disease of Rehmannia glutinosa. Plant Physiol. Biochem. 2022, 172, 136–150. [Google Scholar] [CrossRef]
  51. Zhang, W.; Qiu, H.; Zhang, C.; Hai, L. Identification of chemicals in potato root exudates under different years of continuous cropping and their biologic effects. Chin. J. Eco-Agric. 2018, 26, 1811–1818. (In Chinese) [Google Scholar]
  52. Wankhade, A.; Wilkinson, E.; Britt, D.W.; Kaundal, A. A review of plant–microbe interactions in the rhizosphere and the role of root exudates in microbiome engineering. Appl. Sci. 2025, 13, 7127. [Google Scholar] [CrossRef]
  53. Shen, F.; Wu, W.; Li, Y.; Liu, D.; Teng, Y. Study on microecological effects of root exudates of garden plants with different concentrations. Ecol. Environ. Sci. 2021, 30, 313–319. (In Chinese) [Google Scholar]
  54. Ma, Z.; Wang, Q.; Wang, X.; Chen, X.; Wang, Y.; Mao, Z. Effects of biochar on replant disease by amendment soil environment. Commun. Soil Sci. Plant Anal. 2021, 52, 673–685. [Google Scholar] [CrossRef]
  55. Zhang, J.; Lv, J.; Dawuda, M.M.; Xie, J.; Yu, J.; Li, J.; Zhang, X.; Tang, C.; Wang, C.; Gan, Y. Appropriate ammonium-nitrate ratio improves nutrient accumulation and fruit quality in pepper (Capsicum annuum L.). Agronomy 2019, 9, 683. [Google Scholar] [CrossRef]
  56. Duan, Y.; Zhang, L.; Yang, J.; Zhang, Z.; Awasthi, M.K.; Li, H. Insight to bacteria community response of organic management in apple orchard-bagasse fertilizer combined with biochar. Chemosphere 2022, 286, 131693. [Google Scholar] [CrossRef]
  57. Yang, S.; Huang, T.; Zhang, H.; Guo, H.; Xu, J.; Cheng, Y. Pollutants reduction via artificial mixing in a drinking water reservoir: Insights into bacterial metabolic activity, biodiversity, interactions and co-existence of core genera. Sci. Total Environ. 2023, 898, 165473. [Google Scholar] [CrossRef]
  58. Bai, Y.; Wang, G.; Cheng, Y.; Shi, P.; Yang, C.; Yang, H.; Xu, Z. Soil acidification in continuously cropped tobacco alters bacterial community structure and diversity via the accumulation of phenolic acids. Sci. Rep. 2019, 9, 12499. [Google Scholar] [CrossRef] [PubMed]
  59. Tan, L.; Liang, J.; Qin, Z.; Ning, T.; Wei, X.; Yang, B.; Wang, Q.; Xu, Y.; Shen, F. Unveiling the sustained effects of plant root exudates on soil microbiome and resistome and the related functional traits. J. Environ. Manag. 2025, 376, 124485. [Google Scholar] [CrossRef] [PubMed]
  60. Zhao, M.; Zhao, J.; Yuan, J.; Hale, L.; Wen, T.; Huang, Q.; Vivanco, J.M.; Zhou, J.; Kowalchuk, G.A.; Shen, Q. Root exudates drive soil-microbe-nutrient feedbacks in response to plant growth. Plant Cell Environ. 2020, 44, 613–628. [Google Scholar] [CrossRef]
  61. Zhang, W.-J.; Xu, Z.-R.; Zhao, S.-H.; Sun, J.-Y.; Yang, X. Development of a microbial fermentation process for detoxification of gossypol in cottonseed meal. Anim. Feed Sci. Tech. 2007, 135, 176–186. [Google Scholar] [CrossRef]
  62. Sajeena, A.; Nair, D.S.; Sreepavan, K. Non-pathogenic Fusarium oxysporum as a biocontrol agent. Indian Phytopathol. 2020, 73, 177–183. [Google Scholar] [CrossRef]
  63. Zhang, Q.; Yang, L.; Zhang, J.; Wu, M.; Chen, W.; Jiang, D.; Li, G. Production of anti-fungal volatiles by non-pathogenic Fusarium oxysporum and its efficacy in suppression of Verticillium wilt of cotton. Plant Soil 2015, 392, 101–114. [Google Scholar] [CrossRef]
  64. Philippot, L.; Chenu, C.; Kappler, A.; Rillig, M.C.; Fierer, N. The interplay between microbial communities and soil properties. Nat. Rev. Microbiol. 2023, 4, 226–239. [Google Scholar] [CrossRef]
  65. Tang, Z.; Tan, W.; Li, R.; Weng, L.; Chen, X.; Xi, B.; Lv, D. Advances in rhizosphere microbiome and rhizosphere immunity effect: A review. J. Agric. Food Chem. 2025, 24, 14707–14721. [Google Scholar] [CrossRef]
  66. Nansahwang, A.; Leksungnoen, P.; Armatmontree, C.; Aramrak, S.; Kongsil, P.; Wisawapipat, W. Phosphate mineral solubility controls on cassava root exudates, rhizosphere nutrient availability, and plant nutrient accumulation. Rhizosphere 2022, 23, 100575. [Google Scholar] [CrossRef]
  67. Fan, X.; Ge, A.-H.; Qi, S.; Guan, Y.; Wang, R.; Yu, N.; Wang, E. Root exudates and microbial metabolites: Signals and nutrients in plant-microbe interactions. Sci. China Life Sci. 2025, 68, 2290–2302. [Google Scholar] [CrossRef]
Agronomy 15 02010 g001
Figure 1. Photosynthesis rate (A), SPAD value (B), plant height (C), stem diameter (D), leaf area (E), and yield (F) of pepper under different continuous cropping years. Y0, first cropping; Y1, 1 year of continuous cropping; Y2, 2 years of continuous cropping; Y6, 6 years of continuous cropping. Vertical bars represent standard deviations. Different letters indicate statistically significant differences at p < 0.05, as determined by LSD testing.
Figure 1. Photosynthesis rate (A), SPAD value (B), plant height (C), stem diameter (D), leaf area (E), and yield (F) of pepper under different continuous cropping years. Y0, first cropping; Y1, 1 year of continuous cropping; Y2, 2 years of continuous cropping; Y6, 6 years of continuous cropping. Vertical bars represent standard deviations. Different letters indicate statistically significant differences at p < 0.05, as determined by LSD testing.
Agronomy 15 02010 g001
Agronomy 15 02010 g002
Figure 2. Relative abundance (RA) of key root exudate components under different continuous cropping years. Y0, first cropping; Y1, 1 year of continuous cropping; Y2, 2 years of continuous cropping; Y6, 6 years of continuous cropping. “ND” means that compound concentration was too low and not detected. Vertical bars represent standard deviations. Different letters indicate statistically significant differences at p < 0.05, as determined by LSD testing.
Figure 2. Relative abundance (RA) of key root exudate components under different continuous cropping years. Y0, first cropping; Y1, 1 year of continuous cropping; Y2, 2 years of continuous cropping; Y6, 6 years of continuous cropping. “ND” means that compound concentration was too low and not detected. Vertical bars represent standard deviations. Different letters indicate statistically significant differences at p < 0.05, as determined by LSD testing.
Agronomy 15 02010 g002
Agronomy 15 02010 g003
Figure 3. Pepper root traits (A–F) under condition of different exogenous additions of root exudates. CK, irrigated with distilled water; T1, irrigated with soil extracts from 1-year continuously cropped pepper fields; T2, irrigated with soil extracts from 6-year continuously cropped pepper fields; T3, irrigated with 3,4-dimethylbenzaldehyde solution. Vertical bars represent standard deviations. Different letters indicate statistically significant differences at p < 0.05, as determined by LSD testing.
Figure 3. Pepper root traits (A–F) under condition of different exogenous additions of root exudates. CK, irrigated with distilled water; T1, irrigated with soil extracts from 1-year continuously cropped pepper fields; T2, irrigated with soil extracts from 6-year continuously cropped pepper fields; T3, irrigated with 3,4-dimethylbenzaldehyde solution. Vertical bars represent standard deviations. Different letters indicate statistically significant differences at p < 0.05, as determined by LSD testing.
Agronomy 15 02010 g003
Agronomy 15 02010 g004
Figure 4. Soil physicochemical properties (A–F) under conditions of different exogenous additions of root exudates. CK, irrigated with distilled water; T1, irrigated with soil extracts from 1-year continuously cropped pepper fields; T2, irrigated with soil extracts from 6-year continuously cropped pepper fields; T3, irrigated with 3,4-dimethylbenzaldehyde solution. EC, electrical conductivity; NH4+-N, ammonium nitrogen; NO3−-N, nitrate nitrogen; AP, available phosphorus; AK, available potassium. Vertical bars represent standard deviations. Different letters indicate statistically significant differences at p < 0.05, as determined by LSD testing.
Figure 4. Soil physicochemical properties (A–F) under conditions of different exogenous additions of root exudates. CK, irrigated with distilled water; T1, irrigated with soil extracts from 1-year continuously cropped pepper fields; T2, irrigated with soil extracts from 6-year continuously cropped pepper fields; T3, irrigated with 3,4-dimethylbenzaldehyde solution. EC, electrical conductivity; NH4+-N, ammonium nitrogen; NO3−-N, nitrate nitrogen; AP, available phosphorus; AK, available potassium. Vertical bars represent standard deviations. Different letters indicate statistically significant differences at p < 0.05, as determined by LSD testing.
Agronomy 15 02010 g004
Agronomy 15 02010 g005
Figure 5. The variation in alpha diversity indices and rhizosphere soil microbial community structure across treatments. (A–F) Bacterial communities. (G–L) Fungal communities. The term “UC” in bacterial or fungal nomenclature denotes “unclassified”. CK, irrigated with distilled water; T1, irrigated with soil extracts from 1-year continuously cropped pepper fields; T2, irrigated with soil extracts from 6-year continuously cropped pepper fields; T3, irrigated with 3,4-dimethylbenzaldehyde solution. Different letters above each column indicate statistically significant differences (LSD test, p < 0.05).
Figure 5. The variation in alpha diversity indices and rhizosphere soil microbial community structure across treatments. (A–F) Bacterial communities. (G–L) Fungal communities. The term “UC” in bacterial or fungal nomenclature denotes “unclassified”. CK, irrigated with distilled water; T1, irrigated with soil extracts from 1-year continuously cropped pepper fields; T2, irrigated with soil extracts from 6-year continuously cropped pepper fields; T3, irrigated with 3,4-dimethylbenzaldehyde solution. Different letters above each column indicate statistically significant differences (LSD test, p < 0.05).
Agronomy 15 02010 g005
Agronomy 15 02010 g006
Figure 6. The relationships among soil microbial communities, soil physical and chemical properties, and the root traits of green peppers. (A) Bacterial communities. (B) Fungal communities. The term “UC” in bacterial or fungal nomenclature denotes “unclassified”. EC, electrical conductivity; NH4+-N, ammonium nitrogen; NO3−-N, nitrate nitrogen; AP, available phosphorus; AK, available potassium. * and ** indicate significance at p < 0.05 and p < 0.01, respectively.
Figure 6. The relationships among soil microbial communities, soil physical and chemical properties, and the root traits of green peppers. (A) Bacterial communities. (B) Fungal communities. The term “UC” in bacterial or fungal nomenclature denotes “unclassified”. EC, electrical conductivity; NH4+-N, ammonium nitrogen; NO3−-N, nitrate nitrogen; AP, available phosphorus; AK, available potassium. * and ** indicate significance at p < 0.05 and p < 0.01, respectively.
Agronomy 15 02010 g006
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, Z.; Lian, D.; Zhang, S.; Yao, Y.; Lin, B.; Hong, J.; Wu, S.; Li, H. Continuous Cropping Duration Alters Green Pepper Root Exudate Composition and Triggers Rhizosphere Feedback Inhibition. Agronomy 2025, 15, 2010. https://doi.org/10.3390/agronomy15082010

AMA Style

Li Z, Lian D, Zhang S, Yao Y, Lin B, Hong J, Wu S, Li H. Continuous Cropping Duration Alters Green Pepper Root Exudate Composition and Triggers Rhizosphere Feedback Inhibition. Agronomy. 2025; 15(8):2010. https://doi.org/10.3390/agronomy15082010

Chicago/Turabian Style

Li, Zhou, Dongmei Lian, Shaoping Zhang, Yunfa Yao, Bizhen Lin, Jianji Hong, Songhai Wu, and Honghong Li. 2025. "Continuous Cropping Duration Alters Green Pepper Root Exudate Composition and Triggers Rhizosphere Feedback Inhibition" Agronomy 15, no. 8: 2010. https://doi.org/10.3390/agronomy15082010

APA Style

Li, Z., Lian, D., Zhang, S., Yao, Y., Lin, B., Hong, J., Wu, S., & Li, H. (2025). Continuous Cropping Duration Alters Green Pepper Root Exudate Composition and Triggers Rhizosphere Feedback Inhibition. Agronomy, 15(8), 2010. https://doi.org/10.3390/agronomy15082010

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop