Next Article in Journal
Film-Forming and Metabolic Antitranspirants Reduce Potato Drought Stress and Tuber Physiological Disorders
Previous Article in Journal
Biocontrol Potential of Microfighter: A Zeolite-Based Product Enriched with Pseudomonas synxantha DSL65
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 15
Issue 7
10.3390/agronomy15071565
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Overexpression of AgDREBA6b Gene Significantly Increases Heat Tolerance in Arabidopsis thaliana

by
Fangjie Xie
1,2,
Shengyan Yang
1,2,
Zexi Peng
1,2,
Yonglu Li
1,
Zhenchao Yang
1,2,3 and
Ruiheng Lv
1,*
1
College of Horticulture and Forestry, Tarim University, Alar 843300, China
2
Xinjiang Production & Construction Corps Key Laboratory of Protected Agriculture, Tarim University, Alar 843300, China
3
College of Horticulture, Northwest A & F University, Yangling 712100, China
*
Author to whom correspondence should be addressed.
Agronomy 2025, 15(7), 1565; https://doi.org/10.3390/agronomy15071565
Submission received: 6 May 2025 / Revised: 10 June 2025 / Accepted: 24 June 2025 / Published: 27 June 2025
(This article belongs to the Topic Vegetable Breeding, Genetics and Genomics, 2nd Volume)
Browse Figures
Versions Notes

Abstract

The APETALA2/ethylene response factor (AP2/ERF) is a class of plant-specific transcription factors, among which the dehydration-responsive element-binding protein (DREB) subfamily has been widely reported to enhance plant resistance to abiotic stresses. A high-temperature-related gene, Apium graveolens DREBA6b (AgDREBA6b; accession number: OR727346), was previously cloned from a heat-tolerant celery variety. In this study, we transformed this gene into Arabidopsis thaliana using an Agrobacterium rhizogenes-mediated method to explore its function. The results showed that overexpressing AgDREBA6b in Arabidopsis thaliana significantly improved plant growth under high-temperature stress (38 °C) compared to the dreb mutant and wild-type (WT) plants. The anatomical structure of the leaves revealed that the number and degree of stomatal openings in the overexpressed plants were significantly higher than those in the WT and dreb plants, suggesting that AgDREBA6b enhances stomatal opening. Additionally, the chlorophyll content, chlorophyll fluorescence properties, proline (Pro), malondialdehyde (MDA), superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD) activities were higher in the transgenic plants, indicating better stress tolerance. qPCR analysis showed that four heat tolerance-related genes (AtHSP98.7, AtHSP70-1, AtAPX1, and AtGOLS1) were upregulated in the transgenic plants, with higher expression levels than in WT and mutant plants. This study provides valuable genetic resources for understanding the molecular mechanisms of celery’s heat tolerance and offers insights for breeding heat-tolerant celery varieties.

1. Introduction

Plants are exposed to a variety of environmental threats in their natural environments, such as abiotic stresses like drought, salinity, and temperature extremes, which negatively affect plant adaptation to these stresses, biomass, and yield [1]. To adapt to these stresses, plants have evolved complex physiological and molecular responses, including changes in gene expression, metabolic pathways, and cellular structures [2]. Transcription factors (TFs) play a crucial role in regulating these responses by binding to specific DNA sequences and modulating the transcription of downstream genes [3]. TFs are a class of proteins that activate or repress the transcription of other downstream genes by recognizing and binding to DNA sequences of their promoters, such as dehydration-responsive element-binding protein (DREB), basic leucine zipper (bZIP), myeloblastosis (MYB), no apical meristem (NAM), WRKY, and the NAM/ATAF/CUC (NAC). They control signal transduction and regulate gene expression under abiotic stress [4].
DREB (dehydration responsive element-binding protein), as a plant-specific transcription factor, belongs to a branch of the APETALA2/ethylene response factor (AP2/ERF) gene family and regulates the expression of downstream target genes by specifically identifying the dehydration responsive element/C-repeat sequence (DRE/CRT) cis-element, which, in turn, enhances plant resistance to abiotic stresses [5,6]. Currently, different numbers of DREB genes have been identified and functionally analyzed in an increasing number of species. Based on the similarity of AP2 structural domains, DREB family members can be classified into subfamilies A1 to A6, and DREB proteins show functional divergence in stress responses. For example, A1 members are mainly involved in the cold stress response [7,8], A2 members are mainly involved in drought and high-salt stress regulation [9], and A3-type DREBs play a role in regulating the response to abscisic acid (ABA) in seeds [10]. Among these, the A-1 (DREB1) and A-2 (DREB2) subgroups have been extensively investigated and are recognized as the primary categories of DREBs that play crucial roles in modulating plant responses to abiotic stresses [11]. Previous studies on DREB have focused on the A1/A2 subfamily, and DREBA6 contains a large number of gene members, with marked differences in the function of the DREB (A-6) genes in different plants. There are few studies on the A6 subfamily, and the functions and mechanisms of the A-6-type genes are still unclear [12]. Therefore, there is a need to explore more genes from subgroup A-6 to better understand their functions and complex regulatory mechanisms in various plants.
Environmental factor stresses (drought, high temperature, high salt, and low temperature) often cause changes in plant physiological and biochemical indices, which are regulated by the protective system and related gene expression in the plant [13]. Among them, chlorophyll fluorescence parameters can be the first to respond to stress, which helps to clarify the site and extent of stress damage in the photosynthetic structure [14]. Plants can also overcome environmental stresses through the synergistic action of osmoprotectants and various antioxidants in the plant. For example, proline (Pro) is an important soluble osmotic pressure, which is an important indicator of changes in physiological parameters in response to plant adversity stress [15]. The antioxidant enzyme system in plants, including key enzymes such as peroxidase (POD), catalase (CAT), and superoxide dismutase (SOD), reduces the damage of adversity to cellular structures by rapid synthesis and activation of antioxidant defense mechanisms that lead to the accumulation of reactive oxygen species (ROS), which degrade the polyunsaturated lipids, leading to the formation of malondialdehyde (MDA). Overexpression of Limonium bicolor Lb DREB upregulates the expression of stress-related genes such as Cu/ZnSOD and POD [16]. After transfection of the Eleusine coracana Ec DREB2A gene in tobacco (Nicotiana tabacum L.), the transgenic tobacco could tolerate a high temperature of 42 °C but not salt stress and osmotic stress. Further studies found that the plants enhanced tolerance to heat stress mainly by increasing the activities of antioxidant enzymes (SOD, CAT, and POD), and increasing the content of MDA, and eight downstream related genes were also significantly upregulated [17]. Overexpression of chrysanthemum CmDREB6 promoted the expression of CmHsfA4, CmHSP90, and the reactive oxygen scavenger genes CmSOD and CmCAT [18]. The above studies indicated that DREB transcription factors are important regulatory nodes for abiotic stress response in plants, and their overexpression enhances stress tolerance by activating antioxidant systems and thermo-protective mechanisms.
Celery is suitable for growing in cool and moist environments, and high temperature is the main environmental factor limiting the growth of celery [19]. In order to investigate the molecular mechanism of high-temperature response in celery, the research group cloned an AgDREBA6b gene from celery, and found that under high-temperature stress, the expression of AgDREBA6b gene showed a sustained increased trend with the increase in time, suggesting that this gene may be actively involved in the response to high-temperature stress in celery [20]. On this basis, the AgDREBA6b gene was transformed into Arabidopsis thaliana dreb mutants in this study, and its role in regulating heat tolerance in plants was analyzed in the context of changes in cellular anatomy, phenotype, physiology, and related stress genes. This study expands the application prospects of DREB family transcription factors, which is conducive to a deeper understanding of the mechanism of high-temperature injury in celery, and lays the foundation for further exploration of its functions and the creation of new stress-resistant germplasm resources.

2. Materials and Methods

2.1. The AgDREBA6b Gene Overexpression Vector Agrobacterium Transformation

The Arabidopsis dreba6 mutant seeds were purchased from the TAIR website (https://www.arabidopsis.org/) on 10 June 2023, and pCAMBIA1301-AgDREBA6b plasmids were preserved for our laboratory.
The recombinant vector pCAMBIA1301-AgDREBA6b was introduced into Agrobacterium tumefaciens GV3101 (Sangon, Shanghai, China) using the freeze–thaw method. Briefly, 2 μg of the vector was added to 100 μL of A. tumefaciens competent cells, mixed by tapping, and subjected to 5 min on ice, 5 min in liquid nitrogen, 5 min at 37 °C, and 5 min in an ice bath. Then, 700 μL of antibiotic-free LB medium was added, and the mixture was incubated at 28 °C for 2 h. After incubation, the cells were centrifuged at 6000 rpm for 1 min, resuspended in 100 μL LB, and spread onto YEB solid medium (pH 7.0) with 15 μL kanamycin and 15 μL rifampicin. The plates were incubated at 28 °C for 2 days. Positive clones were selected and verified by colony PCR with the following protocol: 95 °C for 3 min, followed by 35 cycles of 95 °C for 15 s, 55 °C for 15 s, 72 °C for 30 s, and a final extension at 72 °C for 5 min.

2.2. Cultivation of Arabidopsis thaliana

Several Arabidopsis seeds were loaded into sterile 1.5 mL centrifuge tubes as required for the experiment, and 1 mL of 75% ethanol was added. The results were mixed by inverting the tube up and down, discarding the supernatant, and repeating three times. Next, 1 mL of ultrapure water was added, the seeds were washed, the supernatant was discarded, and the process was repeated three times. In the ultra-clean bench with 1 mL pipette Arabidopsis seeds in the prepared MS plate spot seeding, the plate was sealed and inverted under dark conditions in 4 °C in the environment of the vernalization of 72 h; after the end of the vernalization, the plate was placed in a light incubator for vertical cultivation. The emergence of seedlings can be transplanted after seven days; with tweezers gently planted the seedlings into the soil of the small pots. The first plastic wrap was moisturized for 24 h and put in the plant growth chamber; seedlings were kept in the plant growth room for 24 h. The seedlings were cultured until the Arabidopsis thaliana grew (30 days); then, they could be used for transformation experiments.

2.3. Genetic Transformation of Arabidopsis thaliana

First, 10 μL of Rif and 20 μL of Kan (Sigma, St. Louis, MO, USA) were added into 20 mL of LB liquid medium and shaken well to inoculate the bacteria, and the bacteria were activated by shaking at 28 °C 220 rpm for 8–10 h to obtain the activation solution of Agrobacterium. Next, 100 μL of Rif and 200 μL of Kan were added into 200 mL of YEB liquid medium; then, 5–10 mL of the activated bacterial solution was added and the culture shaken at 28 °C/220 rpm for 14–16 h. When the OD value reached 1.6–2.0, centrifugation was performed at 4500 rpm for 10 min, and the supernatant was discarded from the precipitated bacterial body, which was dried naturally. Next, 20 μL of SILWETL-77 (surfactant) solution and 100 mL of 5% sucrose was added to the precipitated bacterial body to re-suspend the bacteria, a pipette was used to blow evenly, and the bacteria were re-suspended repeatedly. The bacterial solution in the centrifugal bottle was added to the petri dish, and the inflorescence of Arabidopsis thaliana was closed, immersed in the petri dish, and gently shaken for 15 s. After the transformation, the bacterial solution was stirred and the plants were covered with a black bag; the plants were protected from light and kept in humidity for 24 h, and the transformation was repeated again a week later.

2.4. Screening of T1 Generation Positive Plants

The Arabidopsis T0 generation seeds were collected and planted. The T0 generation seeds were sterilized, inoculated on MS screening medium containing 30 mg/L chaotropic acid (with 25 mg/L cephalothin added for bacterial suppression), light-cultured at 22 °C for 7–10 days, and screened to obtain the T1 generation of positive plants (plants in which the seedlings and root systems grew normally). Then, the positive seedlings were transplanted to nutrient soil and covered with cling film for 2–3 days before the film was removed so they could grow normally. Genomic DNA was extracted from the leaves of the screened T1-generation positive plants, the presence of the AgDREBA6b gene was confirmed by PCR, and the molecular verification of the target gene in the transgenic plants was carried out, which finally confirmed that the gene had been transferred into the T1-generation positive plants.

2.5. T2 Generation Positive Test of Transgenic Plants

T1-generation positive plants were harvested individually to obtain T1-generation seeds. These seeds were then subjected to thaumatin screening to identify T2-generation positive plants, which were grown for 10 days. The plants were removed with forceps and stained using a GUS staining kit (Beijing Coolabo Technology Co., Ltd., Beijing, China) to verify the presence of the transgene in T2-generation positive plants, dreb mutants, and WT. The confirmed positive plants were then transplanted and grown further. Genomic DNA was extracted from the leaves of these plants, and PCR molecular identification was performed to determine the T2 generation positive plants.

2.6. Phenotype Observation of Arabidopsis Positive Plants

The dreb mutant seeds were sown in blistered nutrient soil at the same time as the T1 generation seeds, purified at 4 °C for 72 h, and then moved into the plant growth room. When the leaves of Arabidopsis unfolded to 5 cm (20 d), high-temperature stress treatment was carried out, and dreb, WT, and 35S:AgDREBA6b/dreb plants were simultaneously placed in a light incubator at 38 °C to maintain the humidity at about 60% for 24 h.

2.7. Determination of Leaf Structural Properties of Arabidopsis Positive Plants

The dreb mutant, WT, and AgDREBA6b transgenic Arabidopsis thaliana plants were exposed to high temperature (38 °C) for 4 h. Leaf samples were collected with tweezers, fixed in FAA fixative for 24 h, dehydrated through an alcohol gradient, and cleared with anhydrous ethanol and xylene. The samples were embedded in paraffin, sectioned at 3 µm thickness, and stained with fenugreek-solid green. Sections were mounted on slides, sealed with neutral gum, and observed under a Nikon Eclipse E100 microscope. Each sample was processed in triplicate.

2.8. Measurement of Physiological and Biochemical Indices in Leaves of Arabidopsis Positive Plants

The dreb mutant plants, WT plants, and overexpressing AgDREBA6b plants in the mutant were treated at 38 °C for 24 h, and the relative chlorophyll content was determined using a portable chlorophyll meter and expressed as SPAD values. The chlorophyll fluorescence parameters of leaves were measured using a portable fluorometer after the whole Arabidopsis plants were treated in the dark for 30 min, including PSII light energy conversion efficiency (Fv/Fm) and photochemical quenching (qN). They were measured in situ in the Arabidopsis culture environment three to five times, with three biological replicates for each strain, and the average values were taken. Arabidopsis leaves were collected for the determination of chlorophyll b, chlorophyll a, and total chlorophyll content using a 1:1 mixture of anhydrous acetone and anhydrous ethanol. The samples were frozen in liquid nitrogen and stored in a −80 °C freezer for the determination of Pro (colorimetric method), POD, and SOD activities, as well as CAT enzyme activity, with measurements performed according to the instructions of the kit provided by Nanjing Jiancheng Institute of Bioengineering Co., Ltd., Nanjing, China. Three plants were selected from each strain, three leaves were selected from each plant, and each leaf was measured three times. All the above experiments were repeated three times.

2.9. Validation of Quantitative Expression in Arabidopsis Positive Plants

The dreb mutant, WT, and 35S:AgDREBA6b/dreb transgenic plants were treated with high temperature at 38 °C for 0 h, 4 h, 12 h, and 24 h, respectively, and the leaves were quickly frozen in liquid nitrogen and then stored in an ultra-low temperature freezer at −80 °C. Total RNA was extracted from Arabidopsis leaves using Plant Total RNA Isolation Kit (Chengdu Fukuji Biotechnology Co., Ltd., Chengdu, China), and the total RNA extracted was reverse transcribed into cDNA using the Goldenstar™ RT6 cDNA Synthesis Mix Rnasin selected (Beijing DynaPro Biotech Co., Ltd., Beijing, China). For the qPCR analysis, AtActin served as the internal reference gene, and the 2×TSINGKE™ Master qPCR Mix kit was employed to assess the expression differences of the four heat-tolerance-related genes among the dreb mutant, the WT, and the transgenic plants. The PCR mixture (20 µL total volume) consisted of 2.0 µL template cDNA, 0.4 µL each of forward and reverse primers (10 mM each), 10 µL SYBR Green I master mix (Takara, Dalian, China), and 7.2 µL ddH2O. The PCR conditions were as follows: 95 °C for 1 min for pre-denaturation, 40 cycles of 95 °C for 10 s for denaturation, and 58 °C for 15 s for annealing and extension. The relative expression levels were assessed using the 2−ΔΔCt method [21], with ΔΔCt calculated as ΔΔCt = (Ct of the target gene − Ct of Actin) in the treatment group and − (Ct of the target gene − Ct of Actin) in the control group. The primer sequences are listed in Table 1.

2.10. Data Analysis

Statistical analysis was performed using one-way analysis of variance (one-way ANOVA) with Excel 2021 and SPSS 19.0 software, with a significance threshold set at p < 0.05. All graphs were generated using Origin 2021.

3. Results

3.1. Identification of Transgenic Arabidopsis thaliana

In the early stage of the study, the AgDREBA6b gene (GenBank accession number: OR727346) was cloned and backfilled into the dreb mutant plants of Arabidopsis thaliana. Transgenic plants (35S:AgDREBA6b/dreb) were obtained from the T2 generation. GUS staining analyses were performed on the T2 generation of positive plants, the dreb mutant, and WT plants (Figure 1). The results showed that 35S:AgDREBA6b/dreb plants turned blue, while the dreb mutant and WT plants did not. Additionally, PCR identification revealed the presence of the target band of AgDREBA6b in the transgenic Arabidopsis thaliana (Figure S1). These results indicate that 35S:AgDREBA6b/dreb transgenic positive plants have been successfully obtained.

3.2. The Phenotype and Leaf Anatomy of Arabidopsis Plants Under Heat Stress

As shown in Figure 2, the strains of Arabidopsis thaliana exhibited good growth and no significant differences before high-temperature treatment. After 24 h of high-temperature treatment, the dreb mutant plants showed the most severe leaf damage, followed by the WT plants. In contrast, the 35S:AgDREBA6b/dreb plants exhibited the least leaf damage and the lowest degree of yellowing and wilting. Further leaf dissection revealed that the number and degree of stomatal openings in the 35S:AgDREBA6b/dreb plants were significantly higher than those in the WT and dreb mutant plants (Figure 3). These results suggest that the AgDREBA6b gene may enhance heat stress tolerance through its regulatory mechanisms. Consequently, heat stress did not significantly damage the leaves of the transgenic plants, which retained well-preserved and undamaged stomata, unlike the damaged leaves of the WT plants.

3.3. Effect of Heat Stress on Chlorophyll Content and Chlorophyll Fluorescence Properties of Leaves of Transgenic Plants

The content of chlorophyll, which serves as the material basis for energy conversion in photosynthesis, is an important indicator of crop senescence and photosynthetic capacity. To evaluate the photosynthetic performance of transgenic Arabidopsis thaliana plants, leaf chlorophyll content and chlorophyll fluorescence characteristics were determined in this study. As shown in Figure 4, the results indicated that the chlorophyll content at 0 h was higher in 35S:AgDREBA6b/dreb plants than in the other two genotypes. Among the chlorophyll fluorescence characteristics, PSII did not differ significantly among the three strains, but dP was higher in 35S:AgDREBA6b/dreb plants than in the other two. In contrast, the overexpression plants exhibited significantly lower non-photochemical quenching than WT plants. This may be because the overexpressing plants do not activate the NPQ pathway when unstressed. Under high-temperature stress, the intensity of photosynthesis in 35S:AgDREBA6b/dreb transgenic Arabidopsis plants was significantly stronger than that in WT and dreb mutant plants. Specifically, while dreb mutant and WT plants showed no significant differences in chlorophyll a and chlorophyll b contents, the chlorophyll a, chlorophyll b, and total chlorophyll contents in 35S:AgDREBA6b/dreb plants were increased by 3 mg/L, 2.3 mg/L, and 3 mg/L, respectively, compared with WT plants. In terms of PSII primary light energy conversion efficiency, chlorophyll non-photochemical burst coefficient, and chlorophyll photochemical burst coefficient, the values for the 35S:AgDREBA6b/dreb transgenic Arabidopsis plants were 2-fold, 1.3-fold, and 1.5-fold higher than those for the dreb mutant plants, respectively. These results indicate that 35S:AgDREBA6b/dreb Arabidopsis plants exhibited higher chlorophyll content and photosynthesis-related indices under high-temperature stress.

3.4. Effects of Heat Stress on Proline and Antioxidant Enzyme Activity in Transgenic Plants

To assess whether the overexpression of AgDREBA6b enhances heat stress tolerance in transgenic plants, we measured several stress tolerance indicators, including free Pro, MDA, CAT, SOD, and POD. As shown in Figure 5, no significant differences were observed in these indicators among Arabidopsis thaliana plants at 0 h. However, after 24 h of high-temperature treatment, the activities of Pro, MDA, CAT, SOD, and POD were significantly higher in the leaves of 35S:AgDREBA6b/dreb plants compared to the dreb mutant and WT plants. Notably, the Pro content in transgenic 35S:AgDREBA6b/dreb plants increased 7-fold and 3.5-fold compared to the dreb mutant and WT plants, respectively. This suggests that the transgenic plants can maintain intracellular osmotic pressure more effectively by increasing Pro accumulation, thereby preventing excessive cell dehydration and structural damage. Additionally, the CAT content in transgenic plants was 4-fold and 2.8-fold higher than in the dreb mutant and WT plants, respectively, while POD enzyme activity was 4-fold and 1.9-fold higher. Although the SOD enzyme activity showed less variation, it was still 1.29 and 1.12 times higher in transgenic plants than in the dreb mutant and WT plants, respectively. The MDA content was also elevated, being 2 and 1.1 times higher in transgenic plants than in the dreb mutant and WT plants. These findings indicate that the introduction of the AgDREBA6b gene into the dreb Arabidopsis mutant enhances Pro content and antioxidant enzyme activity, reduces ROS accumulation, limits cell damage, and, ultimately, improves heat tolerance in transgenic Arabidopsis.

3.5. Expression Patterns of Four High-Temperature-Associated Genes Under Heat Stress

To determine the function of AgDREBA6b under heat stress induction, this study investigated the expression patterns of four high-temperature-responsive genes under different stress treatment times using qPCR. As shown in Figure 6, the results showed that the expression of the four related genes in 35S:AgDREBA6b/dreb plants showed an increasing trend with the increase in treatment time, and the expression increased rapidly after 12 h and remained at a high level. Moreover, the expression of AtHSP70-1, AtAPX1, and AtGOLS1 genes was higher than that of WT and dreb mutant plants, while the expression of AtHSP98.7 gene was higher in overexpressed plants at 4 h and lower than that of WT plants thereafter. After 24 h of high-temperature treatment, AtHSP70-1 gene expression was 2.3-fold and 1.3-fold higher than that of dreb and WT, respectively, AtAPX1 gene expression was 3.3-fold and 1.9-fold higher than that of dreb and WT, respectively, and AtGOLS1 gene expression was 3.8-fold and 1.7-fold higher, respectively. The results indicated that all four relevant genes in 35S:AgDREBA6b/dreb transgenic plants responded to high-temperature stress, which might be related to their functions.

4. Discussion

High-temperature stress involves a variety of plant metabolism characteristics and complex processes of physiology and biochemistry, which is one of the main factors affecting plant growth and development, quality, and yield. Dehydration response element binding protein (DREB) can play an important role in response to various abiotic stresses, especially in response to high-temperature stress, by regulating the expression of stress-related genes [22].
In this study, we successfully constructed Arabidopsis transgenic plants overexpressing the AgDREBA6b gene using genetic transformation technology and established a model of the AgDREBA6b regulatory network in response to heat stress (Figure 7). Under high-temperature stress, although all Arabidopsis plants showed heat damage symptoms such as leaf yellowing and wilting, the transgenic plants with AgDREBA6b were significantly less affected than the WT plants and the dreb mutant. This result indicated that the dreb mutant plants were more sensitive to heat stress, confirming that overexpression of the AgDREBA6b gene enhances heat tolerance in plants, which is consistent with the previous studies [23,24]. To validate our hypothesis, we further analyzed the leaf anatomical structures and found that stomatal opening of Arabidopsis plants overexpressing AgDREBA6b was significantly larger than that of WT and dreb mutant plants under high-temperature stress conditions, which suggested that AgDREBA6b may enhance the heat tolerance of the plants by regulating stomatal movement [25]. These results are consistent with the phenotype under heat stress and further demonstrate the positive role of AgDREBA6b in Arabidopsis plants in response to heat stress.
Chlorophyll plays a direct role in numerous metabolic processes in plants, and its degradation directly impairs plant productivity and diminishes growth and stress tolerance [26]. In this study, we found that the chlorophyll a, chlorophyll b, and total chlorophyll contents in the transgenic plants were significantly higher than those of WT and mutants under high-temperature stress, suggesting that the AgDREBA6b gene may be able to maintain the photosynthetic capacity by mitigating chloroplast damage. Chlorophyll fluorescence is an important index for evaluating the stability of the photosynthetic system and plant heat tolerance, which can reflect the efficiency of the absorption, transmission, distribution, and conversion of light energy in the plant photosystem, and it can respond to the stress first, which can help to clarify the site and degree of damage by adversity stress in the structure of photosynthesis [27]. PSII, as an important parameter reflecting the maximal potential photosynthetic capacity of the plant, had values that were significantly higher in the transgenic strain and significantly higher than those of the WT and the mutant, indicating that the transgenic plants were more efficient in converting light energy under heat stress, which could improve the heat tolerance of the plants by enhancing the photoprotective mechanism. Zha et al. [28] observed that the heterologous expression of VvDREB2c in Arabidopsis thaliana enhanced growth, drought tolerance, and heat tolerance. The VvDREB2c overexpressing lines dissipated excess light energy and converted it into heat, thereby reducing photodamage and enhancing photoprotection, ultimately improving tolerance to high temperatures. This is consistent with the results of the present study. In conclusion, overexpression of the AgDREBA6b gene not only reduces chlorophyll degradation and maintains PSII activity and light energy utilization efficiency, but also enhances the heat dissipation capacity, thus improving the heat tolerance and photosynthetic capacity of plants as a whole.
The plants will activate multiple regulatory mechanisms such as antioxidant enzyme systems, osmoregulation, and signaling pathways under high-temperature stress. Among these, the antioxidant enzyme system is crucial for scavenging reactive oxygen species (ROS) and protecting cells from oxidative damage. For example, the activities of SOD, POD, and CAT were enhanced by AtDREB1C and SlDREBA4, which, in turn, improved heat tolerance in transgenic Arabidopsis thaliana and tomato plants [29]. Overexpression of the VuDREB2A-CA gene in cowpea increased the antioxidant and osmoregulatory capacities of plants under heat stress [30]. In this study, we found that overexpression of AgDREBA6b Arabidopsis thaliana plants led to significantly higher SOD, CAT, and POD activities under high-temperature conditions. This result was consistent with the results of previous studies, indicating that DREB transcription factors generally function to regulate antioxidant enzyme systems. The enhanced activities of these enzymes effectively scavenged the high-temperature-induced generation of reactive oxygen species (ROS) and alleviated the cellular damage caused by oxidative stress. The contents of MDA were significantly higher in the transgenic plants than in the WT and the dreb mutant. MDA, a marker of membrane lipid peroxidation, was positively correlated with the degree of cell membrane damage [31]. Ren M et al. [32] reported that ClRAP2.4, a member of the DREB subfamily and the one most closely related to AT1G22190, was introduced into plants via Agrobacterium-mediated leaf disc transformation, yielding four overexpressing lines (OX-1, OX-2, OX-7, and OX-8). In these overexpressing lines, the activities of superoxide dismutase (SOD) and peroxidase (POD), as well as the content of proline, were higher than those in the wild type (WT), while the electrical conductivity and malondialdehyde (MDA) content were reduced. These findings indicate that plants overexpressing ClRAP2.4 exhibit enhanced tolerance to cold stress. Previous studies have shown that plant stress increases Pro content, which has a number of important roles, including acting as an osmoprotectant, protecting the stability of cellular components and enzymes, scavenging ROS, and helping to maintain redox homeostasis in stressed plant cells [33]. Lotus showing overexpression of LjDREB2B lines had significantly higher Pro content than WT plants [34]. Transgenic Arabidopsis thaliana overexpressing the MaDREB20 gene in banana showed higher survival, leaf relative water content, and Pro content for enhanced tolerance under high temperature, drought, and the combined effects of drought and high temperature [35]. In the present study, compared to the mutant dreba6 plants and WT plants, the DREBA6b-overexpression mutant plants produced higher concentrations of free Pro. This study was consistent with the results of previous studies. It indicated that the surge of Pro in transgenic plants provided a defense mechanism against adversity stress. In conclusion, the AgDREBA6b gene enhances heat tolerance in plants by decreasing ROS levels and alleviating membrane lipid peroxidation damage.
Transcription factors can regulate downstream high-temperature-responsive genes and related metabolic pathways and play important roles in the response to high-temperature stress. For instance, upregulation of the expression of heat, salt, and drought stress-responsive genes was observed in DREB2A transgenic Arabidopsis, resulting in higher abiotic stress tolerance [36]. MsDREB2C and AtDREB2C of Arabidopsis enhanced their heat tolerance by increasing the expression of AtHsfA3 and SIHSP90 in the transgenes [37]. In this study, the expression of AtHSP70-1, AtAPX1, and AtGOLS1 high-temperature-responsive genes was significantly upregulated in AgDREBA6b-overexpressing Arabidopsis transgenic plants, with higher expression than that of WT and dreb mutant plants, whereas expression of the AtHSP98.7 gene was higher in overexpressing plants at 4 h, and lower than that of WT plants thereafter. This may be because AtHSP70-1, AtAPX1, and AtGOLS1 promoters contain activating DRE/CRT elements that are directly positively regulated by AgDREBA6b. Whereas AtHSP98.7 may mainly depend on HSFs and non-DREB family regulation, the exact reason needs to be further verified. Previous studies have shown that DREB genes from other different species display heat tolerance, such as EcDREB2A in tobacco, CmDREB6 in chrysanthemum, LlDREB1G in long lily [38], and TaDREB3 in wheat [13], which is similar to the results of the present study, suggesting that AgDREBA6b may be an upstream transcription factor localized in the nucleus, which enhances heat tolerance by upregulating the expression of a series of stress-related genes to enhance heat tolerance in transgenic Arabidopsis, thereby mediating physiological processes associated with stress tolerance. Hence, transgenic Arabidopsis plants overexpressing AgDREBA6b exhibited enhanced heat tolerance, and the expression of physical metrics and stress-related genes further validated their function in coping with heat stress.

5. Conclusions

In this study, the AgDREBA6b gene from celery was transformed into Arabidopsis thaliana for overexpression, which initially revealed the role of AgDREBA6b gene in drought stress response. The leaves of transgenic Arabidopsis thaliana overexpressing AgDREBA6b showed less yellowing and wilting under high-temperature stress, and the degree of stomatal opening of leaf cells was significantly greater than that of WT plants and dreb mutant plants. The results of the physiological experiments showed that the transgenic Arabidopsis thaliana showed higher antioxidant enzymes and Pro and chlorophyll contents, and the relative expression levels of most high-temperature related genes were higher, indicating that AgDREBA6b overexpression lines could enhance the heat tolerance of plants by improving the activity of antioxidant enzymes and decreasing the degree of membrane lipid per-oxidation, which provided a basis for elucidating the molecular mechanism of the DREB gene family in response to high-temperature stress in plants. These results lay a foundation for clarifying the molecular mechanism of the DREB gene family in response to high-temperature stress in plants and provide theoretical support for exploring the cultivation of high-temperature-tolerant varieties of celery.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agronomy15071565/s1, Figure S1: T2 generation of PCR assay for Arabidopsis thaliana transcribed with pCAMBIA1301-AgDREBA6b gene.

Author Contributions

Conceptualization, F.X. and Z.Y.; data curation, S.Y. and Y.L.; validation, F.X. and Z.P.; writing—original draft preparation, F.X. and S.Y.; writing—review and editing, F.X., R.L. and Z.Y.; funding acquisition, R.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Ruiheng Lv, through the Plan for Tackling Key Scientific and Technological Problems in Key Areas of the Xinjiang Production & Construction Corps (Grant No.: 2021AB022).

Data Availability Statement

The data supporting the reported results in this study are available within the article and its Supplementary Materials. Additionally, the genetic sequences related to the AgDREBA6b gene discussed in this study are available in the GenBank database under the accession number OR727346.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Muthuramalingam, P.; Muthamil, S.; Shilpha, J.; Venkatramanan, V.; Priya, A.; Kim, J.; Shin, Y.; Chen, J.T.; Baskar, V.; Park, K.; et al. Molecular insights into abiotic stresses in mango. Plants 2023, 12, 1939. [Google Scholar] [CrossRef] [PubMed]
  2. Deng, C.; Wu, Y.; Lv, X.; Li, J.; Liu, Y.; Du, G.; Chen, J.; Liu, L. Refactoring transcription factors for metabolic engineering. Biotechnol. Adv. 2022, 57, 107935. [Google Scholar] [CrossRef] [PubMed]
  3. Hussain, Q.; Asim, M.; Zhang, R.; Khan, R.; Farooq, S.; Wu, J. Transcription factors interact with ABA through gene expression and signaling pathways to mitigate drought and salinity stress. Biomolecules 2021, 11, 1159. [Google Scholar] [CrossRef]
  4. Lee, S.; Jeon, D.; Choi, S.; Kang, Y.; Seo, S.; Kwon, S.; Lyu, J.; Ahn, J.; Seo, J.; Kim, C. Expression profile of sorghum genes and cis-regulatory elements under salt-stress conditions. Plants 2022, 11, 869. [Google Scholar] [CrossRef]
  5. Zhou, Y.X.; Zhou, W.; Liu, H.; Liu, P.; Li, Z.G. Genome-wide analysis of the soybean DREB gene family: Identification, genomic organization and expression profiles in response to drought stress. Plant Breed. 2020, 139, 1158–1167. [Google Scholar] [CrossRef]
  6. Li, T.; Huang, Y.; Khadr, A.; Wang, Y.H.; Xu, Z.S.; Xiong, A.S. DcDREB1A, a DREB-binding transcription factor from Daucus carota, enhances drought tolerance in transgenic Arabidopsis thaliana and modulates lignin levels by regulating lignin biosynthesis-related genes. Environ. Exp. Bot. 2020, 169, 103896. [Google Scholar] [CrossRef]
  7. Liu, Q.; Kasuga, M.; Sakuma, Y.; Abe, H.; Miura, S.; Yamaguchi-Shinozaki, K.; Shinozaki, K. Two transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA binding domain separate two cellular signal transduction pathways in drought- and low-temperature-responsive gene expression, respectively, in Arabidopsis. Plant Cell 1998, 10, 1391–1406. [Google Scholar] [CrossRef]
  8. Sakuma, Y.; Liu, Q.; Dubouzet, J.G.; Abe, H.; Shinozaki, K.; Yamaguchi-Shinozaki, K. DNA-binding specificity of the ERF/AP2 domain of Arabidopsis DREBs, transcription factors involved in dehydration- and cold-inducible gene expression. Biochem. Biophys. Res. Commun. 2002, 290, 998–1009. [Google Scholar] [CrossRef]
  9. Qin, F.; Kakimoto, M.; Sakuma, Y.; Maruyama, K.; Osakabe, Y.; Tran, L.S.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Regulation and functional analysis of ZmDREB2A in response to drought and heat stresses in Zea mays L. Plant J. 2007, 50, 54–69. [Google Scholar] [CrossRef]
  10. Finkelstein, R.R.; Wang, M.L.; Lynch, T.J.; Rao, S.; Goodman, H.M. The Arabidopsis abscisic acid response locus ABI4 encodes an APETALA 2 domain protein. Plant Cell 1998, 10, 1043–1054. [Google Scholar] [CrossRef]
  11. Zhang, Y.; Xia, P. The DREB transcription factor, a biomacromolecule, responds to abiotic stress by regulating the expression of stress-related genes. Int. J. Biol. Macromol. 2023, 243, 125231. [Google Scholar] [CrossRef] [PubMed]
  12. Azeem, S.; Munir, F.; Gul, A.; Amir, R. An A-6 subgroup member of DREB gene family positively regulates cold stress tolerance by modulating an antioxidant defense system in transgenic potato. Sci. Rep. 2025, 15, 15421. [Google Scholar] [CrossRef] [PubMed]
  13. Niu, X.; Luo, T.; Zhao, H.; Su, Y.; Ji, W.; Li, H. Identification of wheat DREB genes and functional characterization of TaDREB3 in response to abiotic stresses. Gene 2020, 740, 144514. [Google Scholar] [CrossRef] [PubMed]
  14. Zhou, R.; Yu, X.; Kjær, K.H.; Rosenqvist, E.; Ottosen, C.-O.; Wu, Z. Screening and validation of tomato genotypes under heat stress using Fv/Fm to reveal the physiological mechanism of heat tolerance. Environ. Exp. Bot. 2015, 118, 1–11. [Google Scholar] [CrossRef]
  15. Zhou, N.; Huang, J.; Jiang, F.; Hu, E.; Song, X.; Zhou, R.; Wu, Z. SOS3-3 enhances the salt tolerance of tomato plants by regulating ROS balance. Agronomy 2024, 14, 3044. [Google Scholar] [CrossRef]
  16. Ban, Q.; Liu, G.; Wang, Y. A DREB gene from Limonium bicolor mediates molecular and physiological responses to copper stress in transgenic tobacco. J. Plant Physiol. 2011, 168, 449–458. [Google Scholar] [CrossRef]
  17. Singh, S.; Chopperla, R.; Shingote, P.; Chhapekar, S.S.; Deshmukh, R.; Khan, S.; Padaria, J.C.; Sharma, T.R.; Solanke, A.U. Overexpression of EcDREB2A transcription factor from finger millet in tobacco enhances tolerance to heat stress through ROS scavenging. J. Biotechnol. 2021, 336, 10–24. [Google Scholar] [CrossRef]
  18. Du, X.; Li, W.; Sheng, L.; Deng, Y.; Wang, Y.; Zhang, W.; Yu, K.; Jiang, J.; Fang, W.; Guan, Z.; et al. Over-expression of chrysanthemum CmDREB6 enhanced tolerance of chrysanthemum to heat stress. BMC Plant Biol. 2018, 18, 178. [Google Scholar] [CrossRef]
  19. Li, M.Y.; Li, J.; Xie, F.J.; Zhou, J.; Sun, Y.; Luo, Y.; Zhang, Y.; Chen, Q.; Wang, Y.; Lin, Y.X.; et al. Combined evaluation of agronomic and quality traits to explore heat germplasm in celery (Apium graveolens L.). Sci. Hortic. 2023, 317, 112039. [Google Scholar] [CrossRef]
  20. Xie, F.J.; Hu, J.F.; Zhang, W.J.; Wang, X.R.; Zhou, S.H.; Yang, G.Z.; Lv, R.H. Cloning and functional characterization of the AgDREBA6b gene in response to abiotic stress in celery (Apium graveolens L.). Jiangsu Agric. Sci. 2025, 53, 233–241. [Google Scholar]
  21. Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
  22. Mizoi, J.; Shinozaki, K.; Yamaguchi-Shinozaki, K. AP2/ERF family transcription factors in plant abiotic stress responses. Biochim. Biophys. Acta 2012, 1819, 86–96. [Google Scholar] [CrossRef] [PubMed]
  23. Wijewardene, I.; Mishra, N.; Sun, L.; Smith, J.; Zhu, X.; Payton, P.; Shen, G.; Zhang, H. Improving drought-, salinity-, and heat-tolerance in transgenic plants by co-overexpressing Arabidopsis vacuolar pyrophosphatase gene AVP1 and Larrea Rubisco activase gene RCA. Plant Sci. 2020, 296, 110499. [Google Scholar] [CrossRef]
  24. Tokić, M.; Levanić, D.L.; Ludwig-Müller, J.; Bauer, N. Growth and molecular responses of tomato to prolonged and short-term heat exposure. Int. J. Mol. Sci. 2023, 24, 4456. [Google Scholar] [CrossRef] [PubMed]
  25. Raja, V.; Qadir, S.U.; Alyemeni, M.N.; Ahmad, P. Impact of drought and heat stress individually and in combination on physio-biochemical parameters, antioxidant responses, and gene expression in Solanum lycopersicum. 3 Biotech 2020, 10, 208. [Google Scholar] [CrossRef] [PubMed]
  26. Zhang, L.; Dai, Y.; Yue, L.; Chen, G.; Yuan, L.; Zhang, S.; Li, F.; Zhang, H.; Li, G.; Zhu, S.; et al. Heat stress response in Chinese cabbage (Brassica rapa L.) revealed by transcriptome and physiological analysis. PeerJ 2022, 10, e13427. [Google Scholar] [CrossRef]
  27. Bapela, T.; Shimelis, H.; Tsilo, T.; Mathew, I. Genetic improvement of wheat for drought tolerance: Progress, challenges and opportunities. Plants 2022, 11, 1331. [Google Scholar] [CrossRef]
  28. Zha, Q.; Yin, X.; Xi, X.; Jiang, A. Heterologous VvDREB2c expression improves heat tolerance in Arabidopsis by inducing photoprotective responses. Int. J. Mol. Sci. 2023, 24, 5989. [Google Scholar] [CrossRef]
  29. Mao, L.; Deng, M.; Jiang, S.; Zhu, H.; Yang, Z.; Yue, Y.; Zhao, K. Characterization of the DREBA4-type transcription Factor (SlDREBA4), which contributes to heat tolerance in tomatoes. Front. Plant Sci. 2020, 11, 554520. [Google Scholar] [CrossRef]
  30. Kumar, S.; Muthuvel, J.; Sadhukhan, A.; Kobayashi, Y.; Koyama, H.; Sahoo, L. Enhanced osmotic adjustment, antioxidant defense, and photosynthesis efficiency under drought and heat stress of transgenic cowpea overexpressing an engineered DREB transcription factor. Plant Physiol. Biochem. 2022, 193, 1–13. [Google Scholar] [CrossRef]
  31. Wang, X.; Sun, Y.; Wang, R.; Li, X.Y.; Li, Y.Y.; Wang, T.Y.; Guo, Z.H.; Li, Y.; Qiu, W.X.; Guan, S.Y.; et al. Overexpression of the GmPM35 gene significantly enhances drought tolerance in transgenic Arabidopsis and soybean. Agronomy 2025, 15, 1. [Google Scholar] [CrossRef]
  32. Ren, M.; Yang, W.; Zhang, J.; Zhao, L.; Quan, Y.; He, Z.; Xu, Y.; Zhang, F.; Yin, M.; Wang, Y.; et al. Overexpression of ClRAP2.4 in Chrysanthemum enhances tolerance to cold stress. Funct. Plant Biol. 2023, 50, 470–481. [Google Scholar] [CrossRef] [PubMed]
  33. Mansour, M.M.F.; Ali, E.F. Evaluation of proline functions in saline conditions. Phytochemistry 2017, 140, 52–68. [Google Scholar] [CrossRef] [PubMed]
  34. Wang, D.; Zeng, Y.; Yang, X.; Nie, S. Characterization of DREB family genes in Lotus japonicus and LjDREB2B overexpression increased drought tolerance in transgenic Arabidopsis. BMC Plant Biol. 2024, 24, 497. [Google Scholar] [CrossRef]
  35. Chaudhari, R.S.; Jangale, B.L.; Krishna, B.; Sane, P.V. Improved abiotic stress tolerance in Arabidopsis by constitutive active form of a banana DREB2 type transcription factor, MaDREB20.CA, than its native form, MaDREB20. Protoplasma 2023, 260, 671–690. [Google Scholar] [CrossRef]
  36. Mizoi, J.; Kanazawa, N.; Kidokoro, S.; Takahashi, F.; Qin, F.; Morimoto, K.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Heat-induced inhibition of phosphorylation of the stress-protective transcription factor DREB2A promotes thermotolerance of Arabidopsis thaliana. J. Biol. Chem. 2019, 294, 902–917. [Google Scholar] [CrossRef]
  37. Zhao, K.; Shen, X.; Yuan, H.; Liu, Y.; Liao, X.; Wang, Q.; Liu, L.; Li, F.; Li, T. Isolation and characterization of dehydration-responsive element-binding factor 2C (MsDREB2C) from Malus sieversii Roem. Plant Cell Physiol. 2013, 54, 1415–1430. [Google Scholar] [CrossRef]
  38. Liu, B.; Zhou, Y.; Lan, W.; Zhou, Q.; Li, F.; Chen, F.; Bao, M.; Liu, G. LIDREB1G, a novel DREB subfamily gene from Lilium longiflorum, can enhance transgenic Arabidopsis tolerance to multiple abiotic stresses. Plant Cell Tissue Organ. Cult. 2019, 138, 489–506. [Google Scholar] [CrossRef]
Agronomy 15 01565 g001
Figure 1. The GUS staining of transgenic T2 generation plants of Arabidopsis thaliana with AgDREBA6b gene. From left to right: dreb mutant, WT plants, and 35S:AgDREBA6b/dreb Arabidopsis plants.
Figure 1. The GUS staining of transgenic T2 generation plants of Arabidopsis thaliana with AgDREBA6b gene. From left to right: dreb mutant, WT plants, and 35S:AgDREBA6b/dreb Arabidopsis plants.
Agronomy 15 01565 g001
Agronomy 15 01565 g002
Figure 2. Growth of dreb mutant, WT, and AgDREBA6b/dreb under high-temperature treatment. From left to right: the Arabidopsis mutant plants with knockdown of dreb, WT plants of Arabidopsis, and 35S:AgDREBA6b/dreb plants of Arabidopsis T2 generation, respectively.
Figure 2. Growth of dreb mutant, WT, and AgDREBA6b/dreb under high-temperature treatment. From left to right: the Arabidopsis mutant plants with knockdown of dreb, WT plants of Arabidopsis, and 35S:AgDREBA6b/dreb plants of Arabidopsis T2 generation, respectively.
Agronomy 15 01565 g002
Agronomy 15 01565 g003
Figure 3. Stomatal anatomy of leaves of dreb mutant, WT, and 35S:AgDREBA6b/dreb in Arabidopsis after 4 h of high-temperature treatment.
Figure 3. Stomatal anatomy of leaves of dreb mutant, WT, and 35S:AgDREBA6b/dreb in Arabidopsis after 4 h of high-temperature treatment.
Agronomy 15 01565 g003
Agronomy 15 01565 g004
Figure 4. Chlorophyll a content and chlorophyll fluorescence characteristics of dreb mutant, WT, and 35S:AgDREBA6b/dreb transgenic Arabidopsis plants after 0 h and 24 h of high-temperature treatment. (a) Chlorophyll a content of the dreb mutant, WT, and 35S:AgDREBA6b/dreb transgenic Arabidopsis. (b) Chlorophyll b content of the dreb mutant, WT, and 35S:AgDREBA6b/dreb transgenic Arabidopsis. (c) Total chlorophyll content of the dreb mutant, WT, and 35S:AgDREBA6b/dreb transgenic Arabidopsis. (d) PSII primary light energy conversion efficiency in Arabidopsis dreb mutants, WT, and 35S:AgDREBA6b/dreb transgenic plants. (e) Non-photochemical quenching of the dreb mutant, WT, and 35S:AgDREBA6b/dreb transgenic Arabidopsis. (f) Photochemical quenching of the dreb mutant, WT, and 35S:AgDREBA6b/dreb transgenic Arabidopsis. Letters (a–e) on the vertical bars indicate significant differences at the 0.05 level. Each gene was tested with three biological replicates.
Figure 4. Chlorophyll a content and chlorophyll fluorescence characteristics of dreb mutant, WT, and 35S:AgDREBA6b/dreb transgenic Arabidopsis plants after 0 h and 24 h of high-temperature treatment. (a) Chlorophyll a content of the dreb mutant, WT, and 35S:AgDREBA6b/dreb transgenic Arabidopsis. (b) Chlorophyll b content of the dreb mutant, WT, and 35S:AgDREBA6b/dreb transgenic Arabidopsis. (c) Total chlorophyll content of the dreb mutant, WT, and 35S:AgDREBA6b/dreb transgenic Arabidopsis. (d) PSII primary light energy conversion efficiency in Arabidopsis dreb mutants, WT, and 35S:AgDREBA6b/dreb transgenic plants. (e) Non-photochemical quenching of the dreb mutant, WT, and 35S:AgDREBA6b/dreb transgenic Arabidopsis. (f) Photochemical quenching of the dreb mutant, WT, and 35S:AgDREBA6b/dreb transgenic Arabidopsis. Letters (a–e) on the vertical bars indicate significant differences at the 0.05 level. Each gene was tested with three biological replicates.
Agronomy 15 01565 g004
Agronomy 15 01565 g005
Figure 5. Determination of physiological indicators after 0 h and 24 h of high-temperature treatment in dreb mutant, WT, and 35S:AgDREBA6b/dreb Arabidopsis plants. (a) Pro content of the dreb mutant, WT, and 35S:AgDREBA6b/dreb transgenic Arabidopsis. (b) MDA content of the dreb mutant, WT, and 35S:AgDREBA6b/dreb transgenic Arabidopsis. (c) CAT activity in the dreb mutant, WT, and 35S:AgDREBA6b/dreb transgenic Arabidopsis plants. (d) SOD activity in the dreb mutant, WT, and 35S:AgDREBA6b/dreb transgenic Arabidopsis plants. (e) POD activity in the dreb mutant, WT, and 35S:AgDREBA6b/dreb transgenic Arabidopsis plants. Letters (a–d) on the vertical bars indicate significant differences at the 0.05 level. Each gene was tested with three biological replicates.
Figure 5. Determination of physiological indicators after 0 h and 24 h of high-temperature treatment in dreb mutant, WT, and 35S:AgDREBA6b/dreb Arabidopsis plants. (a) Pro content of the dreb mutant, WT, and 35S:AgDREBA6b/dreb transgenic Arabidopsis. (b) MDA content of the dreb mutant, WT, and 35S:AgDREBA6b/dreb transgenic Arabidopsis. (c) CAT activity in the dreb mutant, WT, and 35S:AgDREBA6b/dreb transgenic Arabidopsis plants. (d) SOD activity in the dreb mutant, WT, and 35S:AgDREBA6b/dreb transgenic Arabidopsis plants. (e) POD activity in the dreb mutant, WT, and 35S:AgDREBA6b/dreb transgenic Arabidopsis plants. Letters (a–d) on the vertical bars indicate significant differences at the 0.05 level. Each gene was tested with three biological replicates.
Agronomy 15 01565 g005
Agronomy 15 01565 g006
Figure 6. Relative expression of the four genes after high-temperature treatment. (a) Relative expression of the AtHSP98.7 gene. (b) Relative expression of the AtHSP70-1 gene. (c) Relative expression of the AtAPX1 gene. (d) Relative expression of the AtGOLS1 gene.
Figure 6. Relative expression of the four genes after high-temperature treatment. (a) Relative expression of the AtHSP98.7 gene. (b) Relative expression of the AtHSP70-1 gene. (c) Relative expression of the AtAPX1 gene. (d) Relative expression of the AtGOLS1 gene.
Agronomy 15 01565 g006
Agronomy 15 01565 g007
Figure 7. Module-centered pattern of the transcriptional regulatory network of AgDREBA6b in response to heat stress; purple arrows indicate increased.
Figure 7. Module-centered pattern of the transcriptional regulatory network of AgDREBA6b in response to heat stress; purple arrows indicate increased.
Agronomy 15 01565 g007
Table 1. qPCR primers for four high-temperature-related genes.
Table 1. qPCR primers for four high-temperature-related genes.
Gene NameForward Primer (5′ → 3′)Reverse Primers (5′ → 3′)
AtHSP98.7F: TGCTTGGACGAGGTGAACTGAGR: CGTTCGGTGATGTAGCGGTCTG
AtHSP70-1F: TGCGTGAGATTGCTGAGGCTTAR: CGGCTGTAGGCTCGTTGATGAT
AtAPX1F: ACTACCCAACCGTGAGCGAAGAR: TGCCATGCGAGTCGGACCAT
AtGOLS1F: ATGGAGTCACACGCCGCAATACR: TGACGCCATAACATCGCAAGGA
AtACT2F: GAAATCACAGCACTTGCACCR: AAGCCTTTGATCTTGAGAGC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Xie, F.; Yang, S.; Peng, Z.; Li, Y.; Yang, Z.; Lv, R. Overexpression of AgDREBA6b Gene Significantly Increases Heat Tolerance in Arabidopsis thaliana. Agronomy 2025, 15, 1565. https://doi.org/10.3390/agronomy15071565

AMA Style

Xie F, Yang S, Peng Z, Li Y, Yang Z, Lv R. Overexpression of AgDREBA6b Gene Significantly Increases Heat Tolerance in Arabidopsis thaliana. Agronomy. 2025; 15(7):1565. https://doi.org/10.3390/agronomy15071565

Chicago/Turabian Style

Xie, Fangjie, Shengyan Yang, Zexi Peng, Yonglu Li, Zhenchao Yang, and Ruiheng Lv. 2025. "Overexpression of AgDREBA6b Gene Significantly Increases Heat Tolerance in Arabidopsis thaliana" Agronomy 15, no. 7: 1565. https://doi.org/10.3390/agronomy15071565

APA Style

Xie, F., Yang, S., Peng, Z., Li, Y., Yang, Z., & Lv, R. (2025). Overexpression of AgDREBA6b Gene Significantly Increases Heat Tolerance in Arabidopsis thaliana. Agronomy, 15(7), 1565. https://doi.org/10.3390/agronomy15071565

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop