Next Article in Journal
Evaluation of the Field Performance and Economic Feasibility of Mechanized Onion Production in the Republic of Korea
Previous Article in Journal
Effect of Planting Density and Harvesting Age on Iris pallida Lam. Biomass, Morphology and Orris Concrete Production
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Phylogenetic Diversity and Symbiotic Effectiveness of Bradyrhizobium Strains Nodulating Glycine max in Côte d’Ivoire

by
Marie Ange Akaffou
1,
Romain Kouakou Fossou
1,
Anicet Ediman Théodore Ebou
1,
Zaka Ghislaine Claude Kouadjo-Zézé
2,
Chiguié Estelle Raïssa-Emma Amon
1,
Clémence Chaintreuil
3,4,
Saliou Fall
4 and
Adolphe Zézé
1,*
1
Laboratoire de Microbiologie, Biotechnologies et Bio-Informatique (LaMBB), UMRI Sciences Agronomiques et Procédés de Transformation, Institut National Polytechnique Félix Houphouët-Boigny, Yamoussoukro 1093, Côte d’Ivoire
2
Laboratoire Central de Biotechnologies, Centre National de la Recherche Agronomique, Abidjan 1740, Côte d’Ivoire
3
Laboratoire des Symbioses Tropicales et Méditerranéennes, Institut de Recherche pour le Développement, UMR Institut de Recherche pour le Développement/SupAgro/Institut National de la Recherche Agronomique/Université de Montpellier/Centre de Coopération Internationale en Recherche Agronomique pour le Développement, 34398 Montpellier, CEDEX 5, France
4
Laboratoire Commun de Microbiologie (LCM) IRD/ISRA/UCAD, Centre de Recherche de Bel Air, Dakar 1386, Senegal
*
Author to whom correspondence should be addressed.
Agronomy 2025, 15(7), 1720; https://doi.org/10.3390/agronomy15071720
Submission received: 17 May 2025 / Revised: 13 June 2025 / Accepted: 24 June 2025 / Published: 17 July 2025
(This article belongs to the Section Agricultural Biosystem and Biological Engineering)

Abstract

Soybean (Glycine max) is a protein-rich legume crop that plays an important role in achieving food security. The aim of this study was to isolate soybean-nodulating rhizobia from Côte d’Ivoire soils and evaluate their potential as efficient strains in order to develop local bioinoculants. For this objective, 38 composite soil samples were collected from Côte d’Ivoire’s five major climatic zones. These soils were used as substrate to trap the nodulating rhizobia using the promiscuous soybean variety R2-231. A total of 110 bacterial strains were isolated and subsequently identified. The analysis of ITS (rDNA16S-23S), glnII and recA sequences revealed a relatively low genetic diversity of these native rhizobia. Moreover, the ITS phylogeny showed that these were scattered into two Bradyrhizobium clades dominated by the B. elkanii supergroup, with ca. 75% of all isolates. Concatenated glnII-recA sequence phylogeny confirmed that the isolates belong in the majority to ‘B. brasilense’, together with B. vignae and some putative genospecies of Bradyrhizobium that needs further elucidation. The core gene phylogeny was found to be incongruent with nodC and nifH phylogenies, probably due to lateral gene transfer influence on the symbiotic genes. The diversity and composition of the Bradyrhizobium species varied significantly among different sampling sites, and the key explanatory variables identified were carbon (C), magnesium (Mg), nitrogen (N), pH, and annual precipitation. Based on both shoot biomass and leaf relative chlorophyll content, three isolates consistently showed a higher symbiotic effectiveness than the exotic inoculant strain Bradyrhizobium IRAT-FA3, demonstrating their potential to serve as indigenous elite strains as bioinoculants.

1. Introduction

Soybean [Glycine max (L.) Merr.] is a pulse legume cultivated for its grains rich in proteins (40%), oil (20%), and carbohydrates (30%) [1]. G. max is also a source of vitamin E, bioflavonoids, oligosaccharides, phytosterols, saponins, and tocopherols and fiber food, all of which are very important for human and animal health [2]. It is the most cultivated food legume in the world, being actually grown on 125 million hectares of land with a global production of 353 million hectares per year [3,4]. Soybean-leading producers include Brazil, the United States of America (USA), and Argentina [3]. In addition to its nutritional value, G. max plays an important agroecological role in soil fertilization due to its ability to fix atmospheric nitrogen in root nodules through its symbiosis with soil bacteria collectively known as rhizobia [5]. The rhizobia-legume symbiosis is highly specific. Following complex recognition mechanisms between the two organisms, notably via a molecular dialogue, a specialized organ called nodule is formed on the roots (sometimes on the stems) of the plant to host the rhizobium. Subsequently, within the nodule, the intracellular rhizobium differentiates into a bacteroid capable of fixing atmospheric nitrogen by reducing it to ammonium using the nitrogenase [6]. In return, the plant provides the bacterium with photosynthesis products [7]. This biological process plays an essential role in sustainable agriculture, since it enables a reduction in exogenous nitrogen fertilizers while providing an efficient means of producing protein-rich food [8]. Nitrogen (N) deficiency in agricultural soils has led to an increased demand for chemical nitrogen fertilizers [9]. However, the excessive use of chemical inputs causes serious environmental problems such as eutrophication and water pollution [10]. Rhizobia have then become a source of plant growth-promoting microorganisms [11,12] in that elite strains can be isolated and used as biofertilizers for the host plant [11,13]. Consequently, efficient rhizobia are produced nowadays, and as such, represent a good solution to tackle food insecurity problems in a sustainable way in developing countries [14,15]. For this purpose, commercial biofertilizers have been widely developed [16]. However, it has been shown that commercial inoculants can be less competitive than indigenous strains [17]. Elite rhizobial inoculants must be selected within a background of native rhizobia that may show high effectiveness [18,19]. This means that the development of elite biofertilizers should imply a deep knowledge of rhizobial genetic diversity. Many ambitious programs have been initiated to better study the genetic diversity of the symbionts in order to find the best rhizobial strain(s) capable of increasing the yields of soybean varieties in fields without using chemicals fertilizers [14,20]. Genetic studies carried out in different countries have shown that rhizobial strains isolated from soybean nodules remarkably belong to diverse genera and species, despite the selectivity of the soybean–rhizobium symbionts pairing. Soybean nodulating rhizobia belong to four genera namely Bradyrhizobium, Mesorhizobium, Sinorhizobium (Ensifer), and Rhizobium [21,22]. However, Bradyrhizobium is the major genus and B. diazoefficiens, B. elkanii, B. japonicum and B. yuanmingense are the most dominant species isolated from soybean nodules so far. To date, the Bradyrhizobium genus comprises about ninety species reported in the LPSN website [23] (https://lpsn.dsmz.de/; accessed on 18 March 2024), all of which are scattered into seven supergroups/superclades defined by phylogenetic analysis [24,25]. Several molecular approaches have been used to determine the genetic diversity of rhizobia at the genus and/or species level. Among the molecular markers, the analysis of the intergenic space between 16S and 23S rDNA (ITS) and multiple housekeeping gene analysis (MLSA) are frequently used to elucidate rhizobial diversity and taxonomy [26,27]. However, unlike the 16S rDNA gene, the ITS and housekeeping sequences have a higher degree of resolution and successfully allow an accurate delineation of rhizobia of closely related lineages [26,28]. Indeed, housekeeping genes including atpD, glnII, recA, and rpoB are commonly used in MLSA analysis [26,27]. In addition, nifH and nodC symbiotic gene analysis are also widely used to characterize diazotrophic bacteria and to define symbiotic variants (symbiovars) [29,30]. Cut-off values of approximately 97% (glnII, recA) and 92.5% (nodC, nifH) were usually used in rhizobia study for species and symbiovars’ differentiation, respectively [29]. Moreover, genome sequencing and the calculation of genome-based metrics collectively known as the overall general relatedness index (OGRI) could also be performed depending on the main goal of the study [31].
In Africa, soybean production is relatively low while protein-based food demand is increasing in order to ensure food security. In Côte d’Ivoire, for example, soybean production, which is estimated at 568.47 tons from a cultivated area of 389 hectares [32], can be considered low as compared to that of leading producers. Different studies in African countries have shown that soybean production is limited by an incompatibility between local varieties and native rhizobia as well as several environmental constraints, including soil fertility and biotic stresses [33,34]. Some strategies have been developed to tackle these problems in order to increase soybean production. For example, the International Institute of Tropical Agronomy (IITA) in Nigeria has selected high-yielding soybean varieties by crossing disease-resistant soybean lines capable of adapting to multiple environments. The selected varieties are known as tropical glycine crosses (TGxs) and are expected to be promiscuous [35,36]. However, TGxs are limited in nodulation in certain African soils where native rhizobia exist in very low quantities or almost not at all [37]. Moreover, the introduction of TGx varieties has not been a success in some agroecological regions. Consequently, soybean inoculation with an effective bacterial strain is still necessary in a number of African countries in addition to using TGx varieties [38]. That is also the case in Côte d’Ivoire where soybean was introduced in 1970s [39]. Several research works have been carried out to increase the productivity of soybeans in Côte d’Ivoire. The National Agronomic Research Center (CNRA) has introduced in the country two promiscuous varieties of soybean from IITA, namely R2-231 and R2-217, to overcome the low nodulation ability of local soybean varieties [40]. At the same time, the commercial Bradyrhizobium strain IRAT-FA3 was introduced as bioinoculum two decades ago [39]. Unfortunately, all these initiatives did not allow a substantial increase in soybean yields due to several factors, including the competitiveness of resident rhizobia. Exogenous and endogenous factors such as temperature, the availability of total nitrogen, pH, salinity, and native rhizobia community influence the results of inoculation [33,38,41,42]. In this context, one of the alternative strategies to overcome these difficulties and to increase the production is to take the advantage of using performant native strains associated with soybean in different regions of Côte d’Ivoire [43,44]. It is important to note that Côte d’Ivoire can be divided into three main agro-ecological biomes [45] that include five bioclimatic zones. The Guinean biome, which is the agro-ecological zone with the highest rainfall, is located in southern Côte d’Ivoire and constitute the forest bioclimatic zone [46]. The forest–savannah transition zone, which corresponds to the Sudano–Guinean biome is characterized by a humid tropical climate. This represents a transition zone that takes place between the southern forest zone and the north. The north zone is dominated by the savannah. The transition zone is characterized by relatively low rainfall and a mixed landscape where the two types of vegetation coexist, termed the forest–savannah mosaic [47]. Recent studies have provided insights into the native bacteriobiome in Côte d’Ivoire soils [48]. Moreover, the studies by Gnangui et al. [49] evidenced the presence and dominance of Bradyrhizobium in the soils from northern Côte d’Ivoire using metagenomic approaches. However, if we were to develop local efficient bioinoculants, it is important to study the genetic diversity of soybean nodulating communities scattered throughout Côte d’Ivoire soils. A comprehensive study of the indigenous rhizobia strains associated with soybean in Côte d’Ivoire soils and their symbiotic effectiveness could serve as a guide to the production of efficient local bioinoculants. The aim of this study was to isolate soybean-nodulating rhizobia from Côte d’Ivoire soils and evaluate their potential as efficient strains for bioinoculant development. The specific objectives were to (1) reveal the composition of the soybean rhizobia community in Côte d’Ivoire soils, (2) estimate its distribution in correlation with different ecological factors and (3) identify highly-performant indigenous strains that could be recommended in the formulation of bioinoculants.

2. Materials and Methods

2.1. Soil Sampling

Forty-five (45) surface soil samples were recovered across the five major climate zones in Côte d’Ivoire (Figure S1) from August to September 2017 as reported earlier [49,50]. Briefly, four replicates of 25 g surface soil samples (0–5 cm depth) were collected in sterile Whirlpak® bags from the tops of a 100 m × 50 m plot at each pinpointed sampling site. Subsequently, they were pooled and each final 100 g sample was a composite of four 25 g pseudo-replicate subsamples collected from a 1 m2 quadrat. Samples were stored on ice and transported to the laboratory for further analysis. Seven composite soil samples, namely CI35, CI36, CI41, CI42, CI43, CI44, and CI45, were excluded from the study for quality concerns (Figure S1), and thus the subsequent analyses were performed on 38 soils (Figure 1). These analyses included the estimation of the number of viable and infective native rhizobia (trapping test) as well as the physico-chemical parameters of the sampled soils. A half of each soil sample was kept at 4 °C before being used for soil trapping, while the remaining half was shipped to the Center for Microbial Ecology and Genomics (CMEG) (University of Pretoria, South Africa) for physico-chemical analyzes. Samples were sieved (4 mm mesh) to remove plant roots and other debris and stored at −80 °C [48,49].

2.2. Soil Physico-Chemical Analyses

A total of eleven soil physicochemical parameters were analyzed at the University of Pretoria. All analyses were performed using composite soil samples as described elsewhere [48,49,50]. Briefly, soil pH was measured using the slurry method at a 1:2.5 soil/water ratio, while the Mehlich 3 extraction method [51] was used to quantify the concentrations of soluble and exchangeable sodium (Na), potassium (K), calcium (Ca), magnesium (Mg), and phosphorus (P) (mg/kg). Extractable ion concentrations were subsequently analyzed via inductively coupled plasma optical emission spectrometry (ICP-OES) (Spectro Genesis, SPECTRO Analytical Instruments GmbH & Co. KG, Kleve, Germany) [50]. The particle size distribution of the sampled soils, expressed as the relative proportions of sand, silt, and clay, was determined using the Bouyoucos sedimentation method [52]. Soil organic carbon (C) and total nitrogen (N) (also expressed as percentages) were quantified using the high-temperature catalyzed combustion method [53]. All these physico-chemical analyses were used to comprehensively characterize soil composition and their influence on rhizobia distribution.

2.3. Extraction of Bioclimatic Variables

The GPS coordinates of each sampling site were used to obtain bioclimatic data variables from the WorldClim2 global climate dataset [54] at a 30-arc-second resolution. These included mean annual temperature (Bio1, °C), temperature seasonality (Bio4, °C × 100), coldest-month minimum temperature (Bio6, °C × 10), mean annual precipitation (Bio12, mm), temperature isotherm (Bio3, %), driest-month precipitation (Bio14, mm), and precipitation seasonality (Bio15, %) (Table S1) [50].

2.4. Bacterial Trapping and Isolation

Bacterial trapping was performed under controlled conditions in a growth chamber with a 16 h light/8 h dark photoperiod (16 h/8 h), a temperature range of 26–27 °C, and a humidity level of 63–65% using the promiscuous soybean variety R2-231 as trap plant (Table S2). The seeds of this variety of soybean were provided by the Centre National de Recherche Agronomique (CNRA) and were grown in a lighted culture chamber once prepared for the test. First, the seeds were surface sterilized by immersion in 70% alcohol (v/v) for 1 min and rinsed three times with sterile distilled water (ddH2O), then immersed in a 3% (w/v) sodium hypochlorite (NaClO) solution for 3–5 min and subsequently rinsed four times with ddH2O. To germinate, surface sterilized seeds were incubated for three days in the dark, at 30 °C and on 9% agar water (g/L) plates. After three days, germinated seeds were planted in Magenta jars (one seedling per jar) containing sterile vermiculite [55], and watered using nitrogen-free buffered nodulation medium (BNM) solution [56]. The Magenta jars were filled at the upper part only with vermiculite, covered with aluminum foil, and sealed with adhesive tape. When plantlets emerged from the vermiculite, each of them was inoculated with 1 mL of a diluted soil solution (1/10) containing potential symbiotic bacteria. For each soil, 10 g was taken from the sample kept at 4 °C and then used for the dilution, resulting in 38 different diluted soil solutions. For inoculation, we used 38 soil types, each with three replicates, and negative controls consisting of the non-inoculated plants, totaling 117 plants (Table S2). Inoculated plants were then grown in controlled conditions with a light phase of 16 h, a day temperature of 27 °C, a night temperature of ca. 20 °C and 60–70% humidity. After four weeks of growth, the symbiotic infectivity and efficiency of each soil inoculant was assessed using as parameters the nodule number (NN), plant shoot height (SH), dry weight of shoots (SDW), and the presence/absence of leghemoglobin inside nodules. To assess shoot height and dry biomass, plant shoots were first measured and then harvested and dried in an oven at 105 °C for 5 to 7 days. To assess the remaining parameters, the plants were unpotted and the root system was washed with tap water. After nodule counting, 10 nodules of each replicate were collected and sterilized with the following conditions: incubation in 70% alcohol (v/v) for 30 s, disinfection with 3% NaClO (w/v) for 30 s with intermediate washing steps using sterile ddH2O. Once sterilized, each nodule was crushed into ca. 50 µL of sterile ddH2O in sterile tubes. Finally, an aliquot of the nodule lysate (ca. 10 μL) was used to inoculate a Petri dish containing yeast mannitol agar (YMA) medium [57]. The plates were then incubated at 28 °C for 7 to 14 days and bacterial growth monitored each two days. When nodule isolates started growing, the purification of the bacteria was carried out with a sterile oese by the quadrant or exhaustion method and several successive subcultures were necessary to ensure the purity of the different isolates [58]. Thus, all of the isolates described in this study and used for functional and molecular analyses were first purified.

2.5. Authentication Experiment and Storage of Isolates

An authenticated assay was carried out to assess the capacity of each isolate to induce nodule formation on their original host. Two to three isolates were selected per soil and used to inoculate the soybean variety R2-231 following the same conditions as in the trapping test, with a few modifications, however. Briefly, when plantlets emerged from the vermiculite of the Majenta jar system, each of them was inoculated with 1 mL of a YEM solution containing 2 × 108 freshly grown bacteria. After four weeks of growth, the bacterial isolates having a positive effect on soybean plant growth were considered as the true symbionts of soybean and were stored in two independent copies at −80 °C for further analysis.

2.6. PCR Amplification and Phylogenetic Analyses

Authenticated bacterial colonies were collected from Petri dishes using sterile toothpicks and underwent thermal shock. Colonies were then amplified by targeting the intergenic region ITS 16S-23S of the rRNA operon as well as two housekeeping genes (glnII and recA) and two symbiotic (nodC and nifH) gene markers. These genes were commonly recommended for rhizobia species identification and/or symbiovar differentiation [29,30]. The PCR primers and protocols used are described in Table 1. Amplifications of the 16S-23S ITS, glnII, recA, nodC and nifH sequences were carried out on a T-Gradient thermocycler (Biometra, Göttingen, Germany) in 50 µL PCR reactions and the success of the PCR was verified by 1% (w/v) agarose gel electrophoresis visualizing under ultra violet light.
PCR products obtained from authentic rhizobial strains were sequenced by GenoScreen (https://www.genoscreen.fr/fr/10/10/21, accessed on 23 June 2025) using the Sanger method. The nucleotide sequences obtained were verified, and, if necessary, corrected manually using Chromas Pro version 1.49 beta. Edited sequences were then compared to those of the rhizobium reference strains available from GenBank database, using the basic local alignment BLAST v. 2.13.0 tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 23 June 2025). Putative phylogenetic relationships of the isolates were inferred with the MEGA software version 7 [63], using multiple sequence alignment performed with ClustalW (for glnII, recA, nifH and nodC) or MUSCLE (for ITS 16S-23S) as previously suggested [27]. Neighbor-joining (NJ) or maximum likelihood (ML) trees were constructed based on 1000 bootstrap replicates and best-fit nucleotide substitution model selected according to the Bayesian information criterion (BIC) [64]. Models with the lowest BIC scores are considered to describe the substitution pattern the best [63]. Additionally, we performed a detailed analysis for ITS 16S-23S and the two housekeeping genes. Sequences of ITS were used to assess the genetic diversity level of the isolates using amplicon sequence variants (ASVs) approach that could identify uniquely distinguishable taxa at 100% cut-offs (one nucleotide polymorphism level) [65], including Bradyrhizobium [49]. Partial housekeeping gene sequences were concatenated with Seaview ver. 4 and used to further identify Bradyrhizobium isolates at the species level [60,66]. Cut-off values of approximately 97% (glnII + recA) and 92.5% (nodC, nifH) were used for classifying isolates [29]. All DNA sequences used in this study were deposited in GenBank and their accession numbers are listed in Table S3. Accession numbers are the following: PV696459–PV696486 (glnII), PV696487–PV696514 (recA), PV696515–PV696542 (nifH), and PV759063–PV759089 (nodC).

2.7. Bacterial Symbiotic Efficiency Test

The symbiotic efficiency test of selected authenticated rhizobia isolates was carried out mainly on the basis of their molecular identification and phylogenies. For this test, the Magenta jar system was used and the experimental conditions were the same as described before. Briefly, soybean variety R2-231 seeds were sterilized, pre-germinated, planted (one plantlet/jar), inoculated with 2 × 108 freshly grown bacteria and watered with N-free BNM solution for four weeks. The positive control of the symbiotic efficacy assay was the commercial Bradyrhizobium strain IRAT-FA3 [39]. For each tested strain, there were 5 repetitions, 5 repetitions for the positive control, and 5 repetitions for the negative control (without inoculation) totaling 165 plants. After four weeks of growth in controlled conditions, all treatments were compared using different parameters such plant shoot biomass (SDW) and leaf relative chlorophyll content which was assessed using a Minolta SPAD-502 chlorophyll meter (Konica Minolta SPAD 502, Osaka, Japan) an effectiveness index (EI) of isolates was calculated by the shoot biomass of each test strain divided by shoot biomass from the reference inoculant IRAT-FA3 strain. Based on EI, rhizobia isolates were placed under four different categories: highly effective, effective, partly effective, and ineffective [67].

2.8. Determination of Viable and Infective Indigenous Rhizobia

The most probable number (MPN) assay was used to estimate the number of viable and infective native rhizobia contained in 1 g solution of each the sampled soils [68]. Ten grams of each tested soil was used and they were first diluted in aseptic condition in 90 mL sterilized double distilled water (ddH2O) [69]. This was mixed thoroughly to disperse the soil particles. Then, 10-fold dilutions were subsequently performed for each soil by adding 9 mL of ddH2O into 1 mL from its first dilution. Serial dilutions were continued up to 10−6 for each of the soils and they were used to inoculate seedlings of the soybean variety R2 231, which had been previously sterilized and grown in Gibson tubes in four replications. Positive and negative nodulation were assessed on the soybean root system 28 days after inoculation for all dilutions and converted into a number of rhizobia g−1 using MPN table. Nodule scoring and nodulation categories were assessed following the standard protocol recommended for soybean by N2-Africa project [70].

2.9. Statistical Analyses and Diversity Estimation

Principal component analysis (PCA) and multifactorial analyses of physico-chemical parameters and climatic variables were carried out using the FactoMineR [71] and factoextra [72] packages with R software. Determination of diversity indices and canonical redundancy analysis (RDA) was carried out using the vegan package (version 2.6–6.1) [73] and ggplot2 [74]. Prior to statistical analyses, data normality was assessed using the Shapiro–Wilk test [75]. Since the dataset did not meet the normality assumptions of normality, non-parametric tests were used. The mean and standard deviation of the various environmental variables were calculated beforehand, then the Kruskal–Wallis test [76] was applied to assess significant differences between variables. All statistical analyses were performed using R software v. 4.3.3 (https://www.R-project.org) (R Core Team, 2024). Diversity indices for each site were calculated using a site ASV abundance matrix with the vegan package (version 2.6–6.1) [73]. Species richness was estimated using the Shannon–Wiener diversity index (H) and the true Shannon index. In addition, the Pielou regularity index (J’) was used to quantify the uniformity of species distribution across sampling sites.

3. Results

3.1. Côte d’Ivoire Harbor Diverse Soil Types Exhibiting Different Nodulating Potential

Thirty-eight soils were sampled in total within all five major climatic zones that cover Côte d’Ivoire (Figure 1). The particle size analysis identified four distinct soil textural classes: sandy clay loam (36.84%), loam (10.51%), loamy sand (36.84%), and sandy loam (15.80%) (Table S1). Consequently, the majority of soils in Côte d’Ivoire were classified as either sandy clay loam or loamy sand. The soil pH in Côte d’Ivoire varied significantly, ranging from 4.94 (highly acidic) to 7.78 (slightly alkaline). The pH levels differed across climatic zones and vegetation types. For example, in the Sudanese zone, the average soil pH was 5.86, indicating slightly acidic conditions, whereas in the Sub-Sudanese zone, the pH was closer to neutral. In total, 21 quantitative variables were analyzed and used to compare all five major climatic zones of Côte d’Ivoire (Figure 2; Table S4). Significant differences were revealed between vegetation zones. Principal component analysis (PCA) accounted for 58.1% of the variability in the measured parameters, enabling the identification of four distinct environmental groups. The analysis showed that the Sudanese and sub-Sudanese vegetation zones shared similar environmental characteristics (Figure 2).
The ability of the 38 soil samples to support soybean plant nodulation was evaluated using a plant infection test also known as trapping test (Figure 3; Table S2). The analysis identified a subset of four soils (CI-03, CI-25, CI-31, and CI-38) that were ineffective in promoting soybean nodulation, in contrast to 34 other soils (Figure 3). In total, Figure 3 presents the classification of soils into four groups based on their ability to support nodulation: (i) Group 1 (10.5%): No nodules were observed on plant roots, indicating that these soils may not contain rhizobia compatible with the variety R2-231 of soybean used for the assay; (ii) Group 2 (36.8%): few nodules were detected on the root system (<10 nodules/plant); and (iii) Group 3 and Group 4 (52.6%): Plants exhibited moderate to abundant nodulation (>10 nodules/plant), suggesting more favorable conditions for soybean nodulation. However, soil with the super-nodulation feature (>50 nodules/plant) was not observed. MPN count assessed on about 30% of soil samples revealed that the majority of soils had an indigenous rhizobia population ranging from 0.1 × 101 to 2.4 × 101 per gram of soil (Table S2).

3.2. Bradyrhizobium elkani Supergroup Dominates Soybean Nodulating Communities in Côte d’Ivoire

During the isolation, three to four bacterial strains were isolated and purified from the nodules collected per soil. Thus, a total of 110 bacterial isolates were collected from the 34 soil samples that succeed to nodulate soybean variety R2-231 (Table S3). The bacterial colonies had a circular shape with a regular edge, convex, compact, translucent, with a variable size depending on the isolates from 2 to 4 mm. These colonies remained white or rarely became pink. According to these morphological characteristics, the strains appeared to agree with the description by Jordan [77,78] and Vincent [57] for slow-growing rhizobia, including Bradyrhizobium [22]. Each colony on YMA medium was preserved at −80 °C with 30% (w/v) glycerol for subsequent analysis, including the molecular identification of isolates using a DNA sequencing analysis of the ITS rDNA 16S-23S region. After sequencing and assembly, an average of three ITS sequences of good quality and size (600 to 700 bp length) were recovered from each soil sample resulting in a total of 110 sequences submitted to Blast N and phylogenetic analyses. Blast N analysis confirmed that all sequences belonged to Bradyrhizobium genus only. The ITS phylogeny of the 110 Bradyrhizobium isolates constructed together with their closely related sequences obtained from GenBanK (nr/wgs databases) revealed that they were distributed into only two supergroups, namely Bradyrhizobium elkanii and B. japonicum (Figure 4), out of seven supergroups commonly known to this date [24,25].
Of the 110 Bradyrhizobium isolates, 82 belonged to the B. elkanii supergroup (75% of all isolates), revealing the dominance of this species complex that harbor more than 20 recognized species. Within the B. elkanii supergroup, the 82 bacteria were phylogenetically related to B. elkanii/B. brasilense’ species complex (Figure 5). The Bradyrhizobium japonicum supergroup with 28 isolates seems closely related to the B. vignae and B. diazoefficiens/B. japonicum species complex. In order to further estimate the genetic diversity among these soybean isolates, both ITS phylogeny and sequence similarity values (P-distance) were used to cluster the 110 sequences into amplicon sequence variants (ASVs) that differed with at least one nucleotide. It was shown that all 110 isolates belonged to the 36 ASVs dominated by five ASVs based on their relative abundance, including ASV1 (n = 26), ASV2 (n = 25), ASV3 (n = 7), ASV4 (n = 5), and ASV5 (n = 4), all of which belonged to B. elkanii supergroup (Figure 5). In contrast, the 28 isolates of the B. japonicum supergroup clustered into 21 ASVs with a very low relative abundance in general (16 ASVs were singletons) (Figure 5).

3.3. MLSA and Symbiotic Gene Phylogenies

The results obtained from the phylogeny of ITS were further confirmed by the analysis of the two housekeeping genes (glnII and recA) using about 30 representative isolates selected from the two supergroups. The single gene phylogeny of glnII and recA consistently showed that the isolates were distributed into B. elkanii and B. japonicum supergroups (Figures S2 and S3). A concatenated phylogeny of the two genes (glnII + recA) showed that the majority of selected isolates (n = 19) belong to B. brasilense species (Figure 6), sharing 99.6 to 100% similarity values with its type strain UFLA 03-321T. Only two isolates from B. japonicum supergroup were identified as B. vignae strains, while the remaining isolates were close to several undescribed genospecies of Bradyrhizobium (similarity values < 97%). The commercial inoculant strain IRAT-FA3 was also identified as a member of the Bradyrhizobium japonicum species (Figure 6). The single phylogenies of the symbiotic genes nodC (Figure 7) and nifH (Figure S4) confirmed the presence of Bradyrhizobium-related symbiotic gene sequences on isolates nodulating soybean in Côte d’Ivoire soils. However, the topology of the symbiotic gene trees were not found to be congruent with ITS and housekeeping gene phylogenies (Figure 5 and Figure 6). We also found that Ivorian soybean variety R2 231 isolates belong to three symbiovars: sv. tropici, sv. Glycinearum, and sv. cajani. They are dominated by sv. tropici (70% of isolates).

3.4. Soil Factors That Shape the Distribution of Soybean Nodulating Bradyrhizobium Isolates in Côte d’Ivoire

The redundancy analysis (RDA) was used to model the impact of environmental variables on the distribution of soybean nodulating Bradyrhizobium species recovered from Côte d’Ivoire soils. The included environmental variables explained 19.66% of the variation in bacterial community composition between sites (Figure 8). Annual precipitation (Bio12), magnesium (Mg), and pH were the variables that attracted more Bradyrhizobium community variation or distribution. In total, the key explanatory variables influencing species distribution were annual precipitation (Bio12), carbon (C), nitrogen (N), pH, and magnesium (Mg) (Figure 8).

3.5. Diversity and Distribution of Soybean Nodulating Bradyrhizobium Isolates Within Côte d’Ivoire Soils

Diversity indices revealed significant variations in bacterial diversity and species richness across the different sampling sites. Sites located in the sub-Sudanese zone exhibited the highest species richness, including several distinct Bradyrhizobium species. Regarding vegetation zones, at least two Bradyrhizobium species were found to be exclusive to the tropical, mesophilic, and sub-Sudanese forest regions. The Shannon–Weiner diversity index (H′) reached a maximum value of 1.098 in the mesophilic zone (Figure S5). In contrast, six sampling sites recorded an H′ value of 0—specifically CI10 and CI18 (Sudanese zone), CI20 and CI21 (pre-forest zone), and CI06 and CI24 (mesophilic zone)—indicating the presence of a single species (species richness S = 1), and thus, an absence of diversity in these sites. Pielou’s evenness index (J) ranged from 0.81 to 1.0, indicating variability in species distribution across sites. Collectively, these results suggest considerable spatial heterogeneity in the diversity and composition of soybean-associated rhizobial communities. However, the Kruskal–Wallis test indicated that differences in ecological indices among vegetation zones were not statistically significant (p > 0.05), implying no significant variation in diversity metrics across vegetation types (Figure S5).

3.6. Highly Effective Indigenous Bradyrhizobium Strains from Côte d’Ivoire Outcompeted the Commercial Inoculant Strain IRAT-FA3 on Soybean

About 30 indigenous Bradyrhizobium strains were tested to determine their effectiveness after 28 days post inoculation, together with the reference inoculant strain IRAT-FA3. All the isolates clustered into four (4) groups according to the symbiotic performance of the IRAT-FA3, which is considered as the reference with an effectiveness index of 1 (EI = 1). The data showed that 11 indigenous bacteria (>35% off all isolates) outperformed the IRAT-FA3 strain for shoot biomass (Figure 9). Multiple comparisons of biomass averages between the highly effective isolates identified Soja43, Soja82 and Soja119 as the three best candidates (p < 5%) (Figure S6). Moreover, the relative leaf chlorophyll content measured also four weeks after plant inoculation showed that these three isolates always outperformed the IRAT-FA3 (Figure S7).

4. Discussion

Soybean varieties could produce high yields of seeds with a very low amount of N-fertilizers or even without the use of chemical fertilizers when they are inoculated with highly effective inoculant strains adapted to local farming conditions [14,20]. For this reason, the bioprospection and selection of indigenous performing rhizobia constitute a good strategy for fostering the production of soybean, especially in Africa where smallholder farmers usually have limited access to agrochemicals due to financial issues. This study carried-out in this context of developing eco-friendly solutions provided, for the first time, an in-depth look into indigenous soybean-nodulating rhizobia ecology in Côte d’Ivoire. The physicochemical analysis of the sampling soils showed four distinct soil textural classes dominated by sandy clay loam (36.84%) and loamy sand (36.84%) classes, followed by sandy loam (15.80%) and loam (10.51%). Soil pH varied significantly, ranging from 4.94 (highly acidic) to 7.78 (slightly alkaline), being consistent with the pH range already reported for Côte d’Ivoire soils [48]. The MPN count assessed for about 30% of these soil samples revealed that the majority have an indigenous rhizobia population lower than 102 per gram of soil. These data suggest that soil and/or seed inoculation is required before soybean cultivation in Côte d’Ivoire. Contrasting findings have been reported on the need-to-inoculate legumes [79]. While it was commonly assumed that the response to inoculation is positive when there are less than 10 cells of native or naturalized rhizobia per gram of soil or when a significant part of the population is not effective [80,81], positive responses of soybean to reinoculation in soils with over 103 cells and even 106 cells g−1 of soil have been reported in different countries in America and Africa [14,82]. Different abiotic factors such as the availability of total nitrogen, pH, salinity, and temperature are also known to influence the results of inoculation. Overall, the MPN test not only serves as an indicator to assess the need-to-inoculate legumes, but also helps to better understand the outcome of the symbiotic infectivity of each soil used as inoculant in trapping assays. In this study, soil with the super-nodulation feature (>50 nodules/plant) was not observed, showing a congruence between the results of the trapping test and the relative low indigenous rhizobia population predicted by the MPN test. Working on nodules collected from the trapping test, a catalogue of 110 bacteria strains were isolated, authenticated, and subsequently identified at the molecular level as members of the Bradyrhizobium genus. All these data constitute the first such study to ever be undertaken in Côte d’Ivoire at this scale on soybean symbionts. Indeed, pioneering studies have been carried out to characterize the rhizobia community nodulating soybean in Côte d’Ivoire soils, but were conducted in a few localities based on phenotypic identification [44,83]. In general, genetic diversity and phylogeny of legume symbionts remains poorly explored in Côte d’Ivoire. To date, comprehensive molecular data exist only for pigeon pea symbionts [27,84], cowpea [85], and to a lesser extent for bambara groundnut [86,87] and common bean [88]. For pigeon pea and cowpea, different studies revealed Bradyrhizobium isolates as the main symbionts in Côte d’Ivoire [27,84,85]. To obtain insights into soybean isolate diversity, we used the intergenic transcribed spacer (ITS) sequences between the 16S and 23S genes of the ribosomal operon as markers for phylogenetic reconstructions, together with two housekeeping genes. ITS 16S-23S is widely used to decipher the genetic diversity of plant-associated bacteria, including rhizobia, due to its good resolution [27,89,90]. Since ITS sequences are not translated and do not undergo the same selective pressure as ribosomal RNAs encoding genes, they evolve more rapidly. Since these sequences encode copies of transfer RNA (tRNA), ITSs are nevertheless subject to selection, being suitable for inferring phylogenetic relationships [27,89,91]. BlastN analysis using ca. 700 bp-long ITS sequences showed that all the 110 bacteria symbionts isolated from soybean variety R2-231 nodules are only members of the genus Bradyrhizobium. The subsequent ITS phylogenies revealed that the Bradyrhizobium brasilense species from the B. elkanii supergroup dominates symbiotic interactions with soybean in Côte d’Ivoire fields, together with B. vignae and B. japonium from the B. japonicum supergroup. Many edaphic parameters including soil pH, organic carbon (C), particle size, nitrogen (N), calcium (Ca), and magnesium (Mg) are demonstrated to be determinants of rhizobial distribution in legumes across many geographical areas [92,93]. Overall this study evidenced that rhizobial species distribution in Côte d’Ivoire was influenced by factors including annual precipitation (Bio12), carbon (C), nitrogen (N), pH, and magnesium (Mg). Up to now, soybean nodulating rhizobia belong to Bradyrhizobium, Mesorhizobium, Sinorhizobium (Ensifer), and Rhizob [21,22], but Bradyrhizobium dominated in the nodules of soybean from neutral to acidic and slightly alkaline soils. Soil pH variation in Côte d’Ivoire, which ranges from highly acidic to slightly alkaline in the sampling sites, is adequate for soybean nodulation by strains belonging to the genus Bradyrhizobium. In more alkaline soils, soybean varieties are preferentially nodulated by the strains of Sinorhizobium [94,95]. Moreover, rhizobia strains of B. elkanii superclade are often the dominant microsymbionts associated with soybean in Africa [96,97], America [97,98], and Asia [99,100]. This study evidenced a significant rhizobial diversity variation and species richness across the different bioclimatic zones. Indeed, the sub-Sudanese zone exhibited several distinct Bradyrhizobium species while others did not. Regarding vegetation zones, at least two Bradyrhizobium species were found to be exclusive to the tropical, mesophilic, and sub-Sudanese forest regions. The identification of Côte d’Ivoire soybean isolates obtained from ITS phylogeny was confirmed by the single and concatenated gene phylogenies of housekeeping genes glnII and recA. Indeed the ultilocus sequence analysis (MLSA) of housekeeping genes has been generally used to refine rhizobial phylogenies [26,101,102]. However, the partial sequences of glnII and recA are commonly analyzed to refine the taxonomic position of rhizobia isolates because their phylogeny is highly consistent with the taxonomic scheme of the Bradyrhizobium genus [60]. glnII and recA and gyrB/dnaK were shown to be performant markers, either individually or in combination, for assessing the evolutionary genetics of Bradyrhizobium as described elsewhere [60]. Moreover these genes represent the only housekeeping gene sequences that are available for all Bradyrhizobium described species so far [66,84]. However, there were not found to be sufficient for the taxonomic description of novel rhizobial taxa. In this study, seven isolates from the B. japonicum supergroup showed a low similarity values with the type strains of the closely related species (similarity values of glnII + recA < 97%), suggesting that they could represent a novel Bradyrhizobium species. Further molecular analyses are needed to better elucidate their taxonomic position, including genome sequencing and the calculation of genome-based metrics such as the average nucleotide identity (ANIm or ANIb), digital DNA–DNA hybridization (dDDH), and Genome BLAST distance phylogeny (GBDP) [31]. The phylogenetic analysis of symbiotic genes is useful to understand the evolutionary history of diazotrophic bacteria and to define symbiotic variants [29,30]. Here, we found that Ivorian soybean isolates belong in majority to symbiovar tropici (~70% of isolates). Symbiovar tropici, recently renamed as sv. tropiciagri [30], was described using nodC sequences of Bradyrhizobium embrapense, B. viridifuturi, and B. tropiciagri strains [103]. These strains were isolated from diverse legumes, including the perennial soybean (Neonotonia wightii) [104,105]. Our study showed that this symbiovar is also found in Bradyrhizobium strains isolated from the nodules of the cultivated soybean, variety R2 231. The topology of the nodC and nifH trees were not always found to be congruent with the phylogenies of ITS and housekeeping genes, probably due to lateral gene transfer influence on the symbiotic genes, as reported previously [27]. It has been documented many decades ago for different genera of rhizobia, including Mesorhizobium [106,107,108,109] and Bradyrhizobium [110,111]. It is reported that this mechanism contributes to the promotion of symbiotic gene dispersal to various non-symbiotic bacteria and to diversify the number of rhizobial solutions to fit with the legume plant’s needs [106,112]. Unfortunately, such diversification of potential legume symbionts in soils often reduces the beneficial effects of bioinoculants on legume crops [27,109]. When this type of condition occurs, the inoculation strategy needs to be adapted to ensure the success of the bioinoculants. Our study also revealed that three isolates consistently showed a higher symbiotic effectiveness than the commercial inoculant strain Bradyrhizobium IRAT-FA3, regardless the parameters used for the comparison, e.g., shoot biomass, leaf chlorophyll content, etc. Bradyrhizobium strain IRAT-FA3 was introduced in Côte d’Ivoire at least two decades ago [39], but the response of soybean genotypes to this exotic rhizobia strain is very scarce in Côte d’Ivoire soils [44,113]. These results demonstrate the potential of the indigenous rhizobia isolates to serve as local bioinoculants in Côte d’Ivoire. To transform these interesting results into effective bio-solutions for soybean producers, additional tests need to be carried out in future experiments, including field trials in which the effectiveness and competitiveness of the pre-selected isolates could be challenged in adverse conditions, notably in terms of they affect soil microbial communities [114]. However, since these strains are indigenous to Côte d’Ivoire soils; there should be an increased likelihood that the competitiveness and effectiveness observed in greenhouses are the same in adverse field conditions.

5. Conclusions

This work undertook a national scale study in Côte d’Ivoire in order to investigate the rhizobial communities that nodulate soybeans in Côte d’Ivoire. As a result, soybean-nodulating rhizobia were scattered into two Bradyrhizobium clades dominated by B. elkanii in all Côte d’Ivoire biomes. The distribution of these Bradyrhizobia was mainly influenced by factors including soil carbon (C), magnesium (Mg), nitrogen (N), pH, as well as annual precipitation. Based on both shoot biomass and leaf relative chlorophyll content, three isolates consistently showed higher symbiotic effectiveness than the exotic inoculant strain Bradyrhizobium IRAT-FA3, demonstrating their potential to serve as indigenous elite bioinoculants. In sum, this work, which is a pioneer in terms of studies being carried out at this scale in Côte d’Ivoire, unraveled the genetic diversity of soybean-nodulating rhizobia in Côte d’Ivoire, and opened a new era to use indigenous Bradyrhizobial isolates as soybean bioinoculants.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/agronomy15071720/s1, Figure S1. Map of Côte d’Ivoire showing the 45 sampling sites covered in this study. Figure S2. Single gene phylogeny of glnII. Figure S3. Single gene phylogeny of recA. Figure S4. Phylogeny of the symbiotic gene nifH. Figure S5. Diversity indices compared between the five climatic zones of Côte d’Ivoire. Figure S6. Multiple comparison of plant biomass produced by the highly effective symbiotic bacteria isolated from Côte d’Ivoire. Figure S7. The effectiveness index (EI) of indigenous rhizobia isolates on soybean variety R2 231. Table S1. Sampling sites and their relevant characteristics. Table S2. Soil samples used in bacteria trapping assay and their relevant characteristics. Table S3. Isolates analyzed in this study and their accessions number for selected markers. Table S4. Mean of environmental and physico-chemical characteristics of all five climatic zones.

Author Contributions

A.Z.: Study conception, supervision. M.A.A., C.C. and R.K.F.: data acquisition. A.Z., M.A.A., C.C. and R.K.F.: methodology. M.A.A., A.E.T.E., C.E.R.-E.A., R.K.F. and Z.G.C.K.-Z.: software, data analysis, writing—review and editing. M.A.A., A.E.T.E. and R.K.F.: validation and data curation. M.A.A.: writing—original draft preparation. A.Z., R.K.F., S.F., C.C. and Z.G.C.K.-Z.:—review and editing. A.Z.: funding acquisition. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the US Agency for International Development (USAID), grant number 674-AA-2010-A1.

Data Availability Statement

Data are contained within the article and Supplementary Materials.

Acknowledgments

We would like to acknowledge the Cooperation and Cultural Action Department (SCAC) of the French Embassy for the scholarship that enabled M.A.A. to stay at the Laboratoire des Symbioses Tropicales et Méditerranéennes, Institut de Recherche pour le Développement, UMR Institut de Recherche pour le Développement/SupAgro/Institut National de la Recherche Agronomique/Université de Montpellier and in the Laboratoire Commun de Microbiologie (LCM) IRD/ISRA/UCAD, Centre de Recherche de Bel Air, Dakar, Sénégal.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

APCPrincipal component analysis
ASVAmplicon sequence variants
BLAST Basic local alignment
BNMBuffered nodulation medium
CNRA National Agronomic Research Center
DNADeoxyribonucleic acid
EIEffectiveness index
FAOFood and Agriculture Organization of the United Nations
GPSGlobal Positioning System
IITAInternational Institute for Tropical Agriculture
IRATInstitut de Recherche d’Agronomie Tropicale
ITSInternal transcribed spacer
LPSNList of prokaryotic names with standing in nomenclature
MEGA Molecular evolutionary genetic analysis
MLSAMulti-locus sequence analysis
MPNMost probable number
OGRIOverall general relatedness index
PCRPolymerase chain reaction
RDARedundancy analysis
RNARibonucleic acid
SDWShoot biomass
SPADChlorophyll meter
TGxTropical glycine cross
USAUnited States of America
YEMYeast-extract-mannitol
YMAYeast mannitol agar

References

  1. Meghvansi, M.K.; Prasad, K.; Mahna, S.K. Symbiotic Potential, Competitiveness and Compatibility of Indigenous Bradyrhizobium japonicum Isolates to Three Soybean Genotypes of Two Distinct Agro-Climatic Regions of Rajasthan, India. Saudi. J. Biol. Sci. 2010, 17, 303–310. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Qiu, L.-J.; Chang, R.-Z. The Origin and History of Soybean. In The Soybean Botany, Production and Uses; Singh, G., Ed.; CABI: London, UK, 2010; pp. 1–23. [Google Scholar]
  3. FAO. 2020. Available online: https://www.fao.org (accessed on 16 June 2025).
  4. Herridge, D.F.; Giller, K.E.; Jensen, E.S.; Peoples, M.B. Quantifying Country-to-Global Scale Nitrogen Fixation for Grain Legumes II. Coefficients, Templates and Estimates for Soybean, Groundnut and Pulses. Plant Soil. 2022, 474, 1–15. [Google Scholar] [CrossRef] [Scilit]
  5. Graham, P.H.; Vance, C.P. Legumes: Importance and Constraints to Greater Use. Plant Physiol. 2003, 131, 872–877. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Perret, X.; Staehelin, C.; Broughton, W.J. Molecular Basis of Symbiotic Promiscuity. Microbiol. Mol. Biol. Rev. 2000, 64, 180–201. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Wang, D.; Yang, S.; Tang, F.; Zhu, H. Symbiosis Specificity in the Legume—Rhizobial Mutualism. Cell. Microbiol. 2012, 14, 334–342. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  8. Hirsch, A.M.; Lum, M.R.; Downie, J.A. What Makes the Rhizobia-Legume Symbiosis so Special? Plant Physiol. 2001, 127, 1484–1492. [Google Scholar] [CrossRef] [PubMed]
  9. Simon, Z.; Mtei, K.; Gessesse, A.; Ndakidemi, P.A. Isolation and Characterization of Nitrogen Fixing Rhizobia from Cultivated and Uncultivated Soils of Northern Tanzania. Am. J. Plant Sci. 2014, 5, 4050–4067. [Google Scholar] [CrossRef]
  10. Snapp, S.; Rahmanian, M.; Batello, C.; Calles, T. Légumes Secs et Exploitations Durables en Afrique Subsaharienne; FAO: Rome, Italy, 2018. [Google Scholar]
  11. Fahde, S.; Boughribil, S.; Sijilmassi, B.; Amri, A. Rhizobia: A Promising Source of Plant Growth-Promoting Molecules and Their Non-Legume Interactions: Examining Applications and Mechanisms. Agriculture 2023, 13, 1279. [Google Scholar] [CrossRef] [Scilit]
  12. Velázquez, E.; Carro, L.; Flores-Félix, J.D.; Martínez-Hidalgo, P.; Menéndez, E.; Ramírez-Bahena, M.-H.; Mulas, R.; González-Andrés, F.; Martínez-Molina, E.; Peix, A. The Legume Nodule Microbiome: A Source of Plant Growth-Promoting Bacteria. In Probiotics and Plant Health; Kumar, V., Kumar, M., Sharma, S., Prasad, R., Eds.; Springer: Singapore, 2017; pp. 41–70. [Google Scholar] [CrossRef] [Scilit]
  13. Xavier, G.R.; Jesus Ede, C.; Dias, A.; Coelho, M.R.R.; Molina, Y.C.; Rumjanek, N.G. Contribution of Biofertilizers to Pulse Crops: From Single-Strain Inoculants to New Technologies Based on Microbiomes Strategies. Plants 2023, 12, 954. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Hungria, M.; Mendes, I.C. Nitrogen Fixation with Soybean: The Perfect Symbiosis? John Wiley & Sons: Hoboken, NJ, USA, 2015; Volume 2. [Google Scholar] [CrossRef] [Scilit]
  15. Thilakarathna, M.S.; Raizada, M.N. A Meta-Analysis of the Effectiveness of Diverse Rhizobia Inoculants on Soybean Traits under Field Conditions. Soil. Biol. Biochem. 2017, 105, 177–196. [Google Scholar] [CrossRef] [Scilit]
  16. Thuita, M.; Pypers, P.; Herrmann, L.; Okalebo, R.J.; Othieno, C.; Muema, E.; Lesueur, D. Commercial Rhizobial Inoculants Significantly Enhance Growth and Nitrogen Fixation of a Promiscuous Soybean Variety in Kenyan Soils. Biol. Fertil. Soils 2012, 48, 87–96. [Google Scholar] [CrossRef] [Scilit]
  17. Desta, M.; Akuma, A.; Minay, M.; Yusuf, Z.; Baye, K. Effects of Indigenous and Commercial Rhizobia on Growth and Nodulation of Soybean (Glycine max L.) under Greenhouse Condition. Open Biotechnol. J. 2023, 17, 1–8. [Google Scholar] [CrossRef] [Scilit]
  18. Checcucci, A.; DiCenzo, G.C.; Bazzicalupo, M.; Mengoni, A. Trade, Diplomacy, and Warfare: The Quest for Elite Rhizobia Inoculant Strains. Front. Microbiol. 2017, 8, 2207. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Onishchuk, O.P.; Vorobyov, N.I.; Provorov, N.A. Nodulation Competitiveness of Nodule Bacteria: Genetic Control and Adaptive Significance: Review. Appl. Biochem. Microbiol. 2017, 53, 131–139. [Google Scholar] [CrossRef] [Scilit]
  20. Alves, B.J.R.; Boddey, R.M.; Urquiaga, S. The Success of BNF in Soybean in Brazil. Plant Soil. 2003, 252, 1–9. [Google Scholar] [CrossRef] [Scilit]
  21. Vinuesa, P.; Rojas-Jiménez, K.; Contreras-Moreira, B.; Mahna, S.K.; Prasad, B.N.; Moe, H.; Selvaraju, S.B.; Thierfelder, H.; Werner, D. Multilocus Sequence Analysis for Assessment of the Biogeography and Evolutionary Genetics of Four Bradyrhizobium Species That Nodulate Soybeans on the Asiatic Continent. Appl. Environ. Microbiol. 2008, 74, 6987–6996. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Nakei, M.D.; Venkataramana, P.B.; Ndakidemi, P.A. Soybean-Nodulating Rhizobia: Ecology, Characterization, Diversity, and Growth Promoting Functions. Front. Sustain. Food Syst. 2022, 6, 824444. [Google Scholar] [CrossRef] [Scilit]
  23. Parte, A.C.; Carbasse, J.S.; Meier-Kolthoff, J.P.; Reimer, L.C.; Göker, M. List of Prokaryotic Names with Standing in Nomenclature (LPSN) Moves to the DSMZ. Int. J. Syst. Evol. Microbiol. 2020, 70, 5607–5612. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Avontuur, J.R.; Palmer, M.; Beukes, C.W.; Chan, W.Y.; Coetzee, M.P.A.; Blom, J.; Stępkowski, T.; Kyrpides, N.C.; Woyke, T.; Shapiro, N.; et al. Genome-Informed Bradyrhizobium Taxonomy: Where to from Here? Syst. Appl. Microbiol. 2019, 42, 427–439. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Ormeño-Orrillo, E.; Martínez-Romero, E. A Genomotaxonomy View of the Bradyrhizobium Genus. Front. Microbiol. 2019, 10, 1334. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Menna, P.; Barcellos, F.G.; Hungria, M. Phylogeny and Taxonomy of a Diverse Collection of Bradyrhizobium Strains Based on Multilocus Sequence Analysis of the 16S RRNA Gene, ITS Region and GlnII, RecA, AtpD and DnaK Genes. Int. J. Syst. Evol. Microbiol. 2009, 59, 2934–2950. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Fossou, R.K.; Ziegler, D.; Zézé, A.; Barja, F.; Perret, X. Two Major Clades of Bradyrhizobia Dominate Symbiotic Interactions with Pigeonpea in Fields of Côte d’Ivoire. Front. Microbiol. 2016, 7, 01793. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Martens, M.; Dawyndt, P.; Coopman, R.; Gillis, M.; De Vos, P.; Willems, A. Advantages of Multilocus Sequence Analysis for Taxonomic Studies: A Case Study Using 10 Housekeeping Genes in the Genus Ensifer (Including Former Sinorhizobium). Int. J. Syst. Evol. Microbiol. 2008, 58, 200–214. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. Klepa, M.S.; Helene, L.C.F.; O’hara, G.; Hungria, M. Bradyrhizobium cenepequi sp. nov., Bradyrhizobium semiaridum sp. nov., Bradyrhizobium hereditatis sp. nov. and Bradyrhizobium australafricanum sp. nov., Symbionts of Different Leguminous Plants of Western Australia and South Africa and Definition of Three. Int. J. Syst. Evol. Microbiol. 2022, 72, 5446. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  30. Martinez-Romero, E.; Peix, A.; Hungria, M.; Mousavi, S.A.; Martinez-Romero, J.; Young, P. Guidelines for the Description of Rhizobial Symbiovars. Int. J. Syst. Evol. Microbiol. 2024, 74, 006373. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  31. Chun, J.; Rainey, F.A. Integrating Genomics into the Taxonomy and Systematics of the Bacteria and Archaea. Int. J. Syst. Evol. Microbiol. 2014, 64 Pt 2, 316–324. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. FAO. FAO.STAT. Available online: https://www.fao.org/statistics/en/ (accessed on 6 June 2025).
  33. Osunde, A.O.; Gwam, S.; Bala, A.; Sanginga, N.; Okogun, J.A. Responses to Rhizobial Inoculation by Two Promiscuous Soybean Cultivars in Soils of the Southern Guinea Savanna Zone of Nigeria. Biol. Fertil. Soils 2003, 37, 274–279. [Google Scholar] [CrossRef] [Scilit]
  34. Pule-Meulenberg, F.; Gyogluu, C.; Naab, J.; Dakora, F.D. Symbiotic N Nutrition, Bradyrhizobial Biodiversity and Photosynthetic Functioning of Six Inoculated Promiscuous-Nodulating Soybean Genotypes. J. Plant Physiol. 2011, 168, 540–548. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Abaidoo, R.C.; Keyser, H.H.; Singleton, P.W.; Dashiell, K.E.; Sanginga, N. Population Size, Distribution, and Symbiotic Characteristics of Indigenous Bradyrhizobium spp. That Nodulate TGx Soybean Genotypes in Africa. Appl. Soil Ecol. 2007, 35, 57–67. [Google Scholar] [CrossRef] [Scilit]
  36. Tefera, H. Breeding for Promiscuous Soybeans at IITA. In Soybean—Molecular Aspects of Breeding; IITA: Ibadan, Nigeria, 2011. [Google Scholar] [CrossRef] [Scilit]
  37. Klogo, P.; Ofori, J.K.; Klogo, P.Y.; Amaglo, H. Soybean (Glycine max (L.) Merill) Promiscuity Reaction to Indigenous Bradyrhizobia Inoculation in Some Ghanaian Soils. Int. J. Sci. Technol. Res. 2015, 4, 306–313. [Google Scholar]
  38. Giller, K.E. Nitrogen Fixation in Tropical Cropping Systems; CABI Publishing: Wallingford, UK, 2001. [Google Scholar] [CrossRef] [Scilit]
  39. N’gbesso, M.F.; N’guetta, A.S.P.; Kouamé, N.; Bi, K.F. Evaluation de l’efficience de l’inoculation Des Semences Chez 11 Génotypes de Soja (Glycine max L. Merril) En Zone de Savane de Côte d’Ivoire. Sci. Nat. 2010, 7. [Google Scholar] [CrossRef] [Scilit]
  40. Kouamé, N.C.; Fondio, L.; Djidji, A.H.; N’Gbesso, M.F.P. Rapport d’activités de Recherche Pour Le Développement de La Culture Du Soja Dans Les Zones Centre et Centre-Nord de La Côte d’Ivoire. In Convention CNRA-Projet Pacil; African Development Bank Group: Abidjan, Côte d’Ivoire, 2002; 105p. [Google Scholar]
  41. Niste, M.; Vidican, R.; Pop, R.; Rotar, I. Stress Factors Affecting Symbiosis Activity and Nitrogen Fixation by Rhizobium Cultured In Vitro. ProEnvironment 2013, 6, 42–45. [Google Scholar]
  42. Singleton, P.W.; Bohlool, B.B.; Nakao, P.L. Legume Response to Rhizobial Inoculation in the Tropics: Myths and Realities. Myth. Sci. Soils Trop. 2015, 29, 135–155. [Google Scholar] [CrossRef] [Scilit]
  43. Amani, K.; Fondio, L.; Ibrahim, K.; DPN’Gbesso, M.F.; AMaxwell, B.G.; Abiba Sanogo, T.; Filali-Maltouf, A. Response of Indigenous Rhizobia to the Inoculation of Soybean [Glycine max (L.) Merrill] Varieties Cultivated under Controlled Conditions in Côte d’Ivoire. Adv. Microbiol. 2020, 10, 110–122. [Google Scholar] [CrossRef]
  44. Amani, K.; Yao, G.F.; Fondio, L.; N’Gbesso, M.F.D.P.; Zro, F.B.; Kouamé, C.; Konaté, I. Effects of Native Rhizobia on Soybean [Glycine max (L.) Merrill] Production and Soil Properties in Daloa, Center-West of Côte d’Ivoire. Int. J. Plant Soil Sci. 2024, 36, 239–247. [Google Scholar] [CrossRef] [Scilit]
  45. Ducroquet, H.; Tillie, P.; Louhichi, K.; Gomez-y-Paloma, S. L’agriculture de La Côte d’Ivoire à La Loupe: Etats Des Lieux Des Filières de Production Végétales et Animales et Revue Des Politiques Agricoles; European Commissions: Brussels, Belgium, 2017; ISBN 978-92-79-73180-8. [Google Scholar] [CrossRef]
  46. FAO. État Des Ressources Phytogénétiques Pour l’alimentation et l’agriculture: Second Rapport National; FAO: Rome, Italy, 2009; p. 64.
  47. Gautier, L. Contact Forêt-Savane En Côte d’ivoire Centrale: Évolution de La Surface Forestière de La Réserve de Lamto (Sud Du V-Baoulé). Bull. La Soc. Bot. France. Actual. Bot. 1989, 136, 85–92. [Google Scholar] [CrossRef] [Scilit]
  48. Amon, C.E.R.; Fossou, R.K.; Ebou, A.E.T.; Koua, D.K.; Kouadjo, C.G.; Brou, Y.C.; Voko Bi, D.R.R.; Cowan, D.A.; Zézé, A. The Core Bacteriobiome of Côte d’Ivoire Soils across Three Vegetation Zones. Front. Microbiol. 2023, 14, 1220655. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  49. Gnangui, S.L.E.; Fossou, R.K.; Ebou, A.; Amon, C.E.R.; Koua, D.K.; Kouadjo, C.G.Z.; Cowan, D.A.; Zézé, A. The Rhizobial Microbiome from the Tropical Savannah Zones in Northern Côte d’Ivoire. Microorganisms 2021, 9, 1842. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  50. Cowan, D.; Lebre, P.; Amon, C.; Becker, R.; Boga, H.; Boulangé, A.; Chiyaka, T.; Coetzee, T.; de Jager, P.; Dikinya, O.; et al. Biogeographical Survey of Soil Microbiomes across Sub-Saharan Africa: Structure, Drivers, and Predicted Climate-Driven Changes. Microbiome 2022, 10, 131. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  51. Mehlich, A. Mehlich 3 Soil Test Extractant: A Modification of Mehlich 2 Extractant, Communications in Soil Science and Plant Analysis. Commun. Soil. Sci. Plant Anal. 1984, 15, 1409–1416. [Google Scholar] [CrossRef] [Scilit]
  52. Bouyoucos, G.J. Hydrometer Method Improved for Making Particle Size Analyses of Soils 1. Agron. J. 1962, 54, 464–465. [Google Scholar] [CrossRef] [Scilit]
  53. Bremner, M. Chapter 37: Nitrogen-Total. In Methods of Soil Analysis Part 3; Chemical Methods-SSSA Book Series 5; John Wiley & Sons: Hoboken, NJ, USA, 1996; Number 5; pp. 1085–1121. [Google Scholar]
  54. Fick, S.E.; Hijmans, R.J. WorldClim 2: New 1-Km Spatial Resolution Climate Surfaces for Global Land Areas. Int. J. Climatol. 2017, 37, 4302–4315. [Google Scholar] [CrossRef] [Scilit]
  55. Lewin, A.; Cervantes, E.; Wong, C.H.; Broughton, W.J. nodSU, Two New nod Genes of the Broad Host Range Rhizobium Strain NGR234 Encode Host-Specific Nodulation of the Tropical Tree Leucaena leucocephala. Mol. Plant-Microbe Interact. 1990, 3, 317–326. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Ehrhardt, D.W.; Atkinson, E.M.; Long, S.R. Depolarization of Alfalfa Root Hair Membrane Potential by Rhizobium meliloti Nod Factors. Science 1992, 256, 998–1000. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  57. Vincent, J.M. A Manual for the Practical Study of Root Nodule Bacteria. In International Biological Program Handbook; John Wiley & Sons: Hoboken, NJ, USA, 1970; Volume 15. [Google Scholar]
  58. Sy, A.; Giraud, E.; Jourand, P.; Garcia, N.; Willems, A.; de Lajudie, P.; Prin, Y.; Neyra, M.; Gillis, M.; Boivin-Masson, C.; et al. Methylotrophic Methylobacterium Bacteria Nodulate and Fix Nitrogen in Symbiosis with Legumes. J. Bacteriol. 2001, 183, 214–220. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  59. Willems, A.; Coopman, R.; Gillis, M. Phylogenetic and DNA-DNA Hybridization Analyses of Bradyrhizobium Species. Int. J. Syst. Evol. Microbiol. 2001, 51, 111–117. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  60. Vinuesa, P.; Silva, C.; Werner, D.; Martínez-Romero, E. Population Genetics and Phylogenetic Inference in Bacterial Molecular Systematics: The Roles of Migration and Recombination in Bradyrhizobium Species Cohesion and Delineation. Mol. Phylogenet. Evol. 2005, 34, 29–54. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  61. Nzoué, A.; Miché, L.; Klonowska, A.; Laguerre, G.; de Lajudie, P.; Moulin, L. Multilocus Sequence Analysis of Bradyrhizobia Isolated from Aeschynomene Species in Senegal. Syst. Appl. Microbiol. 2009, 32, 400–412. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  62. Sterner, J.P.; Parker, M.A. Diversity and Relationships of Bradyrhizobia from Amphicarpaea bracteata Based on Partial Nod and Ribosomal Sequences. Syst. Appl. Microbiol. 1999, 22, 387–392. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  63. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  64. Schwarz, G. Estimating the Dimension of a Model. Ann. Stat. 1978, 6, 461–464. [Google Scholar] [CrossRef] [Scilit]
  65. Eren, A.M.; Maignien, L.; Sul, W.J.; Murphy, L.G.; Grim, S.L.; Morrison, H.G.; Sogin, M.L. Oligotyping: Differentiating between Closely Related Microbial Taxa Using 16S RRNA Gene Data. Methods Ecol. Evol. 2013, 4, 1111–1119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  66. Bromfield, E.S.P.; Cloutier, S.; Wasai-Hara, S.; Minamisawa, K. Strains of Bradyrhizobium barranii sp. nov. Associated with Legumes Native to Canada Are Symbionts of Soybeans and Belong to Different Subspecies (subsp. Barranii subsp. nov. and subsp. Apii subsp. nov.) and Symbiovars (sv. Glycinearum and sv. Septentrion). Int. J. Syst. Evol. Microbiol. 2022, 72, 5549. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  67. Waswa, M.N.; Karanja, N.K.; Woomer, P.L.; Mwenda, G.M. Identifying Elite Rhizobia for Soybean (Glycine max) in Kenya 1. Afr. J. Crop Sci. 2014, 2, 60–66. [Google Scholar]
  68. Woomer, P.L. Most Probable Number Counts. In Methods of Soil Analysis, Part 2: Microbiological and Biochemical Properties; Bottomley, P.J., Angle, J.S., Weaver, R.W., Eds.; Wiley: Hoboken, NJ, USA, USA, 1994. [Google Scholar]
  69. Tabaro, A.R. Evaluation of Effectiveness of Rhizobia Isolates from Rwandan. Ph.D. Dissertation, University of Nairobi, Nairobi, Kenya, 2014. [Google Scholar]
  70. Woomer, P.L. A Ranking System for Legume Root Nodules. N2Africa Training Report. Technical Training. Available online: https://n2africa.org/ranking-system-legume-root-nodules-n2africa-training-report (accessed on 3 April 2014).
  71. Sebastien Le Julie Josse, F.H. FactoMineR: An R Package for Multivariate Analysis. J. Stat. Softw. 2008, 25, 1–18. [Google Scholar] [CrossRef] [Scilit]
  72. Kassambara, A.M.F. Factoextra: Extract and Visualize the Results of Multivariate Data Analyses, R Package Version 1.0.7; GESIS: Mannheim, Germany, 2020.
  73. Oksanen, J.; Simpson, G.; Blanchet, F.; Kindt, R.; Legendre, P.; Minchin, P.; O’Hara, R.; Solymos, P.; Stevens, M.; Szoecs, E.; et al. Vegan: Community Ecology Package, R Package Version 2.6-6.1; GESIS: Mannheim, Germany, 2024.
  74. Wickham, H. Ggplot2: Elegant Graphics for Data Analysis; Springer: New York, NY, USA, 2016. [Google Scholar]
  75. Royston, J.P. An Extension of Shapiro and Wilk’s W Test for Normality to Large Samples. Appl. Stat. 1982, 31, 115. [Google Scholar] [CrossRef] [Scilit]
  76. Hollander, M.; Wolfe, D.A. Nonparametric Statistical Methods; Wiley: New York, NY, USA, 1973. [Google Scholar]
  77. Jordan, D.C. Transfer of Rhizobium japonicum Buchanan 1980 to Bradyrhizobium gen. nov., a Genus of Slow-Growing, Root Nodule Bacteria from Leguminous Plants. Int. J. Syst. Bacteriol. 1982, 32, 136–139. [Google Scholar] [CrossRef] [Scilit]
  78. Jordan, D.C. Genus I. Rhizobium. In Bergey’s Manual of Systematic Bacteriology, 1st ed.; Krieg, N.R., Holt, J.G., Eds.; The Williams & Wilkins Co.: Baltimore, MD, USA, 1984; Volume 1, pp. 235–242. [Google Scholar]
  79. Chibeba, A.M.; Kyei-Boahen, S.; de Guimarães, M.F.; Nogueira, M.A.; Hungria, M. Isolation, Characterization and Selection of Indigenous Bradyrhizobium Strains with Outstanding Symbiotic Performance to Increase Soybean Yields in Mozambique. Agric. Ecosyst. Environ. 2017, 246, 291–305. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  80. Brockwell, J.; Bottomley, P.J.; Thies, J.E. Manipulation of Rhizobia Microflora for Improving Legume Productivity and Soil Fertility: A Critical Assessment. In Management of Biological Nitrogen Fixation for the Development of More Productive and Sustainable Agricultural System; Ladha, J.K., Peoples, M.B., Eds.; Springer: Berlin/Heidelberg, Germany, 1995; pp. 143–180. [Google Scholar]
  81. Okogun, J.A.; Sanginga, N. Can Introduced and Indigenous Rhizobial Strains Compete for Nodule Formation by Promiscuous Soybean in the Moist Savanna Agroecological Zone of Nigeria? Biol. Fertil. Soils 2003, 38, 26–31. [Google Scholar] [CrossRef] [Scilit]
  82. Kyei-Boahen, S.; Savala, C.E.N.; Muananamuale, C.P.; Malita, C.; Wiredu, A.N.; Chibeba, A.M.; Elia, P.; Chikoye, D. Symbiotic Effectiveness of Bradyrhizobium Strains on Soybean Growth and Productivity in Northern Mozambique. Front. Sustain. Food Syst. 2023, 6, 1084745. [Google Scholar] [CrossRef] [Scilit]
  83. Amani, K.; Konate, I.; N’gbesso, D.P.; François, M.; Attien, Y.P.; Fondio, L.; Abdelkarim Filali, M.; Tidou Abiba, S. Phenotypic and Symbiotic Diversity of Rhizobia Isolated from Root Nodules of Soybean [Glycine max (L.) Merrill] in Côte d’Ivoire. Int. J. Curr. Microbiol. Appl. Sci. 2019, 8, 766–774. [Google Scholar] [CrossRef] [Scilit]
  84. Fossou, R.K.; Pothier, J.F.; Zézé, A.; Perret, X. Bradyrhizobium ivorense sp. nov. as a Potential Local Bioinoculant for Cajanus cajan Cultures in Côte d’ivoire. Int. J. Syst. Evol. Microbiol. 2020, 70, 1421–1430. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  85. N’Zoué, A. Diversité Génétique et Fonctionnelle Des Souches de Bradyrhizobium Impliquées Dans Les Cultures Mixtes Niébé-Soja-Arachide/Céréales (Maïs) En Côte d’Ivoire. Ph.D. Dissertation, Université des Sciences et Techniques de Montpellier 2, Montpellier, France, 2008. [Google Scholar]
  86. Gnangui, S.; Kouagdo, C.; Nat, A.Z.-M. First Report of Rhizobium Pusense within Voandzou (Vigna subterranea (L.) Verdc.) Rhizosphere in Côte d’Ivoire. Microbiol. Nat. 2019, 1, 55–65. [Google Scholar]
  87. Raissa, G.N.K.; Ibrahim, K.; Kaoutar, T.; Issouf, B.; Maxwell, B.G.A.; Sélastique, A.D.; Maltouf Abdelkarim, F. Molecular and Symbiotic Efficiency Characterization of Rhizobia Nodulating Bambara Groundnut (Vigna subterranea L.) from Agricultural Soils of Daloa Localities in Côte D’Ivoire. Int. J. Curr. Microbiol. Appl. Sci. 2020, 9, 507–519. [Google Scholar] [CrossRef] [Scilit]
  88. Atse, M.-P.A.; N’gbesso, M.F.D.P.; Abe, A.I.; Coulibaly, N.D.; Yeo, K.T.; Butare, L.; Konate, I. Diversity and Phylogeny of Symbiotic Bacteria Nodulating Common Bean (Phaseolus vulgaris L.) in Côte d’Ivoire. Microbiol. Res. J. Int. 2024, 34, 45–53. [Google Scholar] [CrossRef] [Scilit]
  89. Willems, A.; Munive, A.; De Lajudie, P.; Gillis, M. In Most Bradyrhizobium Groups Sequence Comparison of 16S-23S RDNA Internal Transcribed Spacer Regions Corroborates DNA-DNA Hybridizations. Syst. Appl. Microbiol. 2003, 26, 203–210. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  90. Saeki, Y.; Kaneko, A.; Hara, T.; Suzuki, K.; Yamakawa, T.; Minh, T.N.; Nagatomo, Y.; Akao, S. Phylogenetic Analysis of Soybean-Nodulating Rhizobia Isolated from Alkaline Soils in Vietnam. Soil Sci. Plant Nutr. 2005, 51, 1043–1052. [Google Scholar] [CrossRef] [Scilit]
  91. Wang, M.; Cao, B.; Yu, Q.; Liu, L.; Gao, Q.; Wang, L.; Feng, L. Analysis of the 16S-23S RRNA Gene Internal Transcribed Spacer Region in Klebsiella Species. J. Clin. Microbiol. 2008, 46, 3555–3563. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  92. Puozaa, D.K.; Jaiswal, S.K.; Dakora, F.D. African Origin of Bradyrhizobium Populations Nodulating Bambara Groundnut (Vigna subterranea L. Verdc) in Ghanaian and South African Soils. PLoS ONE 2017, 12, 184943. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  93. Asfaw, B.; Aserse, A.A.; Asefa, F.; Yli-Halla, M.; Lindström, K. Genetically Diverse Lentil- and Faba Bean-Nodulating Rhizobia Are Present in Soils across Central and Southern Ethiopia. FEMS Microbiol. Ecol. 2020, 96, fiaa015. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  94. Suzuki, K.; Oguro, H.; Yamakawa, T.; Yamamoto, A.; Akao, S.; Saeki, Y. Diversity and Distribution of Indigenous Soybean-Nodulating Rhizobia in the Okinawa Islands, Japan. Soil Sci. Plant Nutr. 2008, 54, 237–246. [Google Scholar] [CrossRef] [Scilit]
  95. Zhang, Y.M.; Li, Y.; Chen, W.F.; Wang, E.T.; Tian, C.F.; Li, Q.Q.; Zhang, Y.Z.; Sui, X.H.; Chen, W.X. Biodiversity and Biogeography of Rhizobia Associated with Soybean Plants Grown in the North China Plain. Appl. Environ. Microbiol. 2011, 77, 6331–6342. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  96. Wasike, V.W.; Lesueur, D.; Wachira, F.N.; Mungai, N.W.; Mumera, L.M.; Sanginga, N.; Mburu, H.N.; Mugadi, D.; Wango, P.; Vanlauwe, B. Genetic Diversity of Indigenous Bradyrhizobium Nodulating Promiscuous Soybean [Glycine max (L.) Merr.] Varieties in Kenya: Impact of Phosphorus and Lime Fertilization in Two Contrasting Sites. Plant Soil 2009, 322, 151–163. [Google Scholar] [CrossRef] [Scilit]
  97. Gyogluu, C.; Jaiswal, S.K.; Kyei-Boahen, S.; Dakora, F.D. Identification and Distribution of Microsymbionts Associated with Soybean Nodulation in Mozambican Soils. Syst. Appl. Microbiol. 2018, 41, 506–515. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  98. Chen, L.S.; Figueredo, A.; Pedrosa, F.O.; Hungria, M. Genetic Characterization of Soybean Rhizobia in Paraguay. Appl. Environ. Microbiol. 2000, 66, 5099–5103. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  99. Shiro, S.; Matsuura, S.; Saiki, R.; Sigua, G.C.; Yamamoto, A.; Umehara, Y.; Hayashi, M.; Saeki, Y. Genetic Diversity and Geographical Distribution of Indigenous Soybean-Nodulating Bradyrhizobia in the United States. Appl. Environ. Microbiol. 2013, 79, 3610–3618. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  100. Li, Q.Q.; Wang, E.T.; Zhang, Y.Z.; Zhang, Y.M.; Tian, C.F.; Sui, X.H.; Chen, W.F.; Chen, W.X. Diversity and Biogeography of Rhizobia Isolated from Root Nodules of Glycine Max Grown in Hebei Province, China. Microb. Ecol. 2011, 61, 917–931. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  101. Maruekarajtinplenga, S.; Homhaulb, W.; Chansa-Ngavej, K. Presence of Natural Variants of Bradyrhizobium elkanii and Bradyrhizobium japonicum and Detection of Bradyrhizobium yuanmingense in Phitsanulok Province, Thailand. Sci. Asia 2012, 38, 24–29. [Google Scholar] [CrossRef]
  102. Kozieł, M.; Kalita, M.; Janczarek, M. Genetic Diversity of Microsymbionts Nodulating Trifolium Pratense in Subpolar and Temperate Climate Regions. Sci. Rep. 2022, 12, 12144. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  103. Martens, M.; Delaere, M.; Coopman, R.; de Vos, P.; Gillis, M.; Willems, A. Multilocus Sequence Analysis of Ensifer and Related Taxa. Int. J. Syst. Evol. Microbiol. 2007, 57, 489–503. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  104. Ramírez-Bahena, M.H.; Flores-Félix, J.D.; Chahboune, R.; Toro, M.; Velázquez, E.; Peix, A. Bradyrhizobium centrosemae (Symbiovar Centrosemae) sp. nov., Bradyrhizobium americanum (Symbiovar Phaseolarum) sp. nov. and a New Symbiovar (Tropici) of Bradyrhizobium viridifuturi Establish Symbiosis with Centrosema Species Native to America. Syst. Appl. Microbiol. 2016, 39, 378–383. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  105. Delamuta, J.R.M.; Ribeiro, R.A.; Ormeño-Orrillo, E.; Parma, M.M.; Melo, I.S.; Martínez-Romero, E.; Hungria, M. Bradyrhizobium tropiciagri sp. nov. and Bradyrhizobium embrapense sp. nov. Nitrogenfixing Symbionts of Tropical Forage Legumes. Int. J. Syst. Evol. Microbiol. 2015, 65, 4424–4433. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  106. Sullivan, J.T.; Patrick, H.N.; Lowther, W.L.; Scott, D.B.; Ronson, C.W. Nodulating Strains of Rhizobium Loti Arise through Chromosomal Symbiotic Gene Transfer in the Environment. Proc. Natl. Acad. Sci. USA 1995, 92, 8985–8989. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  107. Sullivan, J.T.; Ronson, C.W. Evolution of Rhizobia by Acquisition of a 500-Kb Symbiosis Island That Integrates into a Phe-TRNA Gene. Proc. Natl. Acad. Sci. USA 1998, 95, 5145–5149. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  108. Ramsay, J.P.; Sullivan, J.T.; Stuart, G.S.; Lamont, I.L.; Ronson, C.W. Excision and Transfer of the Mesorhizobium loti R7A Symbiosis Island Requires an Integrase IntS, a Novel Recombination Directionality Factor RdfS, and a Putative Relaxase RlxS. Mol. Microbiol. 2006, 62, 723–734. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  109. Nandasena, K.G.; O’Hara, G.W.; Tiwari, R.P.; Sezmiş, E.; Howieson, J.G. In Situ Lateral Transfer of Symbiosis Islands Results in Rapid Evolution of Diverse Competitive Strains of Mesorhizobia Suboptimal in Symbiotic Nitrogen Fixation on the Pasture Legume Biserrula pelecinus L. Environ. Microbiol. 2007, 9, 2496–2511. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  110. Barcellos, F.G.; Menna, P.; Batista, J.S.D.S.; Hungria, M. Evidence of Horizontal Transfer of Symbiotic Genes from a Bradyrhizobium japonicum Inoculant Strain to Indigenous Diazotrophs Sinorhizobium (Ensifer) fredii and Bradyrhizobium elkanii in a Brazilian Savannah Soil. Appl. Environ. Microbiol. 2007, 73, 2635–2643. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  111. Okubo, T.; Fukushima, S.; Minamisawa, K. Evolution of Bradyrhizobium-Aeschynomene Mutualism: Living Testimony of the Ancient World or Highly Evolved State? Plant Cell Physiol. 2012, 53, 2000–2007. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  112. Masson-Boivin, C.; Giraud, E.; Perret, X.; Batut, J. Establishing Nitrogen-Fixing Symbiosis with Legumes: How Many Rhizobium Recipes? Trends Microbiol. 2009, 17, 458–466. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  113. Jean-Claude, N.Z.; Patrice, K.A.; Daouda, K.K.; Jane, K.; Jean-Luc, K.; Christophe, K. Effect of Inoculating Seeds with Bradyrhizobium japonicum on the Agronomic Performance of Five Varieties of Soybean (Glycine max) in Côte d ’Ivoire. Afr. J. Agric. Res. 2015, 10, 3671–3677. [Google Scholar] [CrossRef] [Scilit]
  114. Cornell, C.; Kokkoris, V.; Richards, A.; Horst, C.; Rosa, D.; Bennett, J.A.; Hart, M.M. Do Bioinoculants Affect Resident Microbial Communities? A Meta-Analysis. Front. Agron. 2021, 3, 753474. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Map of Côte d’Ivoire depicting sampling sites, identified by the abbreviation ‘CI’ and their respective site numbers, within the five bioclimatic zones: rainforest area, mesophilic area, preforest area, sub-Sudanese area, and Sudanese area.
Figure 1. Map of Côte d’Ivoire depicting sampling sites, identified by the abbreviation ‘CI’ and their respective site numbers, within the five bioclimatic zones: rainforest area, mesophilic area, preforest area, sub-Sudanese area, and Sudanese area.
Agronomy 15 01720 g001
Figure 2. Soil discrimination as evidenced by principal component analysis (PCA) carried out on all the physicochemical and climatic parameters.
Figure 2. Soil discrimination as evidenced by principal component analysis (PCA) carried out on all the physicochemical and climatic parameters.
Agronomy 15 01720 g002
Figure 3. Four classes of sampling soils based on their ability to support nodulation with soybean variety R2 231. For negative treatment (T), germinated seeds were planted in Magenta jars containing sterile vermiculite, but they were not inoculated with soil sample.
Figure 3. Four classes of sampling soils based on their ability to support nodulation with soybean variety R2 231. For negative treatment (T), germinated seeds were planted in Magenta jars containing sterile vermiculite, but they were not inoculated with soil sample.
Agronomy 15 01720 g003
Figure 4. Distribution of the 110 Ivorian soybean isolates among the seven supergroups of Bradyrhizobium genus. The phylogenetic tree was constructed with ITS 16S-23S gene sequences using Neighbor-joining method and TG2 + G mathematical model. Bootstrap values ≥ 70 are shown and they result from 1000 replicates.
Figure 4. Distribution of the 110 Ivorian soybean isolates among the seven supergroups of Bradyrhizobium genus. The phylogenetic tree was constructed with ITS 16S-23S gene sequences using Neighbor-joining method and TG2 + G mathematical model. Bootstrap values ≥ 70 are shown and they result from 1000 replicates.
Agronomy 15 01720 g004
Figure 5. ITS rDNA 16S-23S phylogenetic tree of the 110 Ivorian soybean isolates clustered into amplicons sequences variants (ASVs) types within the two supergroups of Bradyrhizobium. This NJ tree (K2 + G model; 773 positions) shows the relationship between all the 110 soybean isolates, the commercial inoculant strain IRAT-FA3 and 23 selected closely related strains (in bold) including the B. elkanii and B. japonicum supergroup type species (USA 76T and USDA 6T, respectively). Bootstrap values ≥ 70 are shown and they result from 1000 replicates. In the tree, each ASV and its abundance (n ≥ 2) are indicated in front of the isolate selected as a representative of the group.
Figure 5. ITS rDNA 16S-23S phylogenetic tree of the 110 Ivorian soybean isolates clustered into amplicons sequences variants (ASVs) types within the two supergroups of Bradyrhizobium. This NJ tree (K2 + G model; 773 positions) shows the relationship between all the 110 soybean isolates, the commercial inoculant strain IRAT-FA3 and 23 selected closely related strains (in bold) including the B. elkanii and B. japonicum supergroup type species (USA 76T and USDA 6T, respectively). Bootstrap values ≥ 70 are shown and they result from 1000 replicates. In the tree, each ASV and its abundance (n ≥ 2) are indicated in front of the isolate selected as a representative of the group.
Agronomy 15 01720 g005
Figure 6. Maximum likelihood (ML) phylogenetic inferred from concatenated glnII-recA sequences of soybean isolates. The tree was inferred from concatenated partial glnII (438 bp) and recA (373 bp) sequences of 78 type strains of the Bradyrhizobium genus, of 28 isolates of soybean (shown in bold) and of the commercial inoculant strain IRAT-FA3 that was also used as a reference. The TN93 + G + I model was used with 811 positions and 1000 pseudo replicates as parameters. Only bootstrap values > 70% are shown at branch nodes. Scale bar indicates the number of substitutions per site.
Figure 6. Maximum likelihood (ML) phylogenetic inferred from concatenated glnII-recA sequences of soybean isolates. The tree was inferred from concatenated partial glnII (438 bp) and recA (373 bp) sequences of 78 type strains of the Bradyrhizobium genus, of 28 isolates of soybean (shown in bold) and of the commercial inoculant strain IRAT-FA3 that was also used as a reference. The TN93 + G + I model was used with 811 positions and 1000 pseudo replicates as parameters. Only bootstrap values > 70% are shown at branch nodes. Scale bar indicates the number of substitutions per site.
Agronomy 15 01720 g006
Figure 7. The neighbor-joining phylogeny of 27 Ivorian soybean isolates based on the nodC gene sequence (240 bp), using the TG2 + G model and 1000 repetitions (bootstrap). Isolate SOJA3 was not included in the nodC gene analysis, as we repeatedly got a bad quality sequence from this strain, leading to internal stop codons. Bootstrap values > 70% are shown at branch nodes. The scale bar indicates the number of substitutions per site.
Figure 7. The neighbor-joining phylogeny of 27 Ivorian soybean isolates based on the nodC gene sequence (240 bp), using the TG2 + G model and 1000 repetitions (bootstrap). Isolate SOJA3 was not included in the nodC gene analysis, as we repeatedly got a bad quality sequence from this strain, leading to internal stop codons. Bootstrap values > 70% are shown at branch nodes. The scale bar indicates the number of substitutions per site.
Agronomy 15 01720 g007
Figure 8. Redundancy analysis of the explanatory variables on the distribution of species in the soil.
Figure 8. Redundancy analysis of the explanatory variables on the distribution of species in the soil.
Agronomy 15 01720 g008
Figure 9. Effectiveness index (EI) of indigenous rhizobia isolates assessed on soybean variety R2 231 grown in the Magenta system supplemented with N-free BNM solution. The plant shoot biomass harvested four weeks after inoculation and desiccated was used to calculate the index.
Figure 9. Effectiveness index (EI) of indigenous rhizobia isolates assessed on soybean variety R2 231 grown in the Magenta system supplemented with N-free BNM solution. The plant shoot biomass harvested four weeks after inoculation and desiccated was used to calculate the index.
Agronomy 15 01720 g009
Table 1. Primers used for PCR in this study and their characteristics.
Table 1. Primers used for PCR in this study and their characteristics.
DNALocusPrimersSize (bp)Primer SequencesTm (°C)Amplification ProgramReference
ITSITS SM
ITS BR3
9505′AAGTCGTAACAAGGTAGCC3′
5′GCTTTTCACCTTTCCCTCAC3′
555 min 96 °C, 35 X (30 s 96 °C, 30 s 55 °C, 2 min), 7 min 72 °C[59]
glnIIglnII 12F
glnII 689R
6005′YAAGCTCGAGTACATYTGGCT3′
3′TGCATGCCSGAGCCGTTCCA5′
635 min 95 °C, 35 X (45 s 94 °C, 1 min 63 °C, 1 min 30 s 72 °C, 7 min 72° C)[60]
recArecA 41F
recA 640R
5005′TTCGGCAAGGGMTCGRTSATG3′
3′ACATSACRCCGATCTTCATGC5′
585 min 95 °C, 35 X (45 s 94 °C, 1 min 58 °C, 1 min 30 s 72 °C), 7 min 72 °C[60]
nifHnifH-28F
nifH-809R
7005′TACGGNAARGGSGGNATCGGCAA3′
3′AGCATGTCYTCSAGYYTCNTCCA5′
65,
55
5 min 94 °C, 20 X (45 s 94 °C, 30 s 65 °C, 1 min 30 s 72 °C), 25 X (45 s 94 °C, 30 s 55 °C, 1 min 30 s 72 °C), 7 min 72 °C[61]
nodCnodCIf
nodCp8
2435′GTCGATTGCMRGTCAAGACTACG3′
3′GCCAGGTCTlGTTGCGATTGCTC5′
575 min 95 °C, 35 X [45 s 94 °C, 1 min 57 °C, 1 min 30 s 72 °C], 7 min 72 °C[62]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Akaffou, M.A.; Fossou, R.K.; Ebou, A.E.T.; Kouadjo-Zézé, Z.G.C.; Amon, C.E.R.-E.; Chaintreuil, C.; Fall, S.; Zézé, A. Phylogenetic Diversity and Symbiotic Effectiveness of Bradyrhizobium Strains Nodulating Glycine max in Côte d’Ivoire. Agronomy 2025, 15, 1720. https://doi.org/10.3390/agronomy15071720

AMA Style

Akaffou MA, Fossou RK, Ebou AET, Kouadjo-Zézé ZGC, Amon CER-E, Chaintreuil C, Fall S, Zézé A. Phylogenetic Diversity and Symbiotic Effectiveness of Bradyrhizobium Strains Nodulating Glycine max in Côte d’Ivoire. Agronomy. 2025; 15(7):1720. https://doi.org/10.3390/agronomy15071720

Chicago/Turabian Style

Akaffou, Marie Ange, Romain Kouakou Fossou, Anicet Ediman Théodore Ebou, Zaka Ghislaine Claude Kouadjo-Zézé, Chiguié Estelle Raïssa-Emma Amon, Clémence Chaintreuil, Saliou Fall, and Adolphe Zézé. 2025. "Phylogenetic Diversity and Symbiotic Effectiveness of Bradyrhizobium Strains Nodulating Glycine max in Côte d’Ivoire" Agronomy 15, no. 7: 1720. https://doi.org/10.3390/agronomy15071720

APA Style

Akaffou, M. A., Fossou, R. K., Ebou, A. E. T., Kouadjo-Zézé, Z. G. C., Amon, C. E. R.-E., Chaintreuil, C., Fall, S., & Zézé, A. (2025). Phylogenetic Diversity and Symbiotic Effectiveness of Bradyrhizobium Strains Nodulating Glycine max in Côte d’Ivoire. Agronomy, 15(7), 1720. https://doi.org/10.3390/agronomy15071720

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop