Validation of Reference Genes for Accurate RT-qPCR Normalization in Aeluropus littoralis Under Drought, Cold, and ABA Treatments
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Material
2.2. Total RNA Extraction
2.3. cDNA Synthesis and RT-qPCR Analysis
2.4. RG Reliability Test
3. Results
3.1. Primer Specificity Validation
3.2. Cq Value Analysis of CRG
3.3. ΔCt Analysis of CRG
3.4. Bestkeeper Algorithm of CRG
3.5. GeNorm Analysis of CRG
3.6. Pairwise Variation Analysis
3.7. Normfinder Algorithm of CRG
3.8. Comprehensive Analysis of CRG
3.9. Validation Analysis with Stable and Unstable CRGs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| CRGs | Candidate Reference Genes |
| PEG | Polyethylene Glycol |
| ABA | Abscisic Acid |
| RG | Reference Gene |
| hps | Hours Post-Stress |
| NTC | Non-Template Control |
| Cq | Quantification Cycle |
References
- Hashemi-Petroudi, S.H.; Arab, M.; Dolatabadi, B.; Kuo, Y.-T.; Baez, M.A.; Himmelbach, A.; Nematzadeh, G.; Maibody, S.A.M.M.; Schmutzer, T.; Mälzer, M. Initial description of the Genome of Aeluropus littoralis, a halophile grass. Front. Plant Sci. 2022, 13, 906462. [Google Scholar] [CrossRef] [PubMed]
- Ben Romdhane, W.; Ben Saad, R.; Guiderdoni, E.; Ali, A.A.M.; Tarroum, M.; Al-Doss, A.; Hassairi, A. De novo, high-quality assembly and annotation of the halophyte grass Aeluropus littoralis draft genome and identification of A20/AN1 zinc finger protein family. BMC Plant Biol. 2025, 25, 556. [Google Scholar] [CrossRef]
- Barhoumi, Z.; Djebali, W.; Chaïbi, W.; Abdelly, C.; Smaoui, A. Salt impact on photosynthesis and leaf ultrastructure of Aeluropus littoralis. J. Plant Res. 2007, 120, 529–537. [Google Scholar] [CrossRef]
- Hashemipetroudi, S.H.; Mohammadi, S.; Fatemi, F. Identification and expression analysis of HSP100 gene family in Aeluropus littoralis. J. Plant Mol. Breed. 2023, 11, 66–77. [Google Scholar] [CrossRef]
- Saad, R.B.; Zouari, N.; Ramdhan, W.B.; Azaza, J.; Meynard, D.; Guiderdoni, E.; Hassairi, A. Improved drought and salt stress tolerance in transgenic tobacco overexpressing a novel A20/AN1 zinc-finger “AlSAP” gene isolated from the halophyte grass Aeluropus littoralis. Plant Mol. Biol. 2010, 72, 171. [Google Scholar]
- Ben Romdhane, W.; Ben-Saad, R.; Meynard, D.; Verdeil, J.-L.; Azaza, J.; Zouari, N.; Fki, L.; Guiderdoni, E.; Al-Doss, A.; Hassairi, A. Ectopic expression of Aeluropus littoralis plasma membrane protein gene AlTMP1 confers abiotic stress tolerance in transgenic tobacco by improving water status and cation homeostasis. Int. J. Mol. Sci. 2017, 18, 692. [Google Scholar] [CrossRef]
- Ghneim-Herrera, T.; Selvaraj, M.G.; Meynard, D.; Fabre, D.; Peña, A.; Ben Romdhane, W.; Ben Saad, R.; Ogawa, S.; Rebolledo, M.C.; Ishitani, M. Expression of the Aeluropus littoralis AlSAP gene enhances rice yield under field drought at the reproductive stage. Front. Plant Sci. 2017, 8, 994. [Google Scholar] [CrossRef] [PubMed]
- Yao, S.; Zhan, J.; Pan, C.; Xiong, W.; Xiao, D.; Wang, Y.; Shen, H.; Wang, A.; He, L. Identification and validation of reference genes for real-time qPCR normalization during Al-induced programmed cell death in peanut. Biol. Plant. 2019, 63, 237–246. [Google Scholar] [CrossRef]
- Dheda, K.; Huggett, J.; Chang, J.; Kim, L.; Bustin, S.; Johnson, M.; Rook, G.; Zumla, A. The implications of using an inappropriate reference gene for real-time reverse transcription PCR data normalization. Anal. Biochem. 2005, 344, 141–143. [Google Scholar] [CrossRef]
- Moreira, V.S.; Soares, V.L.; Silva, R.J.; Sousa, A.O.; Otoni, W.C.; Costa, M.G. Selection and validation of reference genes for quantitative gene expression analyses in various tissues and seeds at different developmental stages in Bixa orellana L. Physiol. Mol. Biol. Plants 2018, 24, 369–378. [Google Scholar] [CrossRef]
- Andersen, C.L.; Jensen, J.L.; Ørntoft, T.F. Normalization of real-time quantitative reverse transcription-PCR data: A model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 2004, 64, 5245–5250. [Google Scholar] [CrossRef] [PubMed]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L. The MIQE Guidelines: M inimum I nformation for Publication of Q uantitative Real-Time PCR E xperiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [PubMed]
- Dai, Q.; Lu, M.; Yang, X.; Lei, C.; Huang, F.; Hu, X.; Huang, X.; Nie, X.; Chen, D.; Huang, S. qRT-PCR Reference Gene Selection for the Discoloration of Tender Leaves in Hawk Tea (Litsea coreana). Curr. Issues Mol. Biol. 2025, 47, 131. [Google Scholar] [CrossRef]
- Liu, X.; Guan, H.; Song, M.; Fu, Y.; Han, X.; Lei, M.; Ren, J.; Guo, B.; He, W.; Wei, Y. Reference gene selection for qRT-PCR assays in Stellera chamaejasme subjected to abiotic stresses and hormone treatments based on transcriptome datasets. PeerJ 2018, 6, e4535. [Google Scholar] [CrossRef]
- Hashemi, S.H.; Nematzadeh, G.; Ahmadian, G.; Yamchi, A.; Kuhlmann, M. Identification and validation of Aeluropus littoralis reference genes for Quantitative Real-Time PCR Normalization. J. Biol. Res.-Thessalon. 2016, 23, 18. [Google Scholar] [CrossRef][Green Version]
- Song, H.; Mao, W.; Duan, Z.; Que, Q.; Zhou, W.; Chen, X.; Li, P. Selection and validation of reference genes for measuring gene expression in Toona ciliata under different experimental conditions by quantitative real-time PCR analysis. BMC Plant Biol. 2020, 20, 450. [Google Scholar] [CrossRef]
- Jia, D.-H.; Wang, B.; Li, X.-L.; Tan, W.; Gan, B.-C.; Peng, W.-H. Validation of reference genes for quantitative gene expression analysis in Auricularia cornea. J. Microbiol. Methods 2019, 163, 105658. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Yu, Y.; Gao, T.; Liu, Z.; Chen, S.; Jia, Y. Determination of Stable Reference Genes for Gene Expression Analysis in Black Rockfish (Sebastes schlegeli) Under Hypoxia Stress. Genes 2024, 16, 9. [Google Scholar] [CrossRef]
- Xiao, X.; Ma, J.; Wang, J.; Wu, X.; Li, P.; Yao, Y. Validation of suitable reference genes for gene expression analysis in the halophyte Salicornia europaea by real-time quantitative PCR. Front. Plant Sci. 2015, 5, 788. [Google Scholar] [CrossRef]
- Cao, J.; Wang, L.; Lan, H. Validation of reference genes for quantitative RT-PCR normalization in Suaeda aralocaspica, an annual halophyte with heteromorphism and C4 pathway without Kranz anatomy. PeerJ 2016, 4, e1697. [Google Scholar] [CrossRef]
- Zhang, L.; Zhang, Q.; Jiang, Y.; Li, Y.; Zhang, H.; Li, R. Reference genes identification for normalization of qPCR under multiple stresses in Hordeum brevisubulatum. Plant Methods 2018, 14, 110. [Google Scholar] [CrossRef]
- Saddhe, A.A.; Malvankar, M.R.; Kumar, K. Selection of reference genes for quantitative real-time PCR analysis in halophytic plant Rhizophora apiculata. PeerJ 2018, 6, e5226. [Google Scholar] [CrossRef]
- Wang, M.; Ren, T.; Marowa, P.; Du, H.; Xu, Z. Identification and selection of reference genes for gene expression analysis by quantitative real-time PCR in Suaeda glauca’s response to salinity. Sci. Rep. 2021, 11, 8569. [Google Scholar] [CrossRef] [PubMed]
- Silver, N.; Best, S.; Jiang, J.; Thein, S.L. Selection of housekeeping genes for gene expression studies in human reticulocytes using real-time PCR. BMC Mol. Biol. 2006, 7, 33. [Google Scholar] [CrossRef]
- Pfaffl, M.W.; Tichopad, A.; Prgomet, C.; Neuvians, T.P. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper–Excel-based tool using pair-wise correlations. Biotechnol. Lett. 2004, 26, 509–515. [Google Scholar] [CrossRef] [PubMed]
- Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, research0034.1. [Google Scholar] [CrossRef]
- Xie, F.; Xiao, P.; Chen, D.; Xu, L.; Zhang, B. miRDeepFinder: A miRNA analysis tool for deep sequencing of plant small RNAs. Plant Mol. Biol. 2012, 80, 75–84. [Google Scholar] [CrossRef]
- Xie, F.; Wang, J.; Zhang, B. RefFinder: A web-based tool for comprehensively analyzing and identifying reference genes. Funct. Integr. Genom. 2023, 23, 125. [Google Scholar] [CrossRef] [PubMed]
- Gao, Y.; Gao, Y.; Huang, B.; Meng, Z.; Jia, Y. Reference gene validation for quantification of gene expression during ovarian development of turbot (Scophthalmus maximus). Sci. Rep. 2020, 10, 823. [Google Scholar] [CrossRef]
- Lu, X.; Liu, Y.; Zhao, L.; Liu, Y.; Zhao, M. Selection of reliable reference genes for RT-qPCR during methyl jasmonate, salicylic acid and hydrogen peroxide treatments in Ganoderma lucidum. World J. Microbiol. Biotechnol. 2018, 34, 92. [Google Scholar] [CrossRef]
- Hashemipetroudi, S.H.; Ahmadian, G.; Fatemi, F.; Nematzadeh, G.; Yamchi, A.; Kuhlmann, M. Ion content, antioxidant enzyme activity and transcriptional response under salt stress and recovery condition in the halophyte grass Aeluropus littoralis. BMC Res. Notes 2022, 15, 201. [Google Scholar] [CrossRef]
- Ruijter, J.; Ramakers, C.; Hoogaars, W.; Karlen, Y.; Bakker, O.; Van den Hoff, M.; Moorman, A. Amplification efficiency: Linking baseline and bias in the analysis of quantitative PCR data. Nucleic Acids Res. 2009, 37, e45. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Augustine, S.M. Function of heat-shock proteins in drought tolerance regulation of plants. In Drought Stress Tolerance in Plants, Vol. 1: Physiology and Biochemistry; Springer: Cham, Switzerland, 2016; pp. 163–185. [Google Scholar]
- Hoseini, M.; Arzani, A. Epigenetic adaptation to drought and salinity in crop plants. J. Plant Mol. Breed. 2023, 11, 1–16. [Google Scholar] [CrossRef]
- Teng, P.; Donnellon-May, G. Global Water Crisis: Options for Food Security; RSIS Comment No. 068; S. Rajaratnam School of International Studies: Singapore, 2022. [Google Scholar]
- Charpentier, A.; James, M.; Ali, H. Predicting drought and subsidence risks in France. Nat. Hazards Earth Syst. Sci. 2022, 22, 2401–2418. [Google Scholar] [CrossRef]
- Chen, C.; Wu, J.; Hua, Q.; Tel-Zur, N.; Xie, F.; Zhang, Z.; Chen, J.; Zhang, R.; Hu, G.; Zhao, J. Identification of reliable reference genes for quantitative real-time PCR normalization in pitaya. Plant Methods 2019, 15, 70. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Zhang, B.; Zhao, Y.; Liu, P.; Zhou, Y. EF1α is a suitable housekeeping gene for RT-qPCR analysis during osteogenic differentiation of mouse bone marrow-derived mesenchymal stem cells. Acta Biochim. Pol. 2013, 60, 381–386. [Google Scholar] [CrossRef]
- Jarošová, J.; Kundu, J.K. Validation of reference genes as internal control for studying viral infections in cereals by quantitative real-time RT-PCR. BMC Plant Biol. 2010, 10, 146. [Google Scholar] [CrossRef]
- Ma, S.; Niu, H.; Liu, C.; Zhang, J.; Hou, C.; Wang, D. Expression stabilities of candidate reference genes for RT-qPCR under different stress conditions in soybean. PLoS ONE 2013, 8, e75271. [Google Scholar] [CrossRef]
- Kozera, B.; Rapacz, M. Reference genes in real-time PCR. J. Appl. Genet. 2013, 54, 391–406. [Google Scholar] [CrossRef]
- Kundu, A.; Patel, A.; Pal, A. Defining reference genes for qPCR normalization to study biotic and abiotic stress responses in Vigna mungo. Plant Cell Rep. 2013, 32, 1647–1658. [Google Scholar] [CrossRef] [PubMed]
- Zong, J.; Chen, J.; Li, L.; Li, J.; Li, D.; Wang, J.; Liu, J.; Liu, J. Reference gene selection for quantitative RT-PCR in Miscanthus sacchariflorus under abiotic stress conditions. Mol. Biol. Rep. 2022, 49, 907–915. [Google Scholar] [CrossRef]
- Li, Z.; Lu, H.; He, Z.; Wang, C.; Wang, Y.; Ji, X. Selection of appropriate reference genes for quantitative real-time reverse transcription PCR in Betula platyphylla under salt and osmotic stress conditions. PLoS ONE 2019, 14, e0225926. [Google Scholar] [CrossRef] [PubMed]
- Luo, H.; Luo, K.; Luo, L.; Xiang Li, E.; Guan, B.; Xiong, D.; Sun, B.; Peng, K.; Yang, B. Evaluation of candidate reference genes for gene expression studies in Cymbidium kanran. Sci. Hortic. 2014, 167, 43–48. [Google Scholar] [CrossRef]
- Sellamuthu, G.; Amin, S.; Bílý, J.; Synek, J.; Modlinger, R.; Sen, M.K.; Chakraborty, A.; Roy, A. Reference gene selection for normalizing gene expression in Ips sexdentatus (Coleoptera: Curculionidae: Scolytinae) under different experimental conditions. Front. Physiol. 2021, 12, 752768. [Google Scholar] [CrossRef]
- Chen, C.; Li, S.; Zhu, H.; Fan, B.; Wang, Y.; Hao, D. Identification and evaluation of reference genes for gene expression analysis in the weevil pest Pagiophloeus tsushimanus using RT-qPCR. J. Asia-Pac. Entomol. 2020, 23, 336–344. [Google Scholar] [CrossRef]
- Li, Y.; Liang, X.; Zhou, X.; Wu, Z.; Yuan, L.; Wang, Y.; Li, Y. Selection of reference genes for qRT-PCR analysis in medicinal plant Glycyrrhiza under abiotic stresses and hormonal treatments. Plants 2020, 9, 1441. [Google Scholar] [CrossRef]
- Nikbakht-Dehkordi, A.; Martinez-Gomez, P. Phytohormones and plant defense. J. Plant Mol. Breed. 2024, 12, 41–52. [Google Scholar] [CrossRef]
- Ambroise, V.; Legay, S.; Guerriero, G.; Hausman, J.-F.; Cuypers, A.; Sergeant, K. Selection of appropriate reference genes for gene expression analysis under abiotic stresses in Salix viminalis. Int. J. Mol. Sci. 2019, 20, 4210. [Google Scholar] [CrossRef]






| Gene Symbol | Accession No. | Gene Locus | Identity% | Description | Primer Sequence | Amplicon Size |
| ACT7 | EE594539.1 | AT5G09810.1 | 94.62 | Member of the actin gene family | GTATGGCAACATCGTGCTCAG TGGAGCAACTACCTTAAT | 118 |
| EF1A | EE594715.1 | AT1G07940 | 34 | GTP binding the elongation factor Tu family protein; | TGCTGTCGGTGTCATCAA CTTCCATCAAACGCCTCATT | 97 |
| UBQ2 | EE594598.1 | AT2G36170 | 62 | 60S ribosomal protein L40-1 | CTTGGTCTGCTGTTGTCTTG CACGGTTCACTTATCCATCAC | 200 |
| TUB6 | EE594551.1 | LOC117856123 | 73 | Encodes beta-tubulin | TGCTGCCTGCTGTATCTT CGGAGGAACTTACTACTACATACT | 109 |
| GTFC | JZ191082.1 | LOC123066744 | 77.89 | General transcription factor 3C polypeptide 5-like | TTCCAAGTGGCCATCAGGTT AAAGGGCTTCCTGCCTCTTG | 108 |
| RPS12 | JZ191056.1 | AT2G32060 | 64 | Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein | TTGGCAGACTCACGAAGG GATGGCGGATCAGGAGAC | 147 |
| GAPDH1 | JN604531.1 | AT3G04120 | 98 | Encodes cytosolic GADPH (C subunit) and involved in the glycolytic pathway | TGGGCAAGATTAAGATCGGAAT TTGATGTCGCTGTGCTTCCA | 184 |
| RPS3 | JZ191044.1 | AT5G35530 | 90 | Ribosomal protein S3 family protein | ATTCACTGGCTGACCGGATG GTGCCAAGGGTTGTGAGGTC | 107 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hashemipetroudi, S.H.; Rezaei, A.; Kuhlmann, M. Validation of Reference Genes for Accurate RT-qPCR Normalization in Aeluropus littoralis Under Drought, Cold, and ABA Treatments. Agronomy 2025, 15, 1596. https://doi.org/10.3390/agronomy15071596
Hashemipetroudi SH, Rezaei A, Kuhlmann M. Validation of Reference Genes for Accurate RT-qPCR Normalization in Aeluropus littoralis Under Drought, Cold, and ABA Treatments. Agronomy. 2025; 15(7):1596. https://doi.org/10.3390/agronomy15071596
Chicago/Turabian StyleHashemipetroudi, Seyyed Hamidreza, Ali Rezaei, and Markus Kuhlmann. 2025. "Validation of Reference Genes for Accurate RT-qPCR Normalization in Aeluropus littoralis Under Drought, Cold, and ABA Treatments" Agronomy 15, no. 7: 1596. https://doi.org/10.3390/agronomy15071596
APA StyleHashemipetroudi, S. H., Rezaei, A., & Kuhlmann, M. (2025). Validation of Reference Genes for Accurate RT-qPCR Normalization in Aeluropus littoralis Under Drought, Cold, and ABA Treatments. Agronomy, 15(7), 1596. https://doi.org/10.3390/agronomy15071596

